CN112481147B - Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof - Google Patents

Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof Download PDF

Info

Publication number
CN112481147B
CN112481147B CN202011451125.8A CN202011451125A CN112481147B CN 112481147 B CN112481147 B CN 112481147B CN 202011451125 A CN202011451125 A CN 202011451125A CN 112481147 B CN112481147 B CN 112481147B
Authority
CN
China
Prior art keywords
gene
gln1
yeast
glutamine
knockout
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011451125.8A
Other languages
Chinese (zh)
Other versions
CN112481147A (en
Inventor
吴艳斌
吴业春
靳海霞
王金羽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Keji Dalong Beijing Biotechnology Co ltd
Original Assignee
Keji Dalong Beijing Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Keji Dalong Beijing Biotechnology Co ltd filed Critical Keji Dalong Beijing Biotechnology Co ltd
Priority to CN202011451125.8A priority Critical patent/CN112481147B/en
Publication of CN112481147A publication Critical patent/CN112481147A/en
Application granted granted Critical
Publication of CN112481147B publication Critical patent/CN112481147B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y603/00Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/01Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
    • C12Y603/01002Glutamate-ammonia ligase (6.3.1.2)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a yeast mutant with a function deletion of glutamine synthetase gene, wherein GLN1 gene of the yeast mutant is deleted with part or all of GLN1 gene and leads to the loss of the function of GLN1 gene. The invention further provides a preparation method and application of the yeast mutant. The yeast mutant with a function of the glutamine synthetase gene which is provided by the invention is difficult to screen even on a culture medium added with glutamine if a gene knockout method is directly adopted in yeast. According to the invention, the functional complementary gene can replace the function of yeast GLN1 by transforming the functional complementary gene, so that colonies with GLN1 knockout fragments can be easily screened.

Description

Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof
Technical Field
The invention relates to the field of biotechnology, in particular to a yeast technology for recombinant modification, and especially relates to a glutamine synthetase gene function-deficient yeast mutant and application thereof in the fields of research and development, medicines, chemical industry and the like.
Background
The defect strain of gene mutation can be obtained by mutagenesis screening of defect strain, site-directed gene knockout can be carried out, the defect strain can be efficiently obtained by screening, and the mutant defect strain with expected gene change can be obtained by homologous recombination accurate replacement of gene sequence.
Glutamine synthetase is a key enzyme for biological nitrogen metabolism, and takes glutamic acid as a substrate and NH4+Glutamine is synthesized and inorganic nitrogen is converted into organic nitrogen. Glutamine synthetase is a target protein of herbicide glufosinate-ammonium, and glufosinate-ammonium occupies a reaction center of the glutamine synthetase through competition with substrate glutamic acid to cause valleyThe synthesis of aminoacyl is terminated, so that the cell can not carry out nitrogen metabolism and NH is generated in the cell4 +The accumulation of the herbicide can lead the cells to be poisoned by ammonium and not to survive, thus leading the plant body to die and achieving the weeding effect. Also, deletion of the glutamine synthetase gene function in yeast results in inability of yeast to grow and difficulty in selection on a corresponding defective medium. With the development of the gene directed evolution technology, the evolution of the glufosinate-ammonium-resistant gene GS also becomes possible, and the mutants of a large number of genes obtained by evolution need to be rapidly and effectively verified. Yeast is a unicellular eukaryote, and is often used as a model eukaryote for research and also for research and application fields of medicine, chemical engineering and the like due to convenient culture operation. In order to eliminate the influence of the endogenous GS gene of yeast, a glutamine synthetase gene function deletion mutant yeast strain is needed to verify the resistance and enzyme activity of the GS gene mutant.
Disclosure of Invention
Based on the above situation, the present invention aims to provide a yeast mutant with a key protein gene of glutamine synthetase gene function deletion, a preparation method of the yeast mutant with the glutamine synthetase gene function deletion and applications of the yeast mutant in research and development, medicine, chemical engineering and other fields.
The invention provides a yeast mutant with a function deletion function of a glutamine synthetase gene, wherein the GLN1 gene of the yeast mutant is deleted with part or all of GLN1 gene and causes the GLN1 gene to lose the function; preferably, the GLN1 gene of the yeast mutant lacks the deoxynucleotide sequence from the 961 st position to the 2113 rd position of the complete GLN1 gene, and the nucleotide sequence of the complete GLN1 gene is SEQ ID NO. 1.
In one embodiment according to the invention, the mutated GLN1 gene has the sequence SEQ ID NO 2.
In one embodiment according to the invention, the yeast mutant cell does not contain an exogenous plasmid.
The invention also provides a preparation method of the yeast mutant with the function deletion of the glutamine synthetase gene, which comprises the following steps:
1) selecting a target section of a GLN1 gene, determining a knockout technology for performing site-directed knockout on the target section, and designing a knockout vector based on an operation principle of the knockout technology; preferably, the knockout technique is selected from any of ZFN, teleen or CRISPR techniques; constructing a gene knockout vector, preferably by means of CRISPR;
2) constructing a functionally complementary gene vector based on the CDS of the GLN1 isogene in other species;
3) constructing a donor sequence containing a GLN1 homologous recombination donor sequence based on the GLN1 gene;
4) simultaneously transforming the excision vector, the function complementary gene vector and the donor sequence in the steps 1) to 3) into a yeast cell;
5) after several days of culture in SC-H + Q medium which is added with glutamine and resistance components corresponding to the resistance gene and does not contain histidine, the yeast strain with the deletion of the 961-2113 position of the GLN1 gene is identified and selected by PCR and stored, and the yeast mutant with the function deletion of the glutamine synthetase gene is obtained.
In one embodiment according to the present invention, the preparation method further comprises:
6) inoculating the yeast mutant strain stored in the step 4) into SC-H + Q culture without resistance components for several days, then separating and inoculating into an SC-H + Q solid culture medium, picking a plurality of single colonies in the SC-H + Q solid culture medium, inoculating each single colony into the SC-H + Q solid culture medium and the SC-H + Q solid culture medium containing the resistance components at the same time, and marking;
7) selecting and storing colonies which can grow on the SC-H + Q solid culture medium and can not grow on the SC-H + Q solid culture medium containing the resistance components after several days; thus obtaining the yeast mutant without the shearing vector plasmid.
In one embodiment according to the present invention, the preparation method further comprises:
8) inoculating the yeast mutant obtained in the step 7) on a YPAD + Q solid culture medium added with glutamine, selecting a single colony to be inoculated on another YPAD + Q solid culture medium added with glutamine again after culturing for several days, selecting a plurality of single colonies after subculturing for 3-5 generations, respectively washing and diluting the single colonies with sterile water, and then respectively inoculating the yeast of each single colony on an SC + Q solid culture medium added with glutamine and an SC-H + Q solid culture medium at the same time and marking; selecting and storing the bacterial strains which can grow on the SC + Q solid culture medium but can not grow on the SC-H + Q solid culture medium, thus obtaining the yeast mutant with the functional complementary gene vector plasmid removed.
In one embodiment according to the invention, the knockout technique in step 1) is selected from any of ZFN, teleen or CRISPR techniques; preferably CRISPR technology.
In one embodiment according to the invention, the GLN1 isogene in step 2) is the CDS sequence of the rice OsGS1 gene, preferably the OsGS1 gene, SEQ ID No. 5; preferably, the function-complementing gene vector comprises a His3 expression cassette (nucleotide sequence is shown as SEQ ID NO: 10), a TEF1 promoter (nucleotide sequence is shown as SEQ ID NO: 11), a CDS sequence (nucleotide sequence is shown as SEQ ID NO: 5) of an OsGS1 gene and an ADH1 terminator (nucleotide sequence is shown as SEQ ID NO: 12) which are connected in sequence.
In one embodiment according to the invention, the donor sequence in step 3) is prepared by a method comprising the following steps:
PCR amplification is carried out by taking genome DNA of a certain yeast strain as a template and using primers GLN1A-F (EQ ID NO:23) and GLN1A-R (EQ ID NO:24) to obtain a segment GLN1 Donor, PCR amplification is carried out by using primers GLN1B-F (SEQ ID NO:26) and GLN1B-R2(SEQ ID NO:27) to obtain a segment GLN1 Donor B, and then overlapping extension PCR amplification is carried out by using a mixture of GLN1-Donor and GLN1-Donor B as a template and using primers GLN1A-F and GLN1B-R2 to obtain a donor sequence.
The invention also provides the application of the yeast mutant with the function deletion of the glutamine synthetase gene or the yeast mutant with the function deletion of the glutamine synthetase gene prepared by the preparation method in the identification of the GS function of yeast, the identification of the resistance of the GS in the yeast to glufosinate-ammonium or the directed evolution identification of the GS.
The technical scheme provided by the invention has the following beneficial effects:
the method provided by the invention can accurately realize gene fragment deletion, so that the GLN1 gene function of the yeast is lost. Meanwhile, considering the situation that mutants are difficult to screen even on a culture medium added with glutamine after the GLN1 gene of the yeast is knocked out, the invention can replace the function of yeast GLN1 by transforming the function complementary gene, thereby screening mutant strains with the GLN1 knock-out fragments more easily.
Drawings
FIG. 1 shows a diagram of YCplac22 vector;
FIG. 2 shows a map of the PY24 vector;
FIG. 3 is a map of PY24-OsGS1 vector;
FIG. 4 shows a map of PY24-OsGS2 vector;
FIG. 5 is a diagram of the PY24-GLN1 vector;
FIG. 6 is a gel electrophoresis image of the identification of GLN1 mutant by PCR;
FIG. 7 is a graph showing the results of GLN1 function loss verification; wherein, 1, Wild Type (WT): yeast strain BY4741 with no endogenous GLN1 knockout; 2. BY4741GLN1ΔEndogenous GLN1 knock-out yeast strain BY4741GLN1Δ(ii) a 3. OsGS 1: yeast strain BY4741 after GLN1 knockoutGLN1ΔTransferring into PY24-OsGS1 vector; 4. OsGS 2: yeast strain BY4741 after GLN1 knockoutGLN1ΔTransferring into PY24-OsGS2 vector; 5. GLN 1: yeast strain BY4741 after GLN1 knockoutGLN1ΔTransferring into PY24-GLN1 vector.
Detailed Description
The following examples are intended to illustrate the present application and are not intended to limit the scope of the present application.
Specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.
In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the present application, but is made for the purpose of illustrating the general principles of the application and not for the purpose of limiting the scope of the application. The protection scope of the present application shall be subject to the definitions of the appended claims.
The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments, and the like used in the following examples were purchased from conventional biochemical reagent suppliers, unless otherwise specified.
It should be understood that although yeast strain BY4741 is used in the examples of the present invention, it is for illustrative purposes only and is not intended to be limiting, and that it is within the scope of the present invention to use other types of yeast strains.
The yeast culture medium used in the invention:
YPAD medium:
10g/L yeast extract, 20g/L peptone, 0.1g/L adenine sulfate, 20g/L D-glucose, pH 5.6. Agar powder 20g/L was added to the solid medium.
YPAD + Q medium:
10g/L yeast extract, 20g/L peptone, 0.1g/L adenine sulfate, 20g/L D-glucose, 0.5 g/L-glutamine, pH 5.6. Agar powder 20g/L was added to the solid medium.
SC medium:
YNB (ammonium sulfate-containing nitrogen source without amino yeast), 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-histidine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, l-uracil 0.1g/L, pH5.6. Agar powder 20g/L was added to the solid medium.
SC + Q medium:
YNB (ammonium sulfate-containing nitrogen source without amino yeast), 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-histidine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, l-, uracil 0.1g/L, L-glutamine 0.5g/L, pH5.6. 20g/L agar powder is also added into the solid culture medium.
SC-H medium:
YNB (containing ammonium sulfate and without amino yeast nitrogen source) 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, L-uracil 0.1g/L, pH 5.6. Agar powder 20g/L was added to the solid medium.
SC-H + Q medium:
YNB (containing ammonium sulfate and without amino yeast nitrogen source) 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, L-uracil 0.1g/L, l-glutamine 0.5g/L, pH 5.6. Agar powder 20g/L was added to the solid medium.
Example 1: a yeast strain with deletion mutation of the function of glutamine synthetase gene GLN1 is prepared.
In this example, 1153 bases of the 961-th-2113 position of the GLN1 gene (nucleotide sequence shown in SEQ ID NO: 1) in yeast were all deleted by transforming a functional complementary gene and homologous recombination to obtain a GLN1 functional deletion mutant. The sequence of the final mutant GLN1 gene is shown in SEQ ID NO. 2. The specific experimental procedure is as follows:
construction of GLN1 Gene specific site knockout vector
The site-directed knockout method can be selected from, but not limited to, ZFN, TELEN or CRISPR and other gene knockout technologies, and can also be selected from other feasible knockout methods. Accurate recombination repair can be realized only by transforming the homologous recombination donor template in yeast, and when the homologous recombination donor template is transformed, the homologous recombination repair frequency can be increased by simultaneously transforming the gene site-specific knockout vector.
The method for selecting CRISPR in the research shows that two target spots GLN1sg3 and GLN1sg5 are designed on the GLN1 gene of the yeast (the target spot design is referred to http:// chopchop. A knockout vector PY10 is constructed and obtained by taking a pCAS (Addgene No. 60847) vector as a framework through a Gibson assembly method, PY10 contains G418 resistance, the specific steps are as follows,
the pCAS vector is subjected to double digestion by SmaI and BglII to recover a large fragment for later use, and PCR amplification is respectively carried out by using four pairs of primers with pCAS as a template, wherein the four pairs of primers comprise a pCas-gF1/GLN1sg3-R1 amplification product sequence A, a GLN1sg3-F1/P1sg1-R2 amplification product sequence B, a P1sg2-F1/GLN1sg5-R2 amplification product sequence C, and a GLN1sg5-F1/pCas-gR1 amplification product sequence D. The pCAS vector is prepared by using SmaI and BglII to carry out double enzyme digestion to recover a large fragment, then assembling the large fragment and A, B, C, D fragments through Gibson, and obtaining a vector PY10, wherein the PY10 contains two GLN1 target spots with the following sequence,
(SEQ ID NO:8)GLN1sg3 ATCATGTGTGAAACTGTTTG;
(SEQ ID NO:9)GLN1sg5 TATCTAGAACTGGACCAAAG。
construction of GLN1 function-complementing Gene vector
Transformation of the vector YCplac22(GenBank: X75455, shown in FIG. 1) firstly replaced Trp1 in YCplac22 by His3 expression cassette by Gibson assembly, and secondly linked TEF1 promoter and ADH1 terminator with YCplac22 to obtain the vector PY24 (shown in FIG. 2). Then, the rice Nipponbare cDNA is used as a template, a primer Y24 GS1-F/Y24 GS1-R is used for PCR amplification to obtain rice OsGS1 gene CDS, and the rice OsGS1 gene CDS is connected with a PY24 vector to obtain PY24-OsGS1 (shown in figure 3).
PCR method for preparing GLN1 homologous recombination Donor sequence GLN1 Donor
Taking yeast strain BY4741 genome DNA as a template, carrying out PCR amplification BY using primers GLN1A-F and GLN1A-R to obtain a fragment GLN1 Donor, carrying out PCR amplification BY using primers GLN1B-F and GLN1B-R2 to obtain a fragment GLN1 Donor B, and carrying out overlap extension PCR amplification BY using a mixture of GLN1-Donor and GLN1-Donor B as a template and using primers GLN1A-F and GLN1B-R2 to obtain GLN1 Donor, wherein the nucleotide sequence is shown as SEQ ID NO: 4.
4. Transformed yeast
Yeast BY4741 was co-transformed using 1ug of vector PY10, 1ug of vector PY24-OsGS1 and 5ug of GLN1 Donor heat shock method, and the transformed yeast was spread on SC-H + Q plates containing 200mg/L G418 and cultured at 30 ℃ for 3-5 days.
5. Screening of mutants
Selecting yeast colonies which grow for 3-5 days on the plate obtained in the step 4, picking 16 colonies with toothpicks to inoculate into 5mL of SC-H + Q medium containing 200mg/L G418, culturing for 1-2 days at 30 ℃, and extracting yeast genome DNA. Yeast genome DNA is used as a template, primer GLNA-F3/GLN1B-R2 is used for PCR amplification, and only colonies which can amplify to 243bp length and not to 243bp length, or colonies which can amplify to fragments with 243bp and 1396bp length simultaneously, or colonies which amplify to fragments with 1396bp length are discarded. The colony amplified to 243bp length is sequenced by using a primer GLNA-F3/GLN1B-R2, the same sequence as SEQ ID NO. 2 is screened from the sequence, the obtained colony is the yeast strain of which the 961-th and 2113-th bases of the GLN1 gene are completely deleted, and the strain is preserved.
6. Removal of sheared vector plasmids in Yeast
According to the screening results of step 5, colonies of the corresponding yeast mutants were picked from the SC-H + Q plates containing 200mg/L G418 in step 4, inoculated into 5mL of SC-H + Q medium, and cultured at 30 ℃ for 1-2 days. Overnight cultured broth was streaked onto SC-H + Q plates using a streaking method. Single colonies were picked from the SC-H + Q plate, inoculated into 5mL of SC-H + Q medium, and cultured at 30 ℃ for 1-2 days. The cultured bacterial suspension was applied simultaneously to SC-H + Q plates and SC-H + Q plates containing 200mg/L G418, respectively, by streaking. If growth was possible on SC-H + Q plates but not on SC-H + Q plates containing G418, it was confirmed that the sheared vector plasmid had been removed from the strain, and the selected yeast strain was preserved.
7. Removal of PY24-OsGS1 vector plasmid from yeast
According to the screening result of step 6, diluting the screened strain 1000 times, taking 50ul of coated YPAD + Q plate, culturing for 3-5 days at 30 ℃, picking up a single colony, scattering in 1000ml of sterile water, taking 50ul of coated YPAD + Q plate, culturing for 3-5 days at 30 ℃. Then, single colonies were picked from this YPAD + Q plate and scattered in 1000ml of sterile water, followed by culturing on 50ul of the spread YPAD + Q plate at 30 ℃ for 3-5 days. Subculture is needed for 3-5 generations, single colonies are picked and scattered with 200uL of sterile water, the single colonies are washed for 1-2 times with the sterile water and finally scattered in 50uL of sterile water, and 1uL of bacterial liquid is taken and respectively spotted on an SC + Q plate and an SC-H + Q plate. If the strain can grow on an SC + Q plate but cannot grow on an SC-H + Q plate, the strain is proved that the PY24-OsGS1 plasmid in the strain is removed, the obtained colony is the required yeast mutant which is 1153 basic groups of 961-2113 of GLN1 gene, and the screened yeast strain BY4741 which does not contain PY10 and PY24-OsGS1 plasmids and is mutated BY GLN1 gene is preservedGLN1Δ
Example 2: functional verification of GLN 1-deleted Yeast mutant obtained in example 1
In example 1, the rice-derived OsGS1 gene had been able to complement the function of yeast GLN1, and in order to further confirm the functional deletion of the GLN1 mutation, the rice-derived OsGS2 gene (SEQ ID NO: 6) and the yeast-endogenous gene GLN1 CDS (SEQ ID NO: 7) were selected for functional complementation verification, and the OsGS2 gene was a sequence from which the signal peptide was deleted.
Constructing a GLN1 function complementary vector, carrying out PCR amplification by using a primer Y24 GS2-F/Y24 GS2-R to obtain OsGS2, and carrying out PCR amplification by using Y24 GLN1-F/Y24 GLN1-R to obtain GLN 1. OsGS2 and GLN1 are Gibson assembled with PY24 to obtain vectors PY24-OsGS2 (shown in FIG. 4) and PY24-GLN1 (shown in FIG. 5), respectively.
The obtained vectors PY24-OsGS1, PY24-OsGS2 and PY24-GLN1 are respectively transformed into a yeast mutant strain BY4741 BY a heat shock methodGLN1ΔCoating an SC-H + Q plate, culturing for 3-5 days at 30 ℃, selecting a single colony to inoculate bacteria in 5mL of SC-H + Q culture medium, and culturing for 1-2 days at 30 ℃. Cleaning 50ul of the bacterial solution with sterile water twice, diluting to OD600 of about 0.1, and respectively dropping 1ul of the bacterial solution on YPAD, YPAD + Q, YPAD + Q + G418, SC + QAnd SC-H plates, and the results are shown in FIG. 7, when they were observed after culturing at 30 ℃ for 3 to 5 days.
The fig. 7 template is as follows:
1. wild Type (WT): yeast strain BY4741 with no endogenous GLN1 knockout;
2、BY4741GLN1Δendogenous GLN1 knock-out yeast strain BY4741GLN1Δ
3. OsGS 1: yeast strain BY4741 after GLN1 knockoutGLN1ΔTransferring into PY24-OsGS1 vector;
4. OsGS 2: yeast strain BY4741 after GLN1 knockoutGLN1ΔTransferring into PY24-OsGS2 vector;
5. GLN 1: yeast strain BY4741 after GLN1 knockoutGLN1ΔTransferring into PY24-GLN1 vector.
After 3-5 days of culture at 30 ℃, all the bacteria can grow on YPAD + Q plates; BY4741 on YPAD PLATEGLN1ΔNo growth occurs; all bacteria were unable to grow on YPAD + Q + G148 plates, demonstrating that PY10 had been removed; on SC plate only BY4741GLN1ΔNo growth occurs; all bacteria can grow on the SC + Q plate; growth of WT and BY4741 on SC-H platesGLN1ΔNo growth was observed, demonstrating that PY24-OsGS1 had been removed. The combined colony growth conditions of OsGS1, OsGS2 and GLN1 can complement BY4741GLN1ΔLoss of function. In addition, BY4741GLN1ΔCan grow in liquid YPAD medium, but has a growth rate slower than that in YPAD + Q and SC + Q, BY4741GLN1ΔCan grow in liquid YPAD + Q and SC + Q culture medium for 24-48 hr, and in liquid YPDA for 48-72 hr, at 30 deg.c and 220-250 rpm.
It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the examples given, those skilled in the art can modify the technical solution of the present invention as needed or equivalent substitutions without departing from the spirit and scope of the technical solution of the present invention.
Gene sequences related to the invention
SEQ ID NO 1 GLN1 genome sequence, 1000bp upstream of ATG and 500bp downstream of TAA;
AAACAGCCATTTTTCAATATGCGCTACCCGGCGGCGGAATATCGTCCCAGCTACATGATAGCCGCTTTTTTGTCTCTCTTTGTCCCACCTGTTCAAAGACATTTGGTAATCAGTTTGTCAGGACAATAGTAAACAAAAGTGCGCAAGTACACATGCGCTGCACGTGCGGCCGGAACAATGGCGCTTTTGGCTCGTCCGGATGATGCGAAAGGGAAAATAAAATCTCGCAATCGGAAAAACACTCGCGAGAACCAAAACAAGGATCCCCTAAACCCAGTACCCGCATACGGTTCTCCCGGGGAAAAGGGGGCGGAGGCCGGACGATGAGTGTTACCCGGATAGGACTACGGATCGCTTCGCACGTTTGTTTACAATTGATGACTGCGCTCCCCTAATAGATAAGATAAGCTCGCGAAGGCAGAAAAAAAAAAGTCTTCTACAGCAGTTGGTCCGCACAGACGATGCCAGACGGTGTTTTATCGAAAATTTTTTTCGCATCATAGTGCCATTTGTGGTCATTATTATTCCCCAAATATGCGAAAATAGTACACTATTTTTGGCAGGAGAGTAGGCTGATATGCCGCATTGATGTCCTGTGTAGCGAAACACAAACAAAAAAAGAAAAAGTAGGATGAAAAAAAGAAAAGTAATATGAAAAAAGAGTGAAAAATTAATTCATTTGTTAGTGTAAGCGGTCAGGTGTAAGTAGTAGGCTTGATAATGAATTAAAGATGACTCCGACGCATATTGTTTGCCATGTTTTTATTTTAGTTTGTAGATTTCTTTTTTTGTAATATATAAGGGAGTGATTCTATATATCGAATTCTCAGGCTTGGTTGGTTCGTAGGTTGTTCTGTCTTTGTTTTCGTTAGGTAAGAACATCACACAAAGATAACTATAGAATCACATACATATTTGTGAGAAATTAACTTCATTTCATTTATAGAAGAAGTTCAACCGAAACAAAAATTAAACATAATATAATATAATATAATCAAAAATGGCTGAAGCAAGCATCGAAAAGACTCAAATTTTACAAAAATATCTAGAACTGGACCAAAGAGGTAGAATAATTGCCGAATACGTTTGGATCGATGGTACTGGTAACTTACGTTCCAAAGGTAGAACTTTGAAGAAGAGAATCACATCCATTGACCAATTGCCAGAATGGAACTTCGACGGTTCTTCTACCAACCAAGCGCCAGGCCACGACTCTGACATCTATTTGAAACCCGTTGCTTACTACCCAGATCCCTTCAGGAGAGGTGACAACATTGTTGTCTTGGCCGCATGTTACAACAATGACGGTACTCCAAACAAGTTCAACCACAGACACGAAGCTGCCAAGCTATTTGCTGCTCATAAGGATGAAGAAATCTGGTTTGGTCTAGAACAAGAATACACTCTATTTGACATGTATGACGATGTTTACGGATGGCCAAAGGGTGGGTACCCAGCTCCACAAGGTCCTTACTACTGTGGTGTTGGTGCCGGTAAGGTTTATGCCAGAGACATGATCGAAGCTCACTACAGAGCTTGTTTGTATGCCGGATTAGAAATTTCTGGTATTAACGCTGAAGTCATGCCATCTCAATGGGAATTCCAAGTCGGTCCATGTACCGGTATTGACATGGGTGACCAATTATGGATGGCCAGATACTTTTTGCACAGAGTGGCAGAAGAGTTTGGTATCAAGATCTCATTCCATCCAAAGCCATTGAAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAACACATTAAGTTGTACGGTAGCGATAACGACATGAGATTAACTGGTAGACATGAAACCGCTTCCATGACTGCCTTTTCTTCTGGTGTCGCCAACAGAGGTAGCTCAATTAGAATCCCAAGATCCGTCGCCAAGGAAGGTTACGGTTACTTTGAAGACCGTAGACCAGCTTCCAACATCGACCCATACTTGGTTACAGGTATCATGTGTGAAACTGTTTGCGGTGCTATTGACAATGCTGACATGACGAAGGAATTTGAAAGAGAATCTTCATAAGCATAATACAATGGTGCAAAATTTTTTTTAGGCAGGAACTAATCTACTAATAAACTAACAATAATGCACAGGAAATATTAATGATTTATTTATTTATTTTACTACTATATTACATTACTTTTTTACATAAAAAATTTCCCATCTCACGATCAAAAACAGGCATGAGAAAAAATCAAAATTTATAAAATTAATTTCTAATAAATTAACTGTAATGACATAAAATAAGAGGCTGCGACAGTCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAATAATTTTCTATTGTTTTCCTCATGCCATTACCCTACCTACCCGTGCATAATTACACGAGGGGGAGAGCTTTTTCTTCCCAAACCAGACCAGGAAAAAAAAAAAGGTTTGATAATGAAAAAAAAAAAAAGTATTGTATATGACTGTTTTCCTGATAAAAGAATGCCTGCAATAATTCAAAGACAAGAGATATAAAAGTGCACTG
2 GLN1 KO genome sequence Precisely knocked out CDS region sequence
AAACAGCCATTTTTCAATATGCGCTACCCGGCGGCGGAATATCGTCCCAGCTACATGATAGCCGCTTTTTTGTCTCTCTTTGTCCCACCTGTTCAAAGACATTTGGTAATCAGTTTGTCAGGACAATAGTAAACAAAAGTGCGCAAGTACACATGCGCTGCACGTGCGGCCGGAACAATGGCGCTTTTGGCTCGTCCGGATGATGCGAAAGGGAAAATAAAATCTCGCAATCGGAAAAACACTCGCGAGAACCAAAACAAGGATCCCCTAAACCCAGTACCCGCATACGGTTCTCCCGGGGAAAAGGGGGCGGAGGCCGGACGATGAGTGTTACCCGGATAGGACTACGGATCGCTTCGCACGTTTGTTTACAATTGATGACTGCGCTCCCCTAATAGATAAGATAAGCTCGCGAAGGCAGAAAAAAAAAAGTCTTCTACAGCAGTTGGTCCGCACAGACGATGCCAGACGGTGTTTTATCGAAAATTTTTTTCGCATCATAGTGCCATTTGTGGTCATTATTATTCCCCAAATATGCGAAAATAGTACACTATTTTTGGCAGGAGAGTAGGCTGATATGCCGCATTGATGTCCTGTGTAGCGAAACACAAACAAAAAAAGAAAAAGTAGGATGAAAAAAAGAAAAGTAATATGAAAAAAGAGTGAAAAATTAATTCATTTGTTAGTGTAAGCGGTCAGGTGTAAGTAGTAGGCTTGATAATGAATTAAAGATGACTCCGACGCATATTGTTTGCCATGTTTTTATTTTAGTTTGTAGATTTCTTTTTTTGTAATATATAAGGGAGTGATTCTATATATCGAATTCTCAGGCTTGGTTGGTTCGTAGGTTGTTCTGTCTTTGTTTTCGTTAGGTAAGAACATCACACAAAGATAACTATAGAATCACATACATATTTGTGAGAAATTAACTTCATTTCATTTATAGAAGAAGTTCAACCGGCATAATACAATGGTGCAAAATTTTTTTTAGGCAGGAACTAATCTACTAATAAACTAACAATAATGCACAGGAAATATTAATGATTTATTTATTTATTTTACTACTATATTACATTACTTTTTTACATAAAAAATTTCCCATCTCACGATCAAAAACAGGCATGAGAAAAAATCAAAATTTATAAAATTAATTTCTAATAAATTAACTGTAATGACATAAAATAAGAGGCTGCGACAGTCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAATAATTTTCTATTGTTTTCCTCATGCCATTACCCTACCTACCCGTGCATAATTACACGAGGGGGAGAGCTTTTTCTTCCCAAACCAGACCAGGAAAAAAAAAAAGGTTTGATAATGAAAAAAAAAAAAAGTATTGTATATGACTGTTTTCCTGATAAAAGAATGCCTGCAATAATTCAAAGACAAGAGATATAAAAGTGCACTG
1153bp of sequence knocked out by SEQ ID NO 3 GLN1 genome sequence
AAACAAAAATTAAACATAATATAATATAATATAATCAAAAATGGCTGAAGCAAGCATCGAAAAGACTCAAATTTTACAAAAATATCTAGAACTGGACCAAAGAGGTAGAATAATTGCCGAATACGTTTGGATCGATGGTACTGGTAACTTACGTTCCAAAGGTAGAACTTTGAAGAAGAGAATCACATCCATTGACCAATTGCCAGAATGGAACTTCGACGGTTCTTCTACCAACCAAGCGCCAGGCCACGACTCTGACATCTATTTGAAACCCGTTGCTTACTACCCAGATCCCTTCAGGAGAGGTGACAACATTGTTGTCTTGGCCGCATGTTACAACAATGACGGTACTCCAAACAAGTTCAACCACAGACACGAAGCTGCCAAGCTATTTGCTGCTCATAAGGATGAAGAAATCTGGTTTGGTCTAGAACAAGAATACACTCTATTTGACATGTATGACGATGTTTACGGATGGCCAAAGGGTGGGTACCCAGCTCCACAAGGTCCTTACTACTGTGGTGTTGGTGCCGGTAAGGTTTATGCCAGAGACATGATCGAAGCTCACTACAGAGCTTGTTTGTATGCCGGATTAGAAATTTCTGGTATTAACGCTGAAGTCATGCCATCTCAATGGGAATTCCAAGTCGGTCCATGTACCGGTATTGACATGGGTGACCAATTATGGATGGCCAGATACTTTTTGCACAGAGTGGCAGAAGAGTTTGGTATCAAGATCTCATTCCATCCAAAGCCATTGAAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAACACATTAAGTTGTACGGTAGCGATAACGACATGAGATTAACTGGTAGACATGAAACCGCTTCCATGACTGCCTTTTCTTCTGGTGTCGCCAACAGAGGTAGCTCAATTAGAATCCCAAGATCCGTCGCCAAGGAAGGTTACGGTTACTTTGAAGACCGTAGACCAGCTTCCAACATCGACCCATACTTGGTTACAGGTATCATGTGTGAAACTGTTTGCGGTGCTATTGACAATGCTGACATGACGAAGGAATTTGAAAGAGAATCTTCATAA
Donor sequence for recombinant knockout of SEQ ID NO 4 GLN1 Donor
GGCTTGGTTGGTTCGTAGGTTGTTCTGTCTTTGTTTTCGTTAGGTAAGAACATCACACAAAGATAACTATAGAATCACATACATATTTGTGAGAAATTAACTTCATTTCATTTATAGAAGAAGTTCAACCGGCATAATACAATGGTGCAAAATTTTTTTTAGGCAGGAACTAATCTACTAATAAACTAACAATAATGCACAGGAA
5 Rice OsGS1 Gene CDS sequence
ATGGCTTCTCTCACCGATCTCGTCAACCTCAACCTCTCCGACACCACGGAGAAGATCATCGCCGAGTACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAGGCTAGGACTCTCTCCGGCCCTGTGACTGATCCCAGCAAGCTGCCCAAGTGGAACTACGATGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGTGAGGTCATCCTGTACCCACAGGCTATCTTCAAGGACCCATTCAGGAAGGGAAACAACATCCTTGTCATGTGCGATTGCTACACGCCAGCCGGAGAACCGATCCCCACCAACAAGAGGCACAATGCTGCCAAGATCTTCAGCTCCCCTGAGGTTGCTTCTGAGGAGCCCTGGTACGGTATTGAGCAAGAGTACACCCTCCTCCAGAAGGACATCAACTGGCCCCTTGGCTGGCCTGTTGGTGGCTTCCCTGGTCCTCAGGGTCCTTACTACTGTGGTATCGGTGCTGACAAGTCTTTTGGGCGTGATATTGTTGACTCCCACTACAAGGCTTGCCTCTATGCCGGCATCAACATCAGTGGAATCAACGGCGAGGTCATGCCAGGACAGTGGGAGTTCCAAGTTGGCCCGTCTGTCGGCATTTCTGCCGGTGATCAGGTGTGGGTTGCTCGCTACATTCTTGAGAGGATCACCGAGATCGCCGGAGTCGTCGTCTCATTTGACCCCAAGCCCATCCCGGGAGACTGGAACGGTGCTGGTGCTCACACCAACTACAGCACCAAGTCGATGAGGAACGATGGTGGCTACGAGATCATCAAGTCCGCCATTGAGAAGCTCAAGCTCAGGCACAAGGAGCACATCTCCGCCTACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGAGTTGCCAACCGCGGCGCCTCGGTCCGCGTCGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGATCGCCGGCCGGCGTCCAACATGGACCCTTACATCGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA
6 Rice OsGS2 Gene CDS sequence Signal peptide sequence removed
ATGGCGCAGGCGGTGGTGCCGGCGATGCAGTGCCAGGTCGGGGCCGTGCGGGCGAGGCCGGCGGCGGCTGCGGCGGCGGCGGGGGGGAGGGTGTGGGGAGTCAGGAGGACCGGGCGCGGCACGTCGGGGTTCAGGGTGATGGCCGTGAGCACGGAGACCACCGGGGTGGTGACGCGGATGGAGCAGCTGCTCAACATGGACACCACCCCCTTCACCGACAAGATCATCGCCGAGTACATCTGGGTTGGAGGAACTGGAATTGACCTCAGAAGCAAATCAAGGACAATATCAAAACCAGTGGAGGACCCCTCGGAGCTACCAAAATGGAACTACGATGGATCAAGCACAGGGCAAGCTCCAGGAGAAGATAGTGAAGTCATCTTATACCCACAGGCTATATTCAAGGACCCATTTCGAGGTGGCAACAACATATTGGTTATGTGTGATACCTACACACCAGCTGGGGAACCCATCCCTACTAACAAACGTAACAGGGCTGCACAAGTATTCAGTGATCCAAAGGTTGTCAGCCAAGTGCCATGGTTTGGAATAGAACAGGAGTACACTTTGCTCCAGAGAGACGTAAACTGGCCTCTTGGCTGGCCCGTTGGAGGCTACCCTGGGCCCCAGGGTCCATACTACTGCGCTGTAGGATCGGACAAATCGTTTGGCCGTGACATATCAGATGCTCACTACAAGGCATGTCTTTATGCTGGAATTAACATTAGTGGAACAAATGGAGAGGTCATGCCTGGTCAGTGGGAGTACCAGGTTGGACCTAGTGTCGGTATTGAAGCTGGAGACCACATATGGATTTCAAGATATATTCTTGAGAGAATAACGGAGCAGGCTGGTGTAGTGCTTACCCTTGACCCCAAACCAATTCAGGGAGACTGGAATGGAGCTGGGTGCCACACAAACTACAGCACCAAGAGTATGCGTGAAGATGGAGGATTTGAGGTGATCAAGAAGGCAATCCTAAACCTATCACTTCGCCATGACTTGCATATAAGTGCATATGGTGAAGGAAATGAAAGGAGGTTGACAGGTTTACACGAGACAGCTAGCATTGACAATTTCTCATGGGGTGTGGCAAACCGTGGATGCTCTATTCGGGTGGGGCGAGACACCGAGGCGAAGGGAAAAGGCTACTTGGAAGACCGTCGCCCGGCATCAAACATGGACCCGTACGTCGTGACAGCGCTATTGGCTGAAACCACAATTCTTTGGGAGCCAACCCTCGAAGCGGAGGTTCTTGCTGCTAAGAAGTTGGCCCTGAAGGTATGA
CDS sequence of yeast GLN1 gene of SEQ ID NO 7
ATGGCTGAAGCAAGCATCGAAAAGACTCAAATTTTACAAAAATATCTAGAACTGGACCAAAGAGGTAGAATAATTGCCGAATACGTTTGGATCGATGGTACTGGTAACTTACGTTCCAAAGGTAGAACTTTGAAGAAGAGAATCACATCCATTGACCAATTGCCAGAATGGAACTTCGACGGTTCTTCTACCAACCAAGCGCCAGGCCACGACTCTGACATCTATTTGAAACCCGTTGCTTACTACCCAGATCCCTTCAGGAGAGGTGACAACATTGTTGTCTTGGCCGCATGTTACAACAATGACGGTACTCCAAACAAGTTCAACCACAGACACGAAGCTGCCAAGCTATTTGCTGCTCATAAGGATGAAGAAATCTGGTTTGGTCTAGAACAAGAATACACTCTATTTGACATGTATGACGATGTTTACGGATGGCCAAAGGGTGGGTACCCAGCTCCACAAGGTCCTTACTACTGTGGTGTTGGTGCCGGTAAGGTTTATGCCAGAGACATGATCGAAGCTCACTACAGAGCTTGTTTGTATGCCGGATTAGAAATTTCTGGTATTAACGCTGAAGTCATGCCATCTCAATGGGAATTCCAAGTCGGTCCATGTACCGGTATTGACATGGGTGACCAATTATGGATGGCCAGATACTTTTTGCACAGAGTGGCAGAAGAGTTTGGTATCAAGATCTCATTCCATCCAAAGCCATTGAAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAACACATTAAGTTGTACGGTAGCGATAACGACATGAGATTAACTGGTAGACATGAAACCGCTTCCATGACTGCCTTTTCTTCTGGTGTCGCCAACAGAGGTAGCTCAATTAGAATCCCAAGATCCGTCGCCAAGGAAGGTTACGGTTACTTTGAAGACCGTAGACCAGCTTCCAACATCGACCCATACTTGGTTACAGGTATCATGTGTGAAACTGTTTGCGGTGCTATTGACAATGCTGACATGACGAAGGAATTTGAAAGAGAATCTTCATAA
Target sequence of SEQ ID NO 8 GLN1sg3
ATCATGTGTGAAACTGTTTG
Target sequence of SEQ ID NO 9 GLN1sg5
TATCTAGAACTGGACCAAAG
10 His3 expression cassette sequence
TCGAGTTCAAGAGAAAAAAAAAGAAAAAGCAAAAAGAAAAAAGGAAAGCGCGCCTCGTTCAGAATGACACGTATAGAATGATGCATTACCTTGTCATCTTCAGTATCATACTGTTCGTATACATACTTACTGACATTCATAGGTATACATATATACACATGTATATATATCGTATGCTGCAGCTTTAAATAATCGGTGTCACTACATAAGAACACCTTTGGTGGAGGGAACATCGTTGGTACCATTGGGCGAGGTGGCTTCTCTTATGGCAACCGCAAGAGCCTTGAACGCACTCTCACTACGGTGATGATCATTCTTGCCTCGCAGACAATCAACGTGGAGGGTAATTCTGCTAGCCTCTGCAAAGCTTTCAAGAAAATGCGGGATCATCTCGCAAGAGAGATCTCCTACTTTCTCCCTTTGCAAACCAAGTTCGACAACTGCGTACGGCCTGTTCGAAAGATCTACCACCGCTCTGGAAAGTGCCTCATCCAAAGGCGCAAATCCTGATCCAAACCTTTTTACTCCACGCACGGCCCCTAGGGCCTCTTTAAAAGCTTGACCGAGAGCAATCCCGCAGTCTTCAGTGGTGTGATGGTCGTCTATGTGTAAGTCACCAATGCACTCAACGATTAGCGACCAGCCGGAATGCTTGGCCAGAGCATGTATCATATGGTCCAGAAACCCTATACCTGTGTGGACGTTAATCACTTGCGATTGTGTGGCCTGTTCTGCTACTGCTTCTGCCTCTTTTTCTGGGAAGATCGAGTGCTCTATCGCTAGGGGACCACCCTTTAAAGAGATCGCAATCTGAATCTTGGTTTCATTTGTAATACGCTTTACTAGGGCTTTCTGCTCTGTCATCTTTGCCTTCGTTTATCTTGCCTGCTCATTTTTTAGTATATTCTTCGAAGAAATCACATTACTTTATATAATGTATAATTCATTATGTGATAATGCCAATCGCTAAGAAAAAAAAAGAGTCATCCGCTAGGTGGAAAAAAAAAAATGAAAATCATTACCGAGGCATAAAAAAATATAGAGTGTACTAGAGGAGGCCAAGAGTAATAGAAAAAGAAAATTGCGGGAAAGGACTGTGTTATGACTTCCCTGACTAATGCCGTGTTCAAACGATACCTGGCAGTGACTCCTAGCGCTCACCAAGCTCTTAAAACGGGAATT
11 TEF1 promoter sequence
CACACACCATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGACTCCGCGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATACTAAATTTCCCCTCTTTCTTCCTCTAGGGTGTCGTTAATTACCCGTACTAAAGGTTTGGAAAAGAAAAAAGAGACCGCCTCGTTTCTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTTTTTCTTGAAAATTTTTTTTTTTGATTTTTTTCTCTTTCGATGACCTCCCATTGATATTTAAGTTAATAAACGGTCTTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACTTTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGTTTTAATTACAAA
12 ADH1 terminator sequence
CGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTC
Primer name and primer nucleotide sequence (5 '-3')
SEQ ID NO:13 Y24 GS1-F
CAAACTCTAGAGGATCCCCATGGCTTCTCTCACCGATCTCGTCA
SEQ ID NO:14 Y24 GS1-R
ATTCGCGAGCTCGGTACCCTCAGGGCTTCCAGATGATGGTGGTCT
SEQ ID NO:15 pCas-gF1
GGGCGTTCGACTCGCCCCCGGGAGAGATGGCCGGCATGGTCCCA
SEQ ID NO:16 GLN1sg3-R1
CAAACAGTTTCACACATGATAAAGTCCCATTCGCCACCCGAAGGTG
SEQ ID NO:17 GLN1sg3-F1
ATCATGTGTGAAACTGTTTGGTTTTAGAGCTAGAAATAGCAAGTT
SEQ ID NO:18 P1sg1-R2
GCCGGCCATCAAAAGCACCGACTCGGTGCCACTTTTTC
SEQ ID NO:19 P1sg2-F1
CGGTGCTTTTGATGGCCGGCATGGTCCCAGCCTCCT
SEQ ID NO:20 GLN1sg5-R2
CTTTGGTCCAGTTCTAGATAAAAGTCCCATTCGCCACCCGAAGGTG
SEQ ID NO:21 GLN1sg5-F1
TATCTAGAACTGGACCAAAGGTTTTAGAGCTAGAAATAGCAAGTT
SEQ ID NO:22 pCas-gR1
GGACGAGGCAAGCTAAACAGATCTCTAGACCTATATCCACTAGAC
SEQ ID NO:23 GLN1A-F
GGCTTGGTTGGTTCGTAGGTTGT
SEQ ID NO:24 GLN1A-R
TGTATTATGCCGGTTGAACTTCTTCTATAAATGAAATG
SEQ ID NO:25 GLNA-F3
TAATATATAAGGGAGTGATTCTATATATC
SEQ ID NO:26 GLN1B-F
AGTTCAACCGGCATAATACAATGGTGCAAAATTTTTTTTAG
SEQ ID NO:27 GLN1B-R2
TTCCTGTGCATTATTGTTAGTTTATTAG
SEQ ID NO:28 Y24 GS2-F
caaactctagaggatccccATGGCCGTGAGCACGGAGACCACCG
SEQ ID NO:29 Y24 GS2-R
attcgcgagctcggtacccTCATACCTTCAGGGCCAACTTCTTAG
SEQ ID NO:30 Y24 GLN1-F
caaactctagaggatccccATGGCTGAAGCAAGCATCGAAAAGACTCAA
SEQ ID NO:31 Y24 GLN1-R
attcgcgagctcggtacccCTATGAAGATTCTCTTTCAAATTCCTTCGT
Sequence listing
<110> Kochia-Davida Biotechnology Ltd
<120> yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof
<160> 31
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2613
<212> DNA
<213> Saccharomyces cerevisiae
<400> 1
aaacagccat ttttcaatat gcgctacccg gcggcggaat atcgtcccag ctacatgata 60
gccgcttttt tgtctctctt tgtcccacct gttcaaagac atttggtaat cagtttgtca 120
ggacaatagt aaacaaaagt gcgcaagtac acatgcgctg cacgtgcggc cggaacaatg 180
gcgcttttgg ctcgtccgga tgatgcgaaa gggaaaataa aatctcgcaa tcggaaaaac 240
actcgcgaga accaaaacaa ggatccccta aacccagtac ccgcatacgg ttctcccggg 300
gaaaaggggg cggaggccgg acgatgagtg ttacccggat aggactacgg atcgcttcgc 360
acgtttgttt acaattgatg actgcgctcc cctaatagat aagataagct cgcgaaggca 420
gaaaaaaaaa agtcttctac agcagttggt ccgcacagac gatgccagac ggtgttttat 480
cgaaaatttt tttcgcatca tagtgccatt tgtggtcatt attattcccc aaatatgcga 540
aaatagtaca ctatttttgg caggagagta ggctgatatg ccgcattgat gtcctgtgta 600
gcgaaacaca aacaaaaaaa gaaaaagtag gatgaaaaaa agaaaagtaa tatgaaaaaa 660
gagtgaaaaa ttaattcatt tgttagtgta agcggtcagg tgtaagtagt aggcttgata 720
atgaattaaa gatgactccg acgcatattg tttgccatgt ttttatttta gtttgtagat 780
ttcttttttt gtaatatata agggagtgat tctatatatc gaattctcag gcttggttgg 840
ttcgtaggtt gttctgtctt tgttttcgtt aggtaagaac atcacacaaa gataactata 900
gaatcacata catatttgtg agaaattaac ttcatttcat ttatagaaga agttcaaccg 960
aaacaaaaat taaacataat ataatataat ataatcaaaa atggctgaag caagcatcga 1020
aaagactcaa attttacaaa aatatctaga actggaccaa agaggtagaa taattgccga 1080
atacgtttgg atcgatggta ctggtaactt acgttccaaa ggtagaactt tgaagaagag 1140
aatcacatcc attgaccaat tgccagaatg gaacttcgac ggttcttcta ccaaccaagc 1200
gccaggccac gactctgaca tctatttgaa acccgttgct tactacccag atcccttcag 1260
gagaggtgac aacattgttg tcttggccgc atgttacaac aatgacggta ctccaaacaa 1320
gttcaaccac agacacgaag ctgccaagct atttgctgct cataaggatg aagaaatctg 1380
gtttggtcta gaacaagaat acactctatt tgacatgtat gacgatgttt acggatggcc 1440
aaagggtggg tacccagctc cacaaggtcc ttactactgt ggtgttggtg ccggtaaggt 1500
ttatgccaga gacatgatcg aagctcacta cagagcttgt ttgtatgccg gattagaaat 1560
ttctggtatt aacgctgaag tcatgccatc tcaatgggaa ttccaagtcg gtccatgtac 1620
cggtattgac atgggtgacc aattatggat ggccagatac tttttgcaca gagtggcaga 1680
agagtttggt atcaagatct cattccatcc aaagccattg aagggtgact ggaacggtgc 1740
cggttgtcac actaacgttt ccaccaagga aatgagacaa ccaggtggta tgaaatacat 1800
cgaacaagcc atcgagaagt tatccaagag acacgctgaa cacattaagt tgtacggtag 1860
cgataacgac atgagattaa ctggtagaca tgaaaccgct tccatgactg ccttttcttc 1920
tggtgtcgcc aacagaggta gctcaattag aatcccaaga tccgtcgcca aggaaggtta 1980
cggttacttt gaagaccgta gaccagcttc caacatcgac ccatacttgg ttacaggtat 2040
catgtgtgaa actgtttgcg gtgctattga caatgctgac atgacgaagg aatttgaaag 2100
agaatcttca taagcataat acaatggtgc aaaatttttt ttaggcagga actaatctac 2160
taataaacta acaataatgc acaggaaata ttaatgattt atttatttat tttactacta 2220
tattacatta cttttttaca taaaaaattt cccatctcac gatcaaaaac aggcatgaga 2280
aaaaatcaaa atttataaaa ttaatttcta ataaattaac tgtaatgaca taaaataaga 2340
ggctgcgaca gtcgaatttt ttcttttttt ttttctgcaa agcgacgctg tgttgtatat 2400
tgctctaaaa taattttcta ttgttttcct catgccatta ccctacctac ccgtgcataa 2460
ttacacgagg gggagagctt tttcttccca aaccagacca ggaaaaaaaa aaaggtttga 2520
taatgaaaaa aaaaaaaagt attgtatatg actgttttcc tgataaaaga atgcctgcaa 2580
taattcaaag acaagagata taaaagtgca ctg 2613
<210> 2
<211> 1460
<212> DNA
<213> Saccharomyces cerevisiae
<400> 2
aaacagccat ttttcaatat gcgctacccg gcggcggaat atcgtcccag ctacatgata 60
gccgcttttt tgtctctctt tgtcccacct gttcaaagac atttggtaat cagtttgtca 120
ggacaatagt aaacaaaagt gcgcaagtac acatgcgctg cacgtgcggc cggaacaatg 180
gcgcttttgg ctcgtccgga tgatgcgaaa gggaaaataa aatctcgcaa tcggaaaaac 240
actcgcgaga accaaaacaa ggatccccta aacccagtac ccgcatacgg ttctcccggg 300
gaaaaggggg cggaggccgg acgatgagtg ttacccggat aggactacgg atcgcttcgc 360
acgtttgttt acaattgatg actgcgctcc cctaatagat aagataagct cgcgaaggca 420
gaaaaaaaaa agtcttctac agcagttggt ccgcacagac gatgccagac ggtgttttat 480
cgaaaatttt tttcgcatca tagtgccatt tgtggtcatt attattcccc aaatatgcga 540
aaatagtaca ctatttttgg caggagagta ggctgatatg ccgcattgat gtcctgtgta 600
gcgaaacaca aacaaaaaaa gaaaaagtag gatgaaaaaa agaaaagtaa tatgaaaaaa 660
gagtgaaaaa ttaattcatt tgttagtgta agcggtcagg tgtaagtagt aggcttgata 720
atgaattaaa gatgactccg acgcatattg tttgccatgt ttttatttta gtttgtagat 780
ttcttttttt gtaatatata agggagtgat tctatatatc gaattctcag gcttggttgg 840
ttcgtaggtt gttctgtctt tgttttcgtt aggtaagaac atcacacaaa gataactata 900
gaatcacata catatttgtg agaaattaac ttcatttcat ttatagaaga agttcaaccg 960
gcataataca atggtgcaaa atttttttta ggcaggaact aatctactaa taaactaaca 1020
ataatgcaca ggaaatatta atgatttatt tatttatttt actactatat tacattactt 1080
ttttacataa aaaatttccc atctcacgat caaaaacagg catgagaaaa aatcaaaatt 1140
tataaaatta atttctaata aattaactgt aatgacataa aataagaggc tgcgacagtc 1200
gaattttttc tttttttttt tctgcaaagc gacgctgtgt tgtatattgc tctaaaataa 1260
ttttctattg ttttcctcat gccattaccc tacctacccg tgcataatta cacgaggggg 1320
agagcttttt cttcccaaac cagaccagga aaaaaaaaaa ggtttgataa tgaaaaaaaa 1380
aaaaagtatt gtatatgact gttttcctga taaaagaatg cctgcaataa ttcaaagaca 1440
agagatataa aagtgcactg 1460
<210> 3
<211> 1153
<212> DNA
<213> Saccharomyces cerevisiae
<400> 3
aaacaaaaat taaacataat ataatataat ataatcaaaa atggctgaag caagcatcga 60
aaagactcaa attttacaaa aatatctaga actggaccaa agaggtagaa taattgccga 120
atacgtttgg atcgatggta ctggtaactt acgttccaaa ggtagaactt tgaagaagag 180
aatcacatcc attgaccaat tgccagaatg gaacttcgac ggttcttcta ccaaccaagc 240
gccaggccac gactctgaca tctatttgaa acccgttgct tactacccag atcccttcag 300
gagaggtgac aacattgttg tcttggccgc atgttacaac aatgacggta ctccaaacaa 360
gttcaaccac agacacgaag ctgccaagct atttgctgct cataaggatg aagaaatctg 420
gtttggtcta gaacaagaat acactctatt tgacatgtat gacgatgttt acggatggcc 480
aaagggtggg tacccagctc cacaaggtcc ttactactgt ggtgttggtg ccggtaaggt 540
ttatgccaga gacatgatcg aagctcacta cagagcttgt ttgtatgccg gattagaaat 600
ttctggtatt aacgctgaag tcatgccatc tcaatgggaa ttccaagtcg gtccatgtac 660
cggtattgac atgggtgacc aattatggat ggccagatac tttttgcaca gagtggcaga 720
agagtttggt atcaagatct cattccatcc aaagccattg aagggtgact ggaacggtgc 780
cggttgtcac actaacgttt ccaccaagga aatgagacaa ccaggtggta tgaaatacat 840
cgaacaagcc atcgagaagt tatccaagag acacgctgaa cacattaagt tgtacggtag 900
cgataacgac atgagattaa ctggtagaca tgaaaccgct tccatgactg ccttttcttc 960
tggtgtcgcc aacagaggta gctcaattag aatcccaaga tccgtcgcca aggaaggtta 1020
cggttacttt gaagaccgta gaccagcttc caacatcgac ccatacttgg ttacaggtat 1080
catgtgtgaa actgtttgcg gtgctattga caatgctgac atgacgaagg aatttgaaag 1140
agaatcttca taa 1153
<210> 4
<211> 205
<212> DNA
<213> Saccharomyces cerevisiae
<400> 4
ggcttggttg gttcgtaggt tgttctgtct ttgttttcgt taggtaagaa catcacacaa 60
agataactat agaatcacat acatatttgt gagaaattaa cttcatttca tttatagaag 120
aagttcaacc ggcataatac aatggtgcaa aatttttttt aggcaggaac taatctacta 180
ataaactaac aataatgcac aggaa 205
<210> 5
<211> 1071
<212> DNA
<213> Rice (Oryza sativa L.)
<400> 5
atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60
gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120
tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180
ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240
ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300
ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360
tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420
tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480
atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540
tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600
caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660
cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720
ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780
ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840
atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900
atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960
acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020
tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071
<210> 6
<211> 1287
<212> DNA
<213> Rice (Oryza sativa L.)
<400> 6
atggcgcagg cggtggtgcc ggcgatgcag tgccaggtcg gggccgtgcg ggcgaggccg 60
gcggcggctg cggcggcggc gggggggagg gtgtggggag tcaggaggac cgggcgcggc 120
acgtcggggt tcagggtgat ggccgtgagc acggagacca ccggggtggt gacgcggatg 180
gagcagctgc tcaacatgga caccaccccc ttcaccgaca agatcatcgc cgagtacatc 240
tgggttggag gaactggaat tgacctcaga agcaaatcaa ggacaatatc aaaaccagtg 300
gaggacccct cggagctacc aaaatggaac tacgatggat caagcacagg gcaagctcca 360
ggagaagata gtgaagtcat cttataccca caggctatat tcaaggaccc atttcgaggt 420
ggcaacaaca tattggttat gtgtgatacc tacacaccag ctggggaacc catccctact 480
aacaaacgta acagggctgc acaagtattc agtgatccaa aggttgtcag ccaagtgcca 540
tggtttggaa tagaacagga gtacactttg ctccagagag acgtaaactg gcctcttggc 600
tggcccgttg gaggctaccc tgggccccag ggtccatact actgcgctgt aggatcggac 660
aaatcgtttg gccgtgacat atcagatgct cactacaagg catgtcttta tgctggaatt 720
aacattagtg gaacaaatgg agaggtcatg cctggtcagt gggagtacca ggttggacct 780
agtgtcggta ttgaagctgg agaccacata tggatttcaa gatatattct tgagagaata 840
acggagcagg ctggtgtagt gcttaccctt gaccccaaac caattcaggg agactggaat 900
ggagctgggt gccacacaaa ctacagcacc aagagtatgc gtgaagatgg aggatttgag 960
gtgatcaaga aggcaatcct aaacctatca cttcgccatg acttgcatat aagtgcatat 1020
ggtgaaggaa atgaaaggag gttgacaggt ttacacgaga cagctagcat tgacaatttc 1080
tcatggggtg tggcaaaccg tggatgctct attcgggtgg ggcgagacac cgaggcgaag 1140
ggaaaaggct acttggaaga ccgtcgcccg gcatcaaaca tggacccgta cgtcgtgaca 1200
gcgctattgg ctgaaaccac aattctttgg gagccaaccc tcgaagcgga ggttcttgct 1260
gctaagaagt tggccctgaa ggtatga 1287
<210> 7
<211> 1113
<212> DNA
<213> Saccharomyces cerevisiae
<400> 7
atggctgaag caagcatcga aaagactcaa attttacaaa aatatctaga actggaccaa 60
agaggtagaa taattgccga atacgtttgg atcgatggta ctggtaactt acgttccaaa 120
ggtagaactt tgaagaagag aatcacatcc attgaccaat tgccagaatg gaacttcgac 180
ggttcttcta ccaaccaagc gccaggccac gactctgaca tctatttgaa acccgttgct 240
tactacccag atcccttcag gagaggtgac aacattgttg tcttggccgc atgttacaac 300
aatgacggta ctccaaacaa gttcaaccac agacacgaag ctgccaagct atttgctgct 360
cataaggatg aagaaatctg gtttggtcta gaacaagaat acactctatt tgacatgtat 420
gacgatgttt acggatggcc aaagggtggg tacccagctc cacaaggtcc ttactactgt 480
ggtgttggtg ccggtaaggt ttatgccaga gacatgatcg aagctcacta cagagcttgt 540
ttgtatgccg gattagaaat ttctggtatt aacgctgaag tcatgccatc tcaatgggaa 600
ttccaagtcg gtccatgtac cggtattgac atgggtgacc aattatggat ggccagatac 660
tttttgcaca gagtggcaga agagtttggt atcaagatct cattccatcc aaagccattg 720
aagggtgact ggaacggtgc cggttgtcac actaacgttt ccaccaagga aatgagacaa 780
ccaggtggta tgaaatacat cgaacaagcc atcgagaagt tatccaagag acacgctgaa 840
cacattaagt tgtacggtag cgataacgac atgagattaa ctggtagaca tgaaaccgct 900
tccatgactg ccttttcttc tggtgtcgcc aacagaggta gctcaattag aatcccaaga 960
tccgtcgcca aggaaggtta cggttacttt gaagaccgta gaccagcttc caacatcgac 1020
ccatacttgg ttacaggtat catgtgtgaa actgtttgcg gtgctattga caatgctgac 1080
atgacgaagg aatttgaaag agaatcttca taa 1113
<210> 8
<211> 20
<212> DNA
<213> Saccharomyces cerevisiae
<400> 8
atcatgtgtg aaactgtttg 20
<210> 9
<211> 20
<212> DNA
<213> Saccharomyces cerevisiae
<400> 9
tatctagaac tggaccaaag 20
<210> 10
<211> 1182
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tcgagttcaa gagaaaaaaa aagaaaaagc aaaaagaaaa aaggaaagcg cgcctcgttc 60
agaatgacac gtatagaatg atgcattacc ttgtcatctt cagtatcata ctgttcgtat 120
acatacttac tgacattcat aggtatacat atatacacat gtatatatat cgtatgctgc 180
agctttaaat aatcggtgtc actacataag aacacctttg gtggagggaa catcgttggt 240
accattgggc gaggtggctt ctcttatggc aaccgcaaga gccttgaacg cactctcact 300
acggtgatga tcattcttgc ctcgcagaca atcaacgtgg agggtaattc tgctagcctc 360
tgcaaagctt tcaagaaaat gcgggatcat ctcgcaagag agatctccta ctttctccct 420
ttgcaaacca agttcgacaa ctgcgtacgg cctgttcgaa agatctacca ccgctctgga 480
aagtgcctca tccaaaggcg caaatcctga tccaaacctt tttactccac gcacggcccc 540
tagggcctct ttaaaagctt gaccgagagc aatcccgcag tcttcagtgg tgtgatggtc 600
gtctatgtgt aagtcaccaa tgcactcaac gattagcgac cagccggaat gcttggccag 660
agcatgtatc atatggtcca gaaaccctat acctgtgtgg acgttaatca cttgcgattg 720
tgtggcctgt tctgctactg cttctgcctc tttttctggg aagatcgagt gctctatcgc 780
taggggacca ccctttaaag agatcgcaat ctgaatcttg gtttcatttg taatacgctt 840
tactagggct ttctgctctg tcatctttgc cttcgtttat cttgcctgct cattttttag 900
tatattcttc gaagaaatca cattacttta tataatgtat aattcattat gtgataatgc 960
caatcgctaa gaaaaaaaaa gagtcatccg ctaggtggaa aaaaaaaaat gaaaatcatt 1020
accgaggcat aaaaaaatat agagtgtact agaggaggcc aagagtaata gaaaaagaaa 1080
attgcgggaa aggactgtgt tatgacttcc ctgactaatg ccgtgttcaa acgatacctg 1140
gcagtgactc ctagcgctca ccaagctctt aaaacgggaa tt 1182
<210> 11
<211> 420
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat tttctcggac 60
tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat ttcccctctt 120
tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa aaaagagacc 180
gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg tttctttttc 240
ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga tatttaagtt 300
aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta ttacaacttt 360
ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt taattacaaa 420
<210> 12
<211> 165
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cgaatttctt atgatttatg atttttatta ttaaataagt tataaaaaaa ataagtgtat 60
acaaatttta aagtgactct taggttttaa aacgaaaatt cttattcttg agtaactctt 120
tcctgtaggt caggttgctt tctcaggtat agcatgaggt cgctc 165
<210> 13
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
caaactctag aggatcccca tggcttctct caccgatctc gtca 44
<210> 14
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
attcgcgagc tcggtaccct cagggcttcc agatgatggt ggtct 45
<210> 15
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gggcgttcga ctcgcccccg ggagagatgg ccggcatggt ccca 44
<210> 16
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
caaacagttt cacacatgat aaagtcccat tcgccacccg aaggtg 46
<210> 17
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
atcatgtgtg aaactgtttg gttttagagc tagaaatagc aagtt 45
<210> 18
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gccggccatc aaaagcaccg actcggtgcc actttttc 38
<210> 19
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
cggtgctttt gatggccggc atggtcccag cctcct 36
<210> 20
<211> 46
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
ctttggtcca gttctagata aaagtcccat tcgccacccg aaggtg 46
<210> 21
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
tatctagaac tggaccaaag gttttagagc tagaaatagc aagtt 45
<210> 22
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ggacgaggca agctaaacag atctctagac ctatatccac tagac 45
<210> 23
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ggcttggttg gttcgtaggt tgt 23
<210> 24
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
tgtattatgc cggttgaact tcttctataa atgaaatg 38
<210> 25
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
taatatataa gggagtgatt ctatatatc 29
<210> 26
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
agttcaaccg gcataataca atggtgcaaa atttttttta g 41
<210> 27
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
ttcctgtgca ttattgttag tttattag 28
<210> 28
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
caaactctag aggatcccca tggccgtgag cacggagacc accg 44
<210> 29
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
attcgcgagc tcggtaccct cataccttca gggccaactt cttag 45
<210> 30
<211> 49
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
caaactctag aggatcccca tggctgaagc aagcatcgaa aagactcaa 49
<210> 31
<211> 49
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
attcgcgagc tcggtacccc tatgaagatt ctctttcaaa ttccttcgt 49

Claims (4)

1. A preparation method of a yeast mutant with a function deletion of glutamine synthetase gene is characterized in that the GLN1 gene of the yeast mutant is deleted with a 961 th to 2113 th deoxynucleotide sequence of a complete GLN1 gene, and the nucleotide sequence of the complete GLN1 gene is SEQ ID NO 1;
the preparation method of the yeast mutant comprises the following steps:
1) selecting a target section of a GLN1 gene, determining a knockout technology for performing site-directed knockout on the target section, and designing a knockout vector based on an operation principle of the knockout technology;
2) constructing a functionally complementary gene vector based on the CDS of the GLN1 isogene in other species; the GLN1 isogene is a rice OsGS1 gene, the CDS sequence of the OsGS1 gene is SEQ ID NO. 5, and the function complementary gene vector comprises a His3 expression cassette, a TEF1 promoter, the CDS sequence of the OsGS1 gene and an ADH1 terminator which are sequentially connected;
3) constructing a donor sequence containing a GLN1 homologous recombination donor sequence based on the GLN1 gene;
4) simultaneously transforming the knockout vector, the functionally complementary gene vector and the donor sequence described in steps 1) -3) into a yeast cell;
5) culturing for several days in SC medium which is added with glutamine and resistance components corresponding to the resistance genes on the knockout carrier and does not contain histidine, identifying and selecting the knockout yeast strain at the 961-2113 position of the GLN1 gene for preservation through PCR, and obtaining the yeast mutant with the function deletion of the glutamine synthetase gene;
6) inoculating the yeast mutant strain stored in the step 5) into an SC (single chain fermentation) medium which does not contain histidine and contains glutamine and has a resistance component corresponding to the resistance gene on the knockout carrier for several days, then separating and inoculating the yeast mutant strain into an SC solid medium which does not contain histidine and contains glutamine, picking a plurality of single colonies from the SC solid medium which does not contain histidine and contains glutamine, simultaneously inoculating each single colony into the SC solid medium which does not contain histidine and contains glutamine and an SC solid medium which contains no histidine and contains glutamine and has a resistance component corresponding to the resistance gene on the knockout carrier, and marking;
7) selecting colonies which can grow on the SC solid medium without histidine and containing glutamine and can not grow on the SC solid medium without histidine and containing glutamine and containing resistance components corresponding to the resistance genes on the knockout carrier after a plurality of days, and storing the colonies; obtaining the yeast mutant without shearing carrier plasmid;
8) inoculating the yeast mutant obtained in the step 7) on a YPAD solid culture medium added with glutamine, selecting a single colony to be inoculated on another YPAD solid culture medium added with glutamine again after culturing for several days, selecting a plurality of single colonies after subculturing for 3-5 generations, respectively washing and diluting the single colonies with sterile water, and then respectively inoculating the yeast of each single colony on an SC solid culture medium added with glutamine and an SC solid culture medium without histidine and containing glutamine at the same time and marking; selecting and storing the bacterial strain which can grow on the SC solid culture medium added with glutamine but can not grow on the SC solid culture medium without histidine and containing glutamine, thus obtaining the yeast mutant with the functional complementary gene vector plasmid removed.
2. The method for preparing yeast mutant according to claim 1, wherein the sequence of the mutated GLN1 gene is SEQ ID NO. 2.
3. The method for producing a yeast mutant according to claim 1 or 2, wherein the yeast mutant cell does not contain an exogenous plasmid.
4. The method for preparing a yeast mutant according to claim 1, wherein the knockout technique in step 1) is selected from any of ZFN, teleen or CRISPR techniques.
CN202011451125.8A 2020-12-10 2020-12-10 Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof Active CN112481147B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011451125.8A CN112481147B (en) 2020-12-10 2020-12-10 Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011451125.8A CN112481147B (en) 2020-12-10 2020-12-10 Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN112481147A CN112481147A (en) 2021-03-12
CN112481147B true CN112481147B (en) 2022-04-29

Family

ID=74941396

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011451125.8A Active CN112481147B (en) 2020-12-10 2020-12-10 Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN112481147B (en)

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2230114C2 (en) * 2001-11-30 2004-06-10 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" Mutant glutamine synthetase, dna fragment, strain of escherichia coli as p roducer of l-glutamine and method for preparing l-amino acids
PT1766023E (en) * 2004-06-04 2010-12-09 Fluxome Sciences As Metabolically engineered cells for the production of polyunsaturated fatty acids
CN102121018A (en) * 2010-12-22 2011-07-13 上海大学 Gene with asparagine synthetase function, encoding protein and application thereof
CN104017843B (en) * 2014-06-26 2017-02-15 华东理工大学 Method for enhancing yield of S-adenosylmethionine by regulating gln1 gene expression
EP3268468A1 (en) * 2015-03-12 2018-01-17 Biopetrolia AB L-ornithine production in eukaryotic cells
CN111748572B (en) * 2020-07-10 2022-04-15 科稷达隆(北京)生物技术有限公司 Method for obtaining tandem enzyme function deletion mutant and application

Also Published As

Publication number Publication date
CN112481147A (en) 2021-03-12

Similar Documents

Publication Publication Date Title
CN108795972B (en) Method for isolating cells without using transgene marker sequences
EP2893024B1 (en) Fluorescence activated cell sorting (facs) enrichment to generate plants
CN109652422A (en) Efficient single base editing system OsSpCas9-eCDA and its application
WO2018098935A1 (en) Vector for plant genome site-directed base substitution
CN107988409B (en) Specific CAPS marker for identifying wild type or mutant of rice salt-tolerant gene OsRR22, primer and application of primer
CN112126652B (en) Application of rice OsAUX3 gene in regulation of rice seed grain length
CN112481147B (en) Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof
CN113265403A (en) Soybean Dt1 gene editing site and application thereof
KR20200004382A (en) Cell isolation method without transgene marker sequence
Li et al. Creating large chromosomal deletions in rice using CRISPR/Cas9
US20210047652A1 (en) Methods for genetic transformation and genome modification in legumes
CN114540356A (en) Rhodosporidium toruloides promoter and application thereof
CN114686456A (en) Base editing system based on bimolecular deaminase complementation and application thereof
CN113278646A (en) Method for constructing rice polygene editing mutant library and application
CN1318106A (en) Uracile permease from arabidopsis as herbicidal target gene
WO2017197588A1 (en) Glyphosate-resistant gene screening method, epsps mutant gene and deficient strain and use
CN113215187A (en) Method for rapidly obtaining fragrant rice material by using CRISPR/Cas9 technology
CN114656532B (en) Application of CBL9 and coding gene thereof in regulation and control of saline-alkali tolerance of plants
CN112831517B (en) Lycopene gene-mediated modification cloning vector and application thereof
CN113817767B (en) Method for improving wheat yield by creating wheat TaOTUB1 gene function deletion homozygous mutant
CN112646014B (en) Gene and method for changing flowering period of corn
CN117210490B (en) PCHR gene for regulating and controlling malus plant self-flower fructification and application thereof
CN111647578B (en) Application of USB1 protein in regulation and control of plant drought resistance
CN114774455A (en) CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof
Sheng-bo et al. Application of high-throughput sequencing technology in evaluation of molecular characteristics of transgenic crops: opportunities and challenges.

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: 102206 3rd floor, area D, building 1, No. 27, shengshengyuan Road, science and Technology Park, Changping District, Beijing

Applicant after: Keji Dalong (Beijing) Biotechnology Co.,Ltd.

Address before: 102206 3rd floor, area D, building 1, No. 27, shengshengyuan Road, science and Technology Park, Changping District, Beijing

Applicant before: Keji Dalong Biotechnology Co.,Ltd.

GR01 Patent grant
GR01 Patent grant