CN112430555B - Actinomycete chassis strain and application thereof - Google Patents

Actinomycete chassis strain and application thereof Download PDF

Info

Publication number
CN112430555B
CN112430555B CN202011460485.4A CN202011460485A CN112430555B CN 112430555 B CN112430555 B CN 112430555B CN 202011460485 A CN202011460485 A CN 202011460485A CN 112430555 B CN112430555 B CN 112430555B
Authority
CN
China
Prior art keywords
actinoplanes
strain
actinomycete
fidaxomicin
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011460485.4A
Other languages
Chinese (zh)
Other versions
CN112430555A (en
Inventor
李永泉
郦月萍
卜庆廷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202011460485.4A priority Critical patent/CN112430555B/en
Publication of CN112430555A publication Critical patent/CN112430555A/en
Application granted granted Critical
Publication of CN112430555B publication Critical patent/CN112430555B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
    • C12P19/62—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin the hetero ring having eight or more ring members and only oxygen as ring hetero atoms, e.g. erythromycin, spiramycin, nystatin

Landscapes

  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)

Abstract

The invention discloses an actinomycete chassis strain and application thereof. The strain is Actinoplanes Dechenensis YP-D8, and is obtained by targeted knockout of a redundant genome region existing in Actinoplanes Dechensis YP-1 through a CRISPR/Cpf1 gene editing system. The fidaxomicin biosynthesis gene cluster is introduced into the Deshenghao actinoplanes YP-D8 to obtain a fidaxomicin gene cluster multi-copy strain Deshenghao actinoplanes YP-M2, the yield of the strain can reach 65.6mg/L under normal fermentation conditions, the yield is improved by 200-300% compared with that of a starting strain, and the fermentation yield is stable in passage. The strain has high transformation efficiency, high energy and cofactor content, strong foreign protein expression capacity and high genetic stability, and can be applied to the fields of pharmaceutical research and industrial production, in particular to the preparation of I-type polyketone antibiotics.

Description

Actinomycete chassis strain and application thereof
Technical Field
The invention belongs to the field of microbial pharmacy, and relates to an actinomycete chassis strain dejohana planocomiana YP-D8 and application thereof.
Background
The actinomycetes are gram-positive bacteria, are rich in various drug synthesis precursors and synthesis elements in vivo, have strong secondary metabolite synthesis capacity, can synthesize polyketide, non-ribosomal peptide, aminoglycoside, ribosomal peptide, terpenoid and other compounds, and about 65 percent of currently known microbial drugs (more than 1.5 million) are derived from actinomycetes; in addition, many actinomycetes have an integral resistance/resistance mechanism that protects themselves from poisoning by the active product. Therefore, the chassis developed based on actinomycetes can be used for various drug syntheses. By utilizing bioinformatics analysis, a large number of redundant genomes exist in actinomycetes genomes, and the expression of the redundant genomes consumes a large number of precursors, cofactors and energy and is not beneficial to the synthesis of target secondary metabolites; meanwhile, a plurality of movable elements are contained in the redundant genome, and chromosome rearrangement events such as gene deletion, amplification, insertion and the like are easily caused, so that the genetic instability phenomenon of the strain is caused. Therefore, the actinomycete chassis with simplified genome and stable heredity can be obtained by deleting redundant genome in a large scale by an efficient gene editing technology, and the chassis strain can be used for efficient biosynthesis of various natural products or medicines and has a good application prospect.
Fidaxomicin (fidaxomicin), also known as tiacumicin B, PAR-101, OPT-80, Difimicin, is a novel macrolide antibiotic for oral administration, has an inhibitory effect on many gram-positive pathogenic bacteria, and also has excellent anti-mycobacterium tuberculosis activity and in-vitro anti-cancer activity. Fidaxomicin was approved by FDA for marketing in 5 months 2011 and was the first FDA-approved antimicrobial drug for the treatment of Clostridium Difficile Infection (CDI). Clinical research shows that the in vitro antibacterial activity of fidaxomicin on clostridium difficile is 8-10 times that of vancomycin, and the fidaxomicin has obvious clinical application value. At present, fidaxomicin is mainly prepared by microbial fermentation, and the problems of low fermentation level, unstable inheritance of production strains and the like exist, so that the construction of the fidaxomicin stable production strains by utilizing an actinomycete chassis and the improvement of the yield of the fidaxomicin have very important significance.
Disclosure of Invention
The invention aims to provide an actinomycete Chassis strain, which has the name: the Degan plateau Actinoplanes ypnotic YP-D8 has been preserved in China general microbiological culture Collection center (CGMCC) with the preservation number: CGMCC No.21145, preservation date: 11/9/2020, deposit address: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, North.
The construction method of the actinomycete chassis strain comprises the following construction steps:
(1) performing bioinformatics analysis on an origin Degan plateau actinomyces mobilis (Actinoplanes decenensis) YP-1 by using a known Genome island (Genome Islands) online analysis website Islandview 4(http:// www.pathogenomics.sfu.ca/islandviewer/download /), and predicting redundant Genome regions existing in a Genome; the Degan plateau actinoplanes YP-1 is purchased from China general microbiological culture Collection center (CGMCC for short) and has the preservation number as follows: CGMCC No.4.2098, classification name: actinoplanes decemlinensis (Actinoplanes decenanensis), preservation date: 8, 16 months in 2001;
(2) selecting 8 predicted larger redundant genome regions in the step (1) as subsequent knockout regions;
(3) designing a primer sequence and amplifying a corresponding homologous arm fragment according to the 8 redundant genome regions in the step (2), and integrating the homologous arms into a knockout plasmid pKCpf 1 by using a molecular biological method to obtain 8 knockout plasmids;
(4) sequentially transferring the 8 knockout plasmids constructed in the step (3) into an actinomycetes destemma plateau (Actinoplanes decenanensis) YP-1 serving as a starting bacterium through parental conjugation transduction;
(5) the actinomycete chassis strain Degan plateau actinomycete YP-D8 with 8 redundant genome regions knocked out is obtained through genetic screening.
In the above method, the primer sequences in step (3) are as follows:
SEQ ID NO.1：CCTACGAGATATCGACGCACTAGTTGCTGCTCACCACCTTCACC
SEQ ID NO.2：GTATTGGGGACGGTCGTCGACGGCGAGACTCAACCAGTG
SEQ ID NO.3：GTATCGCCGCACGCTGTCCGGACCATCTGCTTGACCTCTT
SEQ ID NO.4：TGTTGTAGATGCAGCTCGGCGAACGGACCAAGCGTCGGAACGCAAGGTGAAGGT
SEQ ID NO.5：GCTTGGTCCGTTCGCCGAGCTGCATCTACAACAGTAGAAATTTGG
SEQ ID NO.6：CGAACTCCTGGTAGATGGACATATGTGGATCCTACCAACCGGCACGATT
SEQ ID NO.7：CCTACGAGATATCGACGCACTAGTCACGTACAGCAGCCAGAGGT
SEQ ID NO.8：GGAAACCCTCACCCTCGAATCCGAGGTCATCGACGCCAAGGT
SEQ ID NO.9：AACGACGGCGACACCCAGTGCATCGACTGGAGCCAGAACG
SEQ ID NO.10：TGTTGTAGATGGCGACGGGCCGGCGACCGAGGCGCGTCCAGGTCATCGTCATC
SEQ ID NO.11：GCCTCGGTCGCCGGCCCGTCGCCATCTACAACAGTAGAAATTTGG
SEQ ID NO.12：CCTACGAGATATCGACGCACTAGTACGACGACCACGACGAGGAA
SEQ ID NO.13：TCAGTTCTCCTGCCACCACCGCTGATGCGGAACGGGATGAT
SEQ ID NO.14：ATCATCCCGTTCCGCATCAGCGGTGGTGGCAGGAGAACTGA
SEQ ID NO.15：GAGGACCACCTGTTGTCGTACGAGCTGGCCCTGGAATTGGAGA
SEQ ID NO.16：TCGTACGACAACAGGTGGTCCTCATCTACAACAGTAGAAATTATTTCGCTGGTGATGACGTCGGAATCTACAACAGTAGAAATTTGGCCA
SEQ ID NO.17：CCTACGAGATATCGACGCACTAGTCCGCCGCATAAGAAGTTGACAG
SEQ ID NO.18：GTGTTGCTCTCCGCTGCGTACCGCACGAACGAGACGAAGA
SEQ ID NO.19：TCTTCGTCTCGTTCGTGCGGTACGCAGCGGAGAGCAACAC
SEQ ID NO.20：GGAACGCGGCAGACGGAACTTCGGCCGTAGTCGATCACCTGGATG
SEQ ID NO.21：CGAAGTTCCGTCTGCCGCGTTCCATCTACAACAGTAGAAATTCGCCCTGCGGCGATCTCCGCCTCATCTACAACAGTAGAAATTTGGCCA
SEQ ID NO.22：CCTACGAGATATCGACGCACTAGTGGTTCTTGATGACGGCACTGAC
SEQ ID NO.23：GATCTTGGGTCACCAACGGCAGCGCTGTGAGTTTGGACTGGGA
SEQ ID NO.24：TCCCAGTCCAAACTCACAGCGCTGCCGTTGGTGACCCAAGATC
SEQ ID NO.25：GCGGAGCGAAAACCCGTCACTCCGCCTTCTGGTCGGTGCATTACG
SEQ ID NO.26：GGAGTGACGGGTTTTCGCTCCGCATCTACAACAGTAGAAATTGGCGTGGGCGTGTTCCT GGTCGCATCTACAACAGTAGAAATTTGGCCA
SEQ ID NO.27：CCTACGAGATATCGACGCACTAGTTGGAGGGACCAACTCGGGAA
SEQ ID NO.28：CGAAGGACGAACTGGCCATGTCCTCGGCGACCAGAATC
SEQ ID NO.29：GTAGCGGATGCCGGGTGTGTGAGTCATGGTTCCTCCTGC
SEQ ID NO.30：GCCGATCACCCCGGTGCAGGCCGACCGCCTCTACCTCTCCTTCT
SEQ ID NO.31：CGGCCTGCACCGGGGTGATCGGCATCTACAACAGTAGAAATTGCGCCACCCTGCGGGTA GGCGCCATCTACAACAGTAGAAATTTGGCCA
SEQ ID NO.32：CCTACGAGATATCGACGCACTAGTGAGTCGCTGCGTGACAACCT
SEQ ID NO.33：CGTAGTCCTTGGTTCCCGCATCGGACACCTTGGCGTAGATGAT
SEQ ID NO.34：ATCATCTACGCCAAGGTGTCCGATGCGGGAACCAAGGACTACG
SEQ ID NO.35：TGTTGTAGATGGTGGCCGGATAGCCGATGTGGAATCGGAACGGCAGCACTCTC
SEQ ID NO.36：TCCACATCGGCTATCCGGCCACCATCTACAACAGTAGAAATTTGG
SEQ ID NO.37：CCTACGAGATATCGACGCACTAGTTGATAGCCGAGGCTCATGTTGA
SEQ ID NO.38：TCATTGGCATCCGTGGCATCCGCCGGTGACGAAGTACCAGAT
SEQ ID NO.39：ATCTGGTACTTCGTCACCGGCGGATGCCACGGATGCCAATGA
SEQ ID NO.40：GTCAGCCGCAACGTCGACCACCGGTCGGCTGGTCATCCTCAACTG
SEQ ID NO.41：CGGTGGTCGACGTTGCGGCTGACATCTACAACAGTAGAAATTAGGGTCTGCGCGCGGTTCGCGGCATCTACAACAGTAGAAATTTGGCCA。
in the above method, the pKCpf 1 plasmid described in step (3) is disclosed in SCI database documents "Li L, Wei KK, Zheng GS, Liu XC, Chen SX, Jiang WH, Lu YH: CRISPR-Cpf 1-isolated Multiplex Genome Editing and transcription in plasmid expression in isolate Environ Microb 2018,84 (18)".
In the method, the screened actinomycete chassis strain Deshenplateau actinomycete (Actinoplanes dechannensis) YP-D8 has the excellent characteristics of high conversion efficiency, high energy and cofactor content, strong foreign protein expression capacity, high genetic stability and the like, provides a good chassis for the production of microbial medicaments, particularly type I polyketone antibiotics, and has a good application prospect in the fields of pharmaceutical research and industrial production.
The invention also aims to provide application of the actinomycete chassis strain delta-stem plateau Actinoplanes YP-D8 in improving the yield of type I polyketide antibiotics. Especially in improving fidaxomicin production.
The application of the invention is realized by the following scheme: a fidaxomicin biosynthesis gene cluster vector pBAC2015-fad is integrated in the actinomycete chassis strain to obtain a high-yield fidaxomicin gene cluster multi-copy strain YP-M2.
In the above method, the vector pBAC2015-fad contains a fidaxomicin biosynthesis gene cluster sequence that has been uploaded to NCBI database under NCBI accession number "MG 972807".
In the above-mentioned method, the pBAC2015-fad vector contains pBAC2015 plasmid disclosed in SCI database documents Wang H, Li Z, Jia R, et al, RecET direct cloning and Red α β cloning of biochemical genes, large microorganisms or single genes for heterologous expression [ J ]. native protocols,2016,11(7):1175 1191190.
According to the method, the yield of the high-yield fidaxomicin strain YP-M2 can reach 65.6mg/L under normal fermentation conditions, is improved by 200-300% compared with that of the original strain, is relatively stable in fermentation yield in the process of passage 10 times, has a good application prospect, and can promote industrial development of fidaxomicin.
The invention has the advantages that: (1) the actinomycete chassis strain Deshenplateau actinomycete (Actinoplanes deacyanensis) YP-D8 constructed by the invention has the excellent characteristics of high conversion efficiency, high energy and cofactor content, strong foreign protein expression capacity, high genetic stability and the like, provides a good chassis for the production of microbial medicaments, particularly type I polyketone antibiotics, and has better application prospect in the fields of pharmaceutical research and industrial production. (2) The invention integrates a fidaxomicin biosynthesis gene cluster (fad) in an actinomycete chassis strain German stem plateau Actinoplanes YP-D8 to obtain a high-yield fidaxomicin gene cluster multi-copy strain YP-M2, and the method is efficient, accurate and convenient to operate, and provides a new research means for constructing high-yield strains of actinomycete drugs. (3) The fidaxomicin yield of the high-yield fidaxomicin gene cluster multi-copy strain YP-M2 can reach 65.6mg/L, is improved by 200-250% compared with that of a starting strain, is relatively stable in fermentation yield in the process of passage 10 times, has a good application prospect, and can promote the industrial development of fidaxomicin.
Drawings
FIG. 1 is a distribution diagram of 8 knockout redundant genome regions in the genome of Actinoplanes delemar heichii YP-1.
FIG. 2 is a PCR verification diagram of actinomycete Chassis strain YP-D8 knockout of plateau actinomycete. M: DNA marker; lane 1: taking a German Gaultheria plateau actinoplanes YP-1 genome as a template; lane 2: taking a genome of the actinoplanes Degan YP-D8 as a template; lane 3: negative control, ddH2O as template.
FIG. 3 is a growth curve of Actinoplanes delbrueckii YP-D8 and Actinoplanes delbrueckii YP-1, the starting bacterium.
FIG. 4 is a diagram showing the analysis of the transformation efficiency of different plasmids in the actinoplanes dekawari YP-D8 and the actinoplanes dekawari YP-1.
FIG. 5 shows the intracellular ATP content analysis of the actinoplanes dekawakamii YP-D8 and the actinoplanes dekawakamii YP-1.
FIG. 6 shows intracellular cofactors (NADPH/NADP) in Actinoplanes desorpta nakai YP-D8 and Actinoplanes desorpta nakai YP-1, the starting bacterium+) And (4) analyzing the content.
FIG. 7 is the analysis of the capability of heterologous expression of eGFP of actinoplanes dekawari YP-D8 and actinoplanes dekawari YP-1.
FIG. 8 is a diagram showing the analysis of the yield and genetic stability of fidaxomicin in the actinoplanes dekaki YP-M2 and the actinoplanes dekaki YP-1, the starting bacterium.
Detailed Description
The invention is further described below with reference to the figures and examples. The invention will be better understood by the following examples, without however limiting it.
The experimental methods and technical means in the following examples are all conventional methods unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Media used in the examples:
(1) ISP4 solid medium: soluble starch 1%, MgSO4.7H2O 0.1％、K2HPO4 0.1％、NaCl 0.1％、(NH4)2SO4 0.2％、CaCO3 0.2％、FeSO4.7H20.0001 percent of O, 0.0001 percent of MnCl, 2 percent of agar and the balance of water, wherein the percentages are mass percentages and pH7.0.
(2) MS solid culture medium: 2 percent of mannitol, 2 percent of soybean meal, 2 percent of agarose and the balance of water, wherein the percentages are mass percentages, 10mM MgCl2And the pH is natural.
(3) Seed culture medium: 1.75% of glucose, 1.5% of peptone, 1.0% of NaCl and the balance of water, wherein the percentages are mass percentages and the pH is natural.
(4) Fermentation medium B: 0.3% of yeast extract, 0.5% of peptone, 0.3% of malt extract, 1% of glucose and the balance of water, wherein the percentages are mass percentages and the pH is natural.
Example 1 construction of Actinoplanes underpan Strain, Deshenplateau Actinoplanes (Actinoplanes decenanensis) YP-D8
The specific construction steps are as follows:
(1) performing bioinformatics analysis on an origin Degan plateau actinomyces mobilis (Actinoplanes decenensis) YP-1 by utilizing a known Genome island (Genome Islands) online analysis website Islandview 4(http:// www.pathogenomics.sfu.ca/islandviewer/download /), and predicting redundant Genome group regions existing in a Genome;
(2) selecting 8 larger redundant genomic regions as shown in figure 1;
(3) designing a primer sequence and amplifying corresponding homologous arm fragments according to the 8 redundant genome regions in the step (2), and respectively integrating the homologous arms into a knockout plasmid pKCpf 1 by using a molecular biological method to obtain 8 knockout plasmids.
(4) The 8 knockout plasmids were introduced into the demethylated starting E.coli E.coil ET12567/pUZ8002 by heat shock method, spread on LB solid plates containing kanamycin (50. mu.g/mL), apramycin (50. mu.g/mL) and chloramphenicol (25. mu.g/mL), and placed at 37 ℃ for inverted culture for 16 h; ET12567/pUZ8002 is disclosed in the paper Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., & Hopwood, D.A. practical streptomyces genetics (Vol.291). Norwich: John Innes Foundation.2000.
(5) Sequentially transferring the 8 knockout plasmids constructed in the step (3) into an actinomycetes destemma plateau (Actinoplanes decenanensis) YP-1 serving as a starting bacterium through parental conjugation transduction; the Degan plateau actinoplanes YP-1 is purchased from China general microbiological culture Collection center (CGMCC for short) and has the preservation number as follows: CGMCC No.4.2098, Classification name: actinoplanes decemlinensis (Actinoplanes decenanensis), preservation date: 8/16/2001.
(6) The specific steps of dual-parent conjugation transduction are as follows: e.coil ET12567/pUZ8002 containing the corresponding knockout plasmid on the plate in step (4) was picked, inoculated into 5ml LB liquid medium (chloramphenicol, kanamycin and apramycin), and shaken overnight at 37 ℃ and 220 rpm; 500ul of the above culture medium was transferred to 50mL of fresh LB liquid medium and cultured at 37 ℃ to OD6000.4-0.6; centrifuging at 4000rpm at room temperature, collecting the thallus, washing twice with 10ml LB liquid culture medium, and re-suspending with 0.5ml 2 XYT liquid culture medium; culturing Actinoplanes delavayi YP-1(Actinoplanes dechannensis YP-1) in TSB liquid culture for 36h, collecting 500 μ l mycelium, discarding supernatant, washing precipitate with 10ml LB liquid culture medium twice, and finally resuspending with 0.5ml 2 XYT liquid culture medium; mixing the collected mycelia of Escherichia coli and Actinoplanes, uniformly coating on MS solid culture medium, and culturing at 30 deg.C for 16-18 h; adding 50 mug/ml of apramycin and 25 mug/ml of nalidixic acid into the MS solid culture medium, and standing and culturing for 5-7 days at 30 ℃ until monoclonals grow out.
(7) Transferring the single clone to an ISP4 solid culture medium containing 50 mu g/ml apramycin to culture for 4-5 days, and obtaining an actinomycete chassis strain Degan plateau actinomycete (Actinoplanes decenanensis) YP-D8 with 8 redundant genome regions successfully knocked out through PCR and photocopy screening; FIG. 2 is a PCR verification diagram of actinomycete chassis strain Desheng plateau actinomycete YP-D8 knockout.
(8) The actinomycete chassis strain German Stem plateau Actinoplanes (Actinoplanes deaceanensis) YP-D8 provided by the invention is preserved in China general microbiological culture Collection center (CGMCC for short) in 11 months and 9 months in 2020, and the preservation number is as follows: CGMCC No. 21145.
Example 2 comparison of growth curves of Actinoplanes desofutoki YP-D8 and Actinoplanes desofutoki YP-1
(1) Placing the D.shikamii YP-D8 and the D.shikamii YP-1 on ISP4 solid medium for culturing for 10 days.
(2) Inoculating the fungus blocks of about 1cm × 1cm from the ISP4 solid culture medium in the step (1) into a seed culture medium respectively, and culturing at 30 deg.C and 220rpm for 24-48 h.
(3) Transferring the mycelium of the seed culture medium into a fermentation culture medium B to the initial OD6000.15, and was cultured at 30 ℃ and 220rpm for 144 hours.
(4) After culturing for 12, 24, 48, 60, 72, 84, 96, 108, 120, 132, and 144 hours, 1ml of each of the fermentation liquids was collected by centrifugation, and the cells were collected by centrifugation again after washing with 1ml of sterile water.
(5) And (3) placing the collected thalli in an oven at 65 ℃ for 3-5 days, weighing, calculating the weight of the thalli at different time points (the weight of the centrifugal tube + the weight of the thalli-the weight of an air centrifugal tube), and drawing a growth curve.
(6) FIG. 3 is a growth curve of actinoplanes dekawakamii YP-D8 and actinoplanes dekawakamii YP-1, and the result shows that the growth cycle of YP-D8 has no obvious change.
Example 3 comparison of the transformation efficiencies of different plasmids in Actinoplanes desorpta parvula YP-D8 and the starting bacterium Actinoplanes desorpta parvula YP-1.
(1) Selecting a common carrier in actinomycetes: the integrated vector pIJ8660, the temperature-sensitive vector pKCpf 1 and the free vector pL97 are introduced into the demethylated starting Escherichia coli E.coil ET12567/pUZ8002 by a heat shock method, coated on an LB solid plate containing kanamycin (50. mu.g/mL), apramycin (50. mu.g/mL) and chloramphenicol (25. mu.g/mL), and placed at 37 ℃ for inverted culture for 16 h; pIJ8660 is disclosed in the paper Sun J, Kelemen G H, Fern a ndez-Absalos J M, et al Green fluorescent protein as a reporter for specific and temporal gene expression A3(2), Microbiology,1999,145(9), 2221-2227; pL97 has been disclosed in the article "Sun N, Wang Z B, Wu H P, et al.construction of over-expression program vectors in microorganisms [ J ]. Annals of microbiology,2012,62(4): 1541-.
(2) E.coil ET12567/pUZ8002 single clones containing the corresponding plasmids on the plates in step 1 were picked, inoculated into 5ml LB liquid medium (chloramphenicol, kanamycin and apramycin) and shaken overnight at 37 ℃ and 220 rpm.
(3) 500ul of the above culture medium was transferred to 50mL of fresh LB liquid medium and cultured at 37 ℃ to OD6000.4-0.6; centrifuging at 4000rpm at room temperature, collecting the thallus, washing twice with 10ml LB liquid culture medium, and re-suspending with 0.5ml 2 XYT liquid culture medium; respectively culturing Drynaldia plateau Actinoplanes YP-D8 and Drynaldia plateau Actinoplanes YP-1(Actinoplanes dechannensis YP-1) in TSB liquid culture for 36h, collecting 500 μ l of mycelia, discarding supernatant, washing precipitate twice with 10ml LB liquid culture medium, and finally resuspending with 0.5ml 2 XYT liquid culture medium; mixing the 3 collected colibacillus thalli with 2 mycelia of actinoplanes respectively, uniformly coating the mixture on an MS solid culture medium, and culturing for 16-18h at 30 ℃; adding 50 mug/ml of apramycin and 25 mug/ml of nalidixic acid into the MS solid culture medium, and standing and culturing for 5-7 days at 30 ℃ until monoclonals grow out.
(4) The MS plates with the grown monoclonals are respectively subjected to plate counting and conversion efficiency calculation, and the attached figure 4 shows that the conversion efficiency analysis of different plasmids in the Desheng plateau actinoplanes YP-D8 and the starting bacteria Desheng plateau actinoplanes YP-1 shows that the Desheng plateau actinoplanes YP-D8 have higher conversion efficiency for the 3 plasmids and are respectively 3.3 times, 7.9 times and 7.2 times of the starting strains.
Example 4 comparison of intracellular ATP content and intracellular cofactor (NADPH/NADPH) in Actinoplanes desorpta nakai YP-D8 and the Actinoplanes desorpta nakai YP-1 starting bacterium+) And (4) content.
(1) Placing Degan plateau actinoplanes YP-D8 and Degan plateau actinoplanes YP-1 on ISP4 solid culture medium, culturing for 10 days, respectively inoculating about 1cm × 1cm of fungus block into seed culture medium, and culturing at 30 deg.C and 220rpm for 24-48 h.
(2) Transferring the mycelium in the seed culture medium to fermentation medium B to initial OD6000.15, and was cultured at 30 ℃ and 220rpm for 144 hours.
(3) After 24, 48, 72, 96, 120 and 144 hours of culture, respectively taking 1ml of fermentation liquor in the step 2, centrifuging, collecting thalli, washing with 1ml of PBS for three times, centrifuging again, collecting thalli, measuring the intracellular ATP content according to the operation steps in an ATP detection kit (product number: QS1702 Shanghai Solarbio), and drawing an analysis chart, wherein the attached figure 5 shows the intracellular ATP content analysis in the Degan plateau actinoplanes YP-D8 and the original bacterium Degan actinoplanes YP-1.
(4) After culturing for 24, 48, 72, 96, 120, 144 hours, 1ml of the fermentation broth obtained in step 2 was collected, centrifuged to collect the cells, washed three times with 1ml of PBS, centrifuged again to collect the cells, and intracellular NADPH/NADP was measured according to the procedure in the coenzyme II NADP (H) content kit (QS 1100 Shanghai Solarbio)+FIG. 6 is a graph showing intracellular cofactors (NADPH/NADP) in Actinoplanes desorpta nakai YP-D8 and Actinoplanes desorpta nakai YP-1 as the starting bacterium+) And (4) analyzing the content.
(5) Based on the results of the analysis, it was found that ATP content and NADPH/NADP in YP-D8 cells were present throughout the fermentation+The ratio is obviously higher than that of the prokaryote YP-1.
Example 5 comparison of the ability of Actinoplanes terrae Germanica YP-D8 to heterologously express eGFP with the starting bacterium Actinoplanes terrae Germanica YP-1.
(1) The eGFP expression plasmid pIJ 8668-ermEp-eGFP is respectively introduced into the actinoplanes dekakii YP-D8 and the actinoplanes dekakii YP-1 through the parental conjugation transduction to obtain strains YP-D8-G and YP-1-G.
(2) The YP-D8-G and YP-1-G strains were inoculated into seed culture media, respectively, and cultured at 30 ℃ and 220rpm for 24-48 hours.
(3) Transferring the mycelium in the seed culture medium to fermentation medium B to initial OD600Is 0.15.
(4) Culturing at 30 deg.C and 220rpm for 48 hr, placing equal amount of mycelium under fluorescence microscope to observe eGFP expression level, and analyzing the ability of Actinoplanes delbrueckii YP-D8 and Actinoplanes delbrueckii YP-1 to heterologously express eGFP in FIG. 7.
(5) According to the analysis result, the actinoplanes dekawari YP-D8 has stronger foreign protein expression capacity compared with the original strain.
Example 6 application of Actinoplanes terrae striolata YP-D8 as actinomycete Chassis strain in increasing yield of fidaxomicin
(1) A gene cluster multi-copy strain YP-M2 is obtained by transferring a fidaxomicin biosynthesis gene cluster (fad) vector pBAC2015-fad into actinoplanes dekaki YP-D8 through parental conjugation transduction.
(2) The gene cluster multi-copy strain YP-M2 and the Degan plateau actinoplanes YP-1 are placed on an ISP4 solid culture medium to be cultured for 7-10 days to form a generation, and are respectively subcultured for 10 times, and sequentially fermented to detect the yield of fidaxomicin.
(3) Fidaxomicin yield analysis: respectively taking 1mL fermentation liquor to be detected, adding 9mL methanol, fully oscillating, centrifuging for 10min at room temperature and 12000rpm, removing settled mycelium and solid, filtering supernatant with 0.22um sterile microporous membrane, collecting filtrate, and analyzing the obtained sample by HPLC detection. HPLC conditions: and (3) chromatographic column: c18 column (agent, Eclipse Plus XDB, 5um, 4.6mm 250 mm); detection wavelength: 254 nm; flow rate: 1.00 mL/min; sample introduction amount: 10 ul; experimental mobile phase: mobile phase a was 10% acetonitrile containing 0.08% trifluoroacetic acid (TFA) and mobile phase B was 90% acetonitrile; HPLC run-off procedure: 0-20min, 30% -100% of phase B; 20-25min, 100% phase B; 25-30min, 100% -30% of phase B.
(4) The fermentation result shows that the yield of fidaxomicin of YP-M2 under the normal fermentation condition can reach 65.6mg/L, which is 200-300% higher than that of the original bacterium of degan plateau actinoplanes YP-1; and YP-M2 has stable fermentation yield in the process of 10 passages, has good application prospect and can promote the industrial development of fidaxomicin. FIG. 8 is a diagram showing the analysis of the yield and genetic stability of fidaxomicin in the actinoplanes dekaki YP-M2 and the actinoplanes dekaki YP-1, the starting bacterium.
Sequence listing
<110> Zhejiang university
<120> actinomycete chassis strain and application thereof
<160> 41
<170> SIPOSequenceListing 1.0
<210> 1
<211> 44
<212> DNA
<213> Artificial sequence (Unknown)
<400> 1
cctacgagat atcgacgcac tagttgctgc tcaccacctt cacc 44
<210> 2
<211> 39
<212> DNA
<213> Artificial sequence (Unknown)
<400> 2
gtattgggga cggtcgtcga cggcgagact caaccagtg 39
<210> 3
<211> 40
<212> DNA
<213> Artificial sequence (Unknown)
<400> 3
gtatcgccgc acgctgtccg gaccatctgc ttgacctctt 40
<210> 4
<211> 54
<212> DNA
<213> Artificial sequence (Unknown)
<400> 4
tgttgtagat gcagctcggc gaacggacca agcgtcggaa cgcaaggtga aggt 54
<210> 5
<211> 45
<212> DNA
<213> Artificial sequence (Unknown)
<400> 5
gcttggtccg ttcgccgagc tgcatctaca acagtagaaa tttgg 45
<210> 6
<211> 49
<212> DNA
<213> Artificial sequence (Unknown)
<400> 6
cgaactcctg gtagatggac atatgtggat cctaccaacc ggcacgatt 49
<210> 7
<211> 44
<212> DNA
<213> Artificial sequence (Unknown)
<400> 7
cctacgagat atcgacgcac tagtcacgta cagcagccag aggt 44
<210> 8
<211> 42
<212> DNA
<213> Artificial sequence (Unknown)
<400> 8
ggaaaccctc accctcgaat ccgaggtcat cgacgccaag gt 42
<210> 9
<211> 40
<212> DNA
<213> Artificial sequence (Unknown)
<400> 9
aacgacggcg acacccagtg catcgactgg agccagaacg 40
<210> 10
<211> 53
<212> DNA
<213> Artificial sequence (Unknown)
<400> 10
tgttgtagat ggcgacgggc cggcgaccga ggcgcgtcca ggtcatcgtc atc 53
<210> 11
<211> 45
<212> DNA
<213> Artificial sequence (Unknown)
<400> 11
gcctcggtcg ccggcccgtc gccatctaca acagtagaaa tttgg 45
<210> 12
<211> 44
<212> DNA
<213> Artificial sequence (Unknown)
<400> 12
cctacgagat atcgacgcac tagtacgacg accacgacga ggaa 44
<210> 13
<211> 41
<212> DNA
<213> Artificial sequence (Unknown)
<400> 13
tcagttctcc tgccaccacc gctgatgcgg aacgggatga t 41
<210> 14
<211> 41
<212> DNA
<213> Artificial sequence (Unknown)
<400> 14
atcatcccgt tccgcatcag cggtggtggc aggagaactg a 41
<210> 15
<211> 43
<212> DNA
<213> Artificial sequence (Unknown)
<400> 15
gaggaccacc tgttgtcgta cgagctggcc ctggaattgg aga 43
<210> 16
<211> 90
<212> DNA
<213> Artificial sequence (Unknown)
<400> 16
tcgtacgaca acaggtggtc ctcatctaca acagtagaaa ttatttcgct ggtgatgacg 60
tcggaatcta caacagtaga aatttggcca 90
<210> 17
<211> 46
<212> DNA
<213> Artificial sequence (Unknown)
<400> 17
cctacgagat atcgacgcac tagtccgccg cataagaagt tgacag 46
<210> 18
<211> 40
<212> DNA
<213> Artificial sequence (Unknown)
<400> 18
gtgttgctct ccgctgcgta ccgcacgaac gagacgaaga 40
<210> 19
<211> 40
<212> DNA
<213> Artificial sequence (Unknown)
<400> 19
tcttcgtctc gttcgtgcgg tacgcagcgg agagcaacac 40
<210> 20
<211> 45
<212> DNA
<213> Artificial sequence (Unknown)
<400> 20
ggaacgcggc agacggaact tcggccgtag tcgatcacct ggatg 45
<210> 21
<211> 90
<212> DNA
<213> Artificial sequence (Unknown)
<400> 21
cgaagttccg tctgccgcgt tccatctaca acagtagaaa ttcgccctgc ggcgatctcc 60
gcctcatcta caacagtaga aatttggcca 90
<210> 22
<211> 46
<212> DNA
<213> Artificial sequence (Unknown)
<400> 22
cctacgagat atcgacgcac tagtggttct tgatgacggc actgac 46
<210> 23
<211> 43
<212> DNA
<213> Artificial sequence (Unknown)
<400> 23
gatcttgggt caccaacggc agcgctgtga gtttggactg gga 43
<210> 24
<211> 43
<212> DNA
<213> Artificial sequence (Unknown)
<400> 24
tcccagtcca aactcacagc gctgccgttg gtgacccaag atc 43
<210> 25
<211> 45
<212> DNA
<213> Artificial sequence (Unknown)
<400> 25
gcggagcgaa aacccgtcac tccgccttct ggtcggtgca ttacg 45
<210> 26
<211> 90
<212> DNA
<213> Artificial sequence (Unknown)
<400> 26
ggagtgacgg gttttcgctc cgcatctaca acagtagaaa ttggcgtggg cgtgttcctg 60
gtcgcatcta caacagtaga aatttggcca 90
<210> 27
<211> 44
<212> DNA
<213> Artificial sequence (Unknown)
<400> 27
cctacgagat atcgacgcac tagttggagg gaccaactcg ggaa 44
<210> 28
<211> 38
<212> DNA
<213> Artificial sequence (Unknown)
<400> 28
cgaaggacga actggccatg tcctcggcga ccagaatc 38
<210> 29
<211> 39
<212> DNA
<213> Artificial sequence (Unknown)
<400> 29
gtagcggatg ccgggtgtgt gagtcatggt tcctcctgc 39
<210> 30
<211> 44
<212> DNA
<213> Artificial sequence (Unknown)
<400> 30
gccgatcacc ccggtgcagg ccgaccgcct ctacctctcc ttct 44
<210> 31
<211> 90
<212> DNA
<213> Artificial sequence (Unknown)
<400> 31
cggcctgcac cggggtgatc ggcatctaca acagtagaaa ttgcgccacc ctgcgggtag 60
gcgccatcta caacagtaga aatttggcca 90
<210> 32
<211> 44
<212> DNA
<213> Artificial sequence (Unknown)
<400> 32
cctacgagat atcgacgcac tagtgagtcg ctgcgtgaca acct 44
<210> 33
<211> 43
<212> DNA
<213> Artificial sequence (Unknown)
<400> 33
cgtagtcctt ggttcccgca tcggacacct tggcgtagat gat 43
<210> 34
<211> 43
<212> DNA
<213> Artificial sequence (Unknown)
<400> 34
atcatctacg ccaaggtgtc cgatgcggga accaaggact acg 43
<210> 35
<211> 53
<212> DNA
<213> Artificial sequence (Unknown)
<400> 35
tgttgtagat ggtggccgga tagccgatgt ggaatcggaa cggcagcact ctc 53
<210> 36
<211> 45
<212> DNA
<213> Artificial sequence (Unknown)
<400> 36
tccacatcgg ctatccggcc accatctaca acagtagaaa tttgg 45
<210> 37
<211> 46
<212> DNA
<213> Artificial sequence (Unknown)
<400> 37
cctacgagat atcgacgcac tagttgatag ccgaggctca tgttga 46
<210> 38
<211> 42
<212> DNA
<213> Artificial sequence (Unknown)
<400> 38
tcattggcat ccgtggcatc cgccggtgac gaagtaccag at 42
<210> 39
<211> 42
<212> DNA
<213> Artificial sequence (Unknown)
<400> 39
atctggtact tcgtcaccgg cggatgccac ggatgccaat ga 42
<210> 40
<211> 45
<212> DNA
<213> Artificial sequence (Unknown)
<400> 40
gtcagccgca acgtcgacca ccggtcggct ggtcatcctc aactg 45
<210> 41
<211> 90
<212> DNA
<213> Artificial sequence (Unknown)
<400> 41
cggtggtcga cgttgcggct gacatctaca acagtagaaa ttagggtctg cgcgcggttc 60
gcggcatcta caacagtaga aatttggcca 90

Claims (2)

1. An actinomycete chassis strain, which is classified and named as: actinoplanes terrae of Degan (A)Actinoplanes deccanensis) YP-D8, depository:china general microbiological culture Collection center, accession number: CGMCC No.21145, preservation date: 11/9/2020, deposit address: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, North.
2. Use of an actinomycete underpan strain as claimed in claim 1 for increasing the production of type I polyketide antibiotics, wherein the actinomycete underpan strain is used for increasing the production of fidaxomicin.
CN202011460485.4A 2020-12-11 2020-12-11 Actinomycete chassis strain and application thereof Active CN112430555B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011460485.4A CN112430555B (en) 2020-12-11 2020-12-11 Actinomycete chassis strain and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011460485.4A CN112430555B (en) 2020-12-11 2020-12-11 Actinomycete chassis strain and application thereof

Publications (2)

Publication Number Publication Date
CN112430555A CN112430555A (en) 2021-03-02
CN112430555B true CN112430555B (en) 2022-06-24

Family

ID=74691475

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011460485.4A Active CN112430555B (en) 2020-12-11 2020-12-11 Actinomycete chassis strain and application thereof

Country Status (1)

Country Link
CN (1) CN112430555B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104603279A (en) * 2012-08-07 2015-05-06 欧伦股份公司 Procedure for the production of tiacumicin b
CN108841769A (en) * 2018-05-24 2018-11-20 浙江大学 A kind of feldamycin genetic engineering bacterium and construction method and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104603279A (en) * 2012-08-07 2015-05-06 欧伦股份公司 Procedure for the production of tiacumicin b
CN108841769A (en) * 2018-05-24 2018-11-20 浙江大学 A kind of feldamycin genetic engineering bacterium and construction method and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Actinoplanes deccanensis strain ATCC 21983 fidaxomicin biosynthesis gene cluster, complete sequence;Yu，P.，等;《Genbank登录号：MG972807.1》;20181124;参见全文 *
RecET direct cloning and Redαβ recombineering of biosynthetic gene clusters,large operons or single genes for heterologous expression;Wang H.，等;《Nature Protocols》;20160602;第11卷(第7期);第1175-1190页 *
高产量非达霉素工程菌的构建及其发酵优化;许睿，等;《中国医药工业杂志》;20200228;第51卷(第2期);第204-210页 *

Also Published As

Publication number Publication date
CN112430555A (en) 2021-03-02

Similar Documents

Publication Publication Date Title
CN104762247A (en) A genetic engineering strain for increasing the yield of ascomycin and a constructing method
Muhammad et al. ANTIBIOTIC PRODUCTION BY THERMOPHILIC BACILLUS SPECIE SAT-4.
CN110343709B (en) Nocardiopsis arctica lasso peptide gene cluster and cloning and expression method thereof
CN105154382A (en) Gene engineering strain streptomyces tsukubaensis L20 and application thereof
CN114317361A (en) Streptomyces new strain and separation method and application thereof
MX2013000944A (en) Genetically engineered strain wsj-ia for producing isovaleryl spiramycin i.
CN112430555B (en) Actinomycete chassis strain and application thereof
CN112625925B (en) High-yield strain of dalbavancin precursor A40926B0 and application thereof
CN105176904B (en) Engineering strain streptomyces tsukubaensis L21 and its application
WO2019223433A1 (en) Genetically engineered bacterium of fidaxomicin and construction method and application thereof
CN103409341A (en) Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain
CN112409372B (en) Yuxithromycin analogue, preparation method and application thereof
CN109468253B (en) Streptomyces hygroscopicus with high rapamycin yield
CN109554321B (en) Genetically engineered bacterium for high-yield lipopeptide and application thereof
CN110092758B (en) Novel alkaloid compound and wart spore strain for preparing compound by fermentation
CN107699532B (en) 3, 7-dihydroxy tropolone high-yield strain and fermentation culture method thereof
CN101260380A (en) Gene engineering bacterial strain for directionally accumulating candicidin single component FR-008-III
CN108456689B (en) Method for improving biosynthesis yield of ansamitocin P-3
CN112430608B (en) Method for constructing high-yield engineering bacteria of oritavancin precursor and application
CN101434931B (en) Streptomyces clavuligerus, as well as preparation method and application thereof
RU2495937C1 (en) Method of preparation of tacrolimus by microbiological synthesis method
KR101327798B1 (en) A Microorganism producing aglucovancomycin
CN108485991B (en) Saccharopolyspora marinum and application thereof in preparation of erythromycin derivative
CN101545000A (en) Method for improving yield of ECO-0501 produced by fermenting Amycolatopsis orientalis
CN114350688A (en) Application of guaA gene, plasmid and strain in expression of azotobacterin

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant