WO2019223433A1 - Genetically engineered bacterium of fidaxomicin and construction method and application thereof - Google Patents

Abstract

Provided are a genetically engineered bacterium of fidaxomicin, and a construction method and application. The genetically engineered bacterium is Actinoplanes deccanensis YP-2, having an accession number of CGMCC No: 15743. The construction method therefor is: introducing a fidaxomicin biosynthesis positive regulatory gene into Actinoplanes deccanensis YP-1, and screening to obtain a genetically engineered bacterium of Actinoplanes deccanensis YP-2 that has high-yield fidaxomicin, and increasing the yield of starting bacterium by 400%-500% to reach 130 mg/L. Further provided are the application of the fidaxomicin genetically engineered bacterium of Actinoplanes deccanensis YP-2 for the preparation of a medicament for treating diarrhea caused by a Clostridium difficile infection.

Description

Fidaxomycin genetic engineering bacteria, construction method and application Technical field

The invention belongs to the field of microbial pharmaceuticals, and relates to a high-yield fidamicin genetically engineered bacterium Degan Plateau Actinomyces YP-2 (Actinoplanes deccanensis YP-2) and a method for constructing the same and application thereof.

Background technique

The large amount of antibiotics used in clinical practice has led to the development of resistance to pathogenic bacteria. What is more serious is that bacteria can effectively spread resistance gene information. The proportion of pathogenic bacteria resistant to various types of antibiotics has been increasing, which has a great negative effect on clinical treatment. influences. Clostridium difficile infection (CDI) is caused by a gram-positive Bacillus clostridium difficile overgrowth and releases toxins, which can cause colon inflammation, severe diarrhea and even death. Previous data show that CDI mainly affects elderly patients, long-term hospitalization and patients in intensive care units. In recent years, the number of cases of infection in healthy people and children has gradually increased. Vancomycin and metronidazole are the first choice drugs for the treatment of CDI, but with the emergence of drug-resistant strains, finding more effective treatments has become the main research target in recent years.

Fidaxomicin, also known as Tiacumicin (also known as Lipiramycin A3, OPT-80, PAR-101), is a new macrolide antibiotic that can be administered orally. Original research plant Optimer The company was approved by the FDA in May 2011, but so far no drug has been approved by the CFDA in China. Clinical studies have shown that compared with vancomycin orally, fidaxomycin is more effective than vancomycin, and has a strong inhibitory effect on C. difficile after administration, and can effectively reduce the recurrence rate of C. difficile infection.

Summary of the Invention

The object of the present invention is to provide a non-dacmycin engineering bacteria Degan Plateau zooplankton actinomycete YP-2, which is classified and named: Actinoplanes deccanensis YP-2, and has been deposited in the General Microbial Center of the China Microbial Species Collection Management Committee ( (CGMCC for short), deposit number: CGMCC No. 15743, deposit date: May 8, 2018, deposit address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing.

Another object of the present invention is to provide a method for constructing the actinomycete engineering bacteria YP-2 (Actinoplanes deccanensis YP-2), which includes the introduction of a gene for positive control of fidaxomycin biosynthesis. The starting strain was screened to obtain a genetically engineered strain (Actinoplanes deccanensis YP-2) of Degan plateau zooplankton with high yield of fidaxomycin.

The specific steps of the construction method of the present invention are as follows:

(1) Design specific primers to amplify the SEQ ID NO.1 sequence and recover,

Upstream primer SEQ ID No. 3: aagatctgcccagcatatgaactgttgaaagttgttta

Downstream primer SEQ ID NO. 4: ccaagatctgcccagcatatgtcaggcggaatccgccatg;

(2) The fragment recovered in step 1 is digested and inserted into the expression vector pIJ8630 to obtain the plasmid pIJ8630-ermE * -fadR1 and verified;

(3) The plasmid obtained in step 2 is introduced into E. coli ET12567 / pUZ8002 through transformation;

(4) Transfer of the plasmid in step 2 into the starting bacteria Actinoplanes deccanensis YP-1 by conjugation and transduction of the parents; the Deccan Plateau actinomycetes YP-1 were purchased from China The Microbial Species Collection Management Committee General Microbiology Center (CGMCC for short), its deposit number is: CGMCC No. 4.2098, classified and named: Actinoplanes Deccancan, date of preservation: August 16, 2001;

(5) The high-yield non-dacomycin genetically engineered strain Dean Plateau zooplankton actinomycete YP-2 (Actinoplanes deccanensis YP-2) was obtained through fermentation. The yield was as high as 130 mg / L, which was 400% to 500% higher than the starting bacteria The strain has been deposited in the General Microbiology Center of the China Microbial Species Collection Management Committee, and is classified and named: Actinoplanes deccanensis YP-2, deposit number: CGMCC No. 15743, deposit date: May 8, 2018, deposit address: Beijing Chaoyang District No. 3, Beichen West Road.

In the above method, in steps 2-4, the sequence of SEQ ID NO. 1 is inserted into the plasmid pIJ8630 and introduced into the starting fungus Degan Plateau Actinomyces YP-1.

Among them, SEQ ID NO.1 in step 1 consists of 3063 nucleotides, positions 1-19 are NdeI recognition sites and protecting bases, positions 20-297 are erythromycin resistance gene promoters, and 297th -3042 is the coding sequence of the gene for positive regulation of fidaxomycin biosynthesis, positions 3043-3063 are the recognition site of NdeI and the protective base, and SEQ ID NO. 2 is the amino acid sequence of the gene for positive regulation of fidaxomycin biosynthesis.

In the above method, step 2 inserts the SEQ ID NO.1 sequence fragment into NdI enzyme digestion and inserts it into the expression vector pIJ8630, the promoter is a erythromycin resistance gene-containing promoter; step 3-4 uses the expression vector Escherichia coli was subjected to parental conjugation to obtain the high-yield fidaxomycin genetically engineered strain Dean Plateau Actinomyces YP-2 (Actinoplanes deccanensis YP-2).

In the above method, the starting bacteria described in step 4 are Actinoplanes deccanensis YP-1, and the E. coli described in step 3 is E.coil ET12567 (pUZ8002).

In the above method, the yield of the genetically engineered strain of non-dacomycin obtained from Degan Plateau Actinoplanes YP-2 (Actinoplanes deccanensis YP-2) was 400% to 500% higher than the starting bacteria and up to 130mg / L. .

Yet another object of the present invention is to provide the application of the fidaxomycin genetically engineered bacteria Dean Plateau Actinomyces YP-2 (Actinoplanes deccanensis YP-2) in the preparation of a medicament for treating diarrhea caused by Clostridium difficile infection.

The present inventor purchased a strain of zooxactinomycetes that produces fidaxomycin from the Common Microbial Center of the China Microbial Species Collection Management Committee (CGMCC for short), but this strain has low fidamycin production and is not suitable for industrial applications . The high-yield Fidaxomycin genetically engineered strain Dean Plateau Actinomyces YP-2 (Actinoplanes deccanensis YP-2) can produce a large amount of Fidaxomycin, a drug used to treat diarrhea caused by Clostridium difficile, through fermentation The yield is increased by 400% to 500% compared to the starting bacteria, up to 130mg / L, which has a good application prospect and can promote the industrial development of fidaxomycin.

The advantages of the invention are:

(1) The present invention obtains high-yield fidamycin genetically engineered bacteria Degan Plateau Actinomycete YP-2 (Actinoplanes deccanensis YP-2) by over-expressing fidaxomycin biosynthesis positive regulatory genes in vivo, without the need for Perform in vitro expression, thereby overcoming the problems of difficult expression of some proteins in vitro, inactivity or low activity after expression, and fast and convenient operation; no need to prepare substrates for in vitro reactions, avoiding the difficulty of preparing or purchasing some substrates; The conditions of in vitro reactions need to be explored to simplify the process.

(2) The high-yield non-dacmycin genetically engineered strain Depth plateau zooplankton actinomycete YP-2 (Actinoplanes deccanensis YP-2) produced by the present invention has an increase in yield of 400% to 500%, and up to 130mg / L compared with the starting bacteria. It greatly reduces the production cost of fidaxomycin and provides technical support for industrial production to increase the yield of fidaxomycin.

In the present invention, through in vivo genetic engineering transformation, rational optimization of fidaxomycin biosynthesis, the high-yield fidaxomycin genetic engineering strain Degan Plateau Actinomyces YP-2 (Actinoplanes deccanensis YP-2) is obtained, and the method is highly efficient It is accurate, convenient and easy to operate, and provides a new research method for the construction of an efficient biosynthetic pathway for actinomycetes. The genetically engineered strain of Fidaxomycin Degan Plateau Actinoplanes YP-2 (Actinoplanes deccanensis YP-2) can be used in the preparation of medicines for treating diarrhea caused by Clostridium difficile infection.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a diagram of the construction of a high expression plasmid.

Fig. 2 is the biomass curve of the Dekan Plateau Actinomyces YP-1 and the Dekan Plateau Actinomyces YP-2 during fermentation.

Figure 3 shows the yield of fidaxomycin during the fermentation of Dekang Plateau S. actinomycetes YP-1 and Dekang Plateau S. actinomycetes YP-2.

Figure 4 shows the growth phenotype of the actinomycete YP-2 on the Degan Plateau.

Detailed ways

The present invention is further described with reference to the drawings and embodiments. The following examples are for better understanding of the present invention, but they are not limited to the present invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

Media used in the examples:

(1) ISP4 solid medium: soluble starch 1%, MgSO ₄ .7H ₂ O 0.1% K ₂ HPO ₄ 0.1%, NaCl 0.1%, (NH ₄ ) ₂ SO ₄ 0.2%, CaCO ₃ 0.2%, FeSO ₄ . 7H ₂ O 0.0001%, MnCl 0.0001% agar 2%, pH 7.0.

(2) 2 × YT liquid medium: peptone 1.6%, yeast extract 1%, NaCl 0.5%.

(3) Seed medium: glucose 1.75%, peptone 1.5%, NaCl 1.0%, and the rest is water. The percentages are all mass percentages, and the pH is natural.

(4) Fermentation medium B: yeast extract 0.3%, peptone 0.5%, malt extract 0.3%, glucose 1%, and the rest is water. The percentages are all mass percentages and the pH is natural.

(5) MS solid medium: 2% mannitol, 2% soybean powder, 2% agarose, and the rest is water. The percentages are all mass percentages, 10 mM MgCl ₂ , and the pH is natural.

Example 1 Construction of a genetically engineered bacterium with high yield of Fidaxomycin Actinoplanes Deccanensis YP-2 (Actinoplanes deccanensis YP-2)

I. Construction of pathway-specific gene expression vector pIJ8630-ermE * -fadR1

The expression vector for the positive regulation gene of fidaxomycin biosynthesis constructed in this embodiment is named pIJ8630-ermE * -fadR1, and this vector contains the positive regulation gene fadR1 of fidaxomycin biosynthesis. The positive regulation gene of fidaxomycin biosynthesis The sequence of fadR1 is shown in SEQ ID NO.1. SEQ ID NO.1 consists of 3063 nucleotides, positions 1-19 are NdeI recognition sites and protective bases, positions 20-297 are erythromycin resistance gene promoters, and fate 297-3042 are The coding sequence of the gene for positive control of biomycin biosynthesis. Positions 3043-3063 are NdeI recognition sites and protective bases, and SEQ ID NO. 2 is the amino acid sequence of the gene for positive control of fidaxomycin biosynthesis.

The construction method of pIJ8630-ermE * -fadR1 is as follows:

(1) Design specific primers to amplify the SEQ ID NO.1 sequence and recover;

Upstream primer SEQ ID No. 3: aagatctgcccagcatatgaactgttgaaagttgttta

Downstream primer SEQ ID No. 4: ccaagatctgcccagcatatgtcaggcggaatccgccatg.

(2) The SEQ ID No.1 fragment with NdeI digestion sites at both ends recovered in step (1) was digested with NdeI and the expression vector pIJ8630, which was cut by the same enzyme, was ligated to obtain the recombinant expression vector pIJ8630- ermE * -fadR1 (Figure 1).

2.Introduce the pIJ8630-ermE * -fadR1 expression vector into the starting bacteria Actinoplanes deccanensis YP-1 to obtain genetically engineered bacteria with high yields of fidaxomycin. (Actinoplanes deccanensis YP-2), the specific method is as follows.

(1) The pIJ8630-ermE * -fadR1 vector was transformed into the demethylated starting E. coli ET1256 / (pUZ8002 by heat shock method to obtain recombinant E.coil ET12567 / pUZ8002 / pIJ8630-ermE * -fadR1 .

(2) Inoculate E.coil ET1256 / (pUZ8002 / pIJ8630-ermE * -fadR1) into 5ml LB liquid medium (containing chloramphenicol, kanamycin and apramycin), and incubate at 37 ° C to OD ₆₀₀ At 0.6, the bacteria were collected by centrifugation, washed twice with 10 ml of LB liquid medium, and resuspended with 0.5 ml of 2 × YT liquid medium; Actinoplanes deccanensis YP-1 Incubate in 2 × YT liquid culture for 36 hours. Take 200 μl of mycelia and wash twice with 10 ml of LB liquid medium and resuspend with 0.5 ml of 2 × YT liquid medium. E. coli and zooplankton The filaments were mixed and evenly coated on MS solid medium. After incubation at 30 ° C for 16 hours, 20 μg / ml of nalidixic acid and apramycin were added, and the culture was continued for 4-5 days at 30 ° C. The transformants obtained above were used. Cultured on slanted medium containing apramycin for 4-5 days. It was confirmed by PCR that the target DNA sequence had been fused in Actinoplanes deccanensis YP-1 and obtained through fermentation screening. Actinoplanes deccanensis YP-2, a genetically engineered strain with high yield of Fidaxomycin.

(3) Actinoplanes YP-2 (Actinoplanes deccanensis YP-2) provided by the present invention has been deposited in the General Microbiology Center of the China Microbial Species Collection Management Committee (CGMCC), and is named and named: Actinoplanes deccanensis YP-2, deposit number: CGMCC No. 15743, deposit date: May 8, 2018, deposit address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing. [0034] Example 2 Synthesis of Fidaxomycin fermentation by starting bacteria and genetically engineered strains.

(1) The starting bacteria, Actinoplanes deccanensis YP-1, and genetically engineered strains Degan Plateau, actinoplanes YP-2 (Actinoplanes deccanensis YP-2) were cultured on ISP4 solid medium 10 days.

(2) On the ISP4 solid medium cultured by the Deccan Plateau Actinomyces YP-1 and the Deccan Plateau Actinomyces YP-2, take 1cm × 1cm pieces of bacteria each and inoculate them into the seed medium Incubate at 30 ° C for 16 hours at 200 rpm; inoculate the mycelium in the seed medium into fermentation medium B to an OD ₆₀₀ of 0.15; incubate at 30 ° C for 168 hours; incubate at 12, 24, 48, 72, 96 After 120 hours, samples were taken to determine the biomass and yield of fidaxomycin. The experiment was repeated three times.

Example 3 Comparison and Verification of Biomass and Fidaxomycin Production of Genetically Engineered Strains and Starting Bacteria

(1) Bacterial biomass: Take 1ml of bacterial solution fermented by fermentation medium B, collect the bacterial cells after centrifugation, wash with 1ml of sterile water, and then collect the bacterial cells after centrifugation. Dry at 50 ° C for 3 days and weigh. 2 is the biomass curve of zooplankton YP-1 and zooplankton YP-2.

(2) Fidaxomycin standard curve: Fidaxomycin standard was prepared with methanol to a certain concentration gradient solution and measured by HPLC. HPLC conditions: Chromatographic column: C18 column (Aglient, Eclipse Plus XDB, 5um, 4.6mm * 250mm); detection wavelength: 254nm; flow rate: 1.00mL / min; injection volume: 10ul; experimental mobile phase: mobile phase A phase is 10% acetonitrile, containing 0.08% trifluoroacetic acid (TFA), mobile phase B phase is 90% acetonitrile; HPLC sampling procedure: 0-20min, 30% -100% B phase; 20-25min, 100% B phase; 25- 30min, 100% -30% B phase.

(3) Analysis of Fidaxomycin production: 1ml of fermentation broth obtained by fermentation was added to 9mL of methanol, and after sufficient shaking, centrifuged at 12000rpm / min for 10min to settle mycelia and solids, and the supernatant was diluted 10 times with 0.45um Filter through a sterile microporous membrane, collect the filtrate, and use the obtained sample for HPLC detection. The detection conditions were the same as those of the standard curve for determination of Fidaxomycin. Figure 3 shows the production curve of Fidamycin from Dekan Plateau Actinomyces YP-1 and Degan Plateau.

(4) The fermentation results showed that the growth curves of genetically engineered strains and starting bacteria were not much different, but the genetically engineered bacteria Dek plateau actinomycete YP-2 (Actinoplanes deccanensis YP-2) in fermentation fermentation The yield of serotonin was increased by 400% to 500%, up to 130mg / L compared with the starting bacteria. Non-daptomycin can well treat diarrhea caused by Clostridium difficile infection. Therefore, the genetically engineered bacteria described in the present invention swim on the Degan Plateau. Actinoplanes YP-2 (Actinoplanes deccanensis YP-2) has good application prospects.

Example 4 Morphological Characteristics of Genetically Engineered Bacteria from Degan Plateau Actinomyces YP-2

The strain Deinoplankton actinomycete YP-2 was cultured in ISP4 agar medium for 10 days, and the basal hyphae and aerial hyphae developed well (Figure 4). Apparent characteristics in various different media, the results are shown in Table 1; physiological and biochemical characteristics of YP-2 in Degan Plateau, see Table 2.

Table 1: Culture characteristics of the Actinomycete YP-2 on the Degan Plateau:

Medium	growing situation	Basal hyphae	Aerial mycelium	Soluble pigment
Yeast extract malt agar	Extremely rich	Light orange	no	no
Oatmeal Agar	Sparse	Light amber	no	no
Inorganic salt starch agar	rich	Orange	no	no
Calcium malate agar	Sparse	Light orange	no	no
Glycerol aspartate agar	rich	Orange	no	no
Glucosamine Aspartate	Sparse	Light orange	no	no
Tyrosine agar	Light orange	no	no	brown

Table 2: Physiological and biochemical characteristics of the actinomycete YP-2 on the Degan Plateau:

characteristic	result	characteristic	result
Growth pH range	Zh	Carbon source utilization	Zh
pH <4	-	D-glucose	+
pH = 5 ～ 11	+	D-fructose	—
pH = 12	W	Mannose	+
NaCl tolerance	Zh	sucrose	+
3% NaCl	+	lactose	+
5% NaCl	W	Inositol	—
7% NaCl	-	D-mannitol	—
Growth temperature	Zh	Arabic candy	+
37 ℃	+	Xylose	+
45 ℃	-	D	+
Melanin production	-	Sodium acetate	-
Nitrate reduction	+	Raffinose	-
Starch hydrolysis	+	Zh	-
Gelatin liquefaction	+	Zh	Zh
Cellulose breakdown	—	Zh	Zh

Note: "W" means weak positive result, "+" means positive result, and "-" means negative result.

Claims (7)

1. A non-dacmycin genetically engineered bacterium is characterized in that the daptomycin genetically engineered bacterium is a Dekang plateau zooplankton actinomycete, which is classified and named: Degan Plateau zooplankton actinomycete YP-2 (Actinoplanes deccanensis YP-2), depository unit: General Microbial Center of China Microbial Collection Management Committee, deposit number: CGMCC No. 15743, deposit date: May 8, 2018, deposit address: No. 1 Beichen West Road, Chaoyang District, Beijing number 3.
2. A method for constructing genetically engineered bacteria of Fidaxomycin, which is characterized by the following steps: introducing positive regulatory genes for Fidaxomycin biosynthesis into the starting bacteria Degan Plateau Actinomycetes YP-1, and screening A genetically engineered strain with higher yields of fidaxomycin than the starting bacteria was obtained. Actinoplanes deccanensis YP-2; Actinoplanes deccanensis YP-2; purchased from China. The General Microbiology Center of the Deposit Management Committee, its deposit number is: CGMCC No. 4.2098, and its classification name is Actinoplanes Deccanensis. The deposit date is August 16, 2001.
3. The method for constructing a genetically engineered strain of fidaxomycin according to claim 2, wherein the method is implemented by the following steps:

   (1) Design specific primers to amplify the SEQ ID NO.1 sequence and recover;

   Upstream primer SEQ ID No. 3: aagatctgcccagcatatgaactgttgaaagttgttta

   Downstream primer SEQ ID No. 4: ccaagatctgcccagcatatgtcaggcggaatccgccatg

   (2) The fragment recovered in step (1) was digested and inserted into the expression vector pIJ8630 to obtain the plasmid pIJ8630-ermE * -fadR1 and verified;

   (3) The plasmid obtained in step (2) is transformed into E. coli ET12567 / pUZ8002 through transformation;

   (4) transferring the plasmid in step (2) into the starting fungus Degan plateau actinomycete YP-1 through the parental conjugation transduction;

   (5) The genetically engineered strain of high-yield fidaxomycin was obtained from Deqian plateau actinomycete YP-2 through fermentation screening, with a yield of 130 mg / L.
4. The method for constructing a genetically engineered strain of fidaxomycin according to claim 3, characterized in that in step (2), the sequence of SEQ ID No. 1 is inserted into the plasmid pIJ8630 and then introduced into the starting fungus on the Degan Plateau. Actinomyces YP-1.
5. The method for constructing a genetically engineered strain of fidaxomycin according to claim 4, characterized in that SEQ ID NO.1 consists of 3063 nucleotides, and positions 1-19 are NdeI recognition sites and protective bases 20th to 297th is the erythromycin resistance gene promoter, 297-3042th is the coding sequence of the positive regulatory gene of fidaxomycin biosynthesis, 30th 3063th is the NdeI recognition site and the protective base, SEQ ID NO. 2 is the amino acid sequence of the positive regulatory gene of fidaxomycin biosynthesis.
6. The method for constructing a genetically engineered strain of fidaxomycin according to claim 4, characterized in that the SEQ ID NO.1 sequence fragment is digested with NdeI and inserted into an expression vector pIJ8630. The promoter is The erythromycin resistance gene promoter is contained; the expression vector is subjected to parental conjugation with E. coli to obtain the high-yield non-dacomycin genetically engineered bacterium Dean Plateau Actinomyces YP-2.
7. The application of the fidaxomycin genetically engineered bacterium according to claim 1 in the preparation of a medicament for treating diarrhea caused by Clostridium difficile infection, said genetically engineered bacterium is Actinoplanes Deccancan YP-2 -2).

Images