CN117778290A - Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof - Google Patents

Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof Download PDF

Info

Publication number
CN117778290A
CN117778290A CN202410008031.5A CN202410008031A CN117778290A CN 117778290 A CN117778290 A CN 117778290A CN 202410008031 A CN202410008031 A CN 202410008031A CN 117778290 A CN117778290 A CN 117778290A
Authority
CN
China
Prior art keywords
seq
amycolatopsis orientalis
aada
neo
yield
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202410008031.5A
Other languages
Chinese (zh)
Inventor
李永泉
赵馨仪
高文丽
马烈
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN202410008031.5A priority Critical patent/CN117778290A/en
Publication of CN117778290A publication Critical patent/CN117778290A/en
Pending legal-status Critical Current

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides engineering bacteria for high-yield of an orivancin direct precursor and application thereof, wherein the engineering bacteria are amycolatopsis orientalis (Amycolatopsis orientalis), potential competitive biosynthesis paths of the orivancin direct precursor (Chloroeremomycin) are knocked out, and simultaneously, the speed-limiting enzyme gene of the orivancin direct precursor is highly expressed, so that the high-yield bacteria of the orivancin direct precursor are obtained, fermentation process optimization is carried out, and the output of the orivancin direct precursor is improved to 3.1 times of that of a starting bacteria, and is up to 428mg/L. The invention uses the combination of knocking out potential competitive metabolic pathways, enhancing the expression of speed-limiting enzyme and optimizing fermentation process, successfully and positively superposing various high-yield strategies, greatly reduces the production cost of the direct precursor of the olympic vancin, improves the biosynthesis efficiency of the direct precursor of the olympic vancin, and has important application value in the industrial production of the olympic vancin.

Description

Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof
Technical Field
The invention belongs to the technical field of pharmaceutical biology, and relates to engineering bacteria for high-yield of an orivancin direct precursor and application thereof.
Background
Oritavancin (Oritavancin), developed by medicinal corporation, was marketed by the FDA in the United states in 2014 under the trade name Orbaciv, which is a new generation of glycopeptide antibiotics after vancomycin.
Orimaxsin is used to treat Acute Bacterial Skin and Skin Structure Infections (ABSSSIs), the first and only antibiotic of a single dose treatment regimen. It exerts a bactericidal effect by blocking transglycosylation of peptidoglycan biosynthesis, thereby inhibiting bacterial cell wall formation, leading to bacterial cell death. In addition, the aureovancin has strong antibacterial activity on vancomycin-insensitive staphylococci and enterococci, so that the application of the aureovancin can effectively reduce the development of drug resistance.
Amycolatopsis orientalis is a producer of the direct precursor of aureoeremomycin (also known as A82846B), and the current fermentation unit is lower. Therefore, the synthesis method utilizes the synthesis biotechnology to rationally reconstruct the synthesis way so as to improve the fermentation level of the Chloroeremomycin, and has important application value for the industrialization of the Olivermectin.
Disclosure of Invention
The invention aims to provide an engineering bacterium for high-yield of an orivancin direct precursor, which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms and is classified and named as follows: amycolatopsis orientalis (Amycolatopsis orientalis) AO-B, accession number: CGMCC No.29179, preservation day: 2023.11.30.
the engineering bacteria are constructed by the following method:
step (1): purchase specific primers are prepared from amycolatopsis orientalis (Amycolatopsis orientalis) with the preservation number of CGMCC No.21140, and are classified and named as amycolatopsis orientalis (Amycolatopsis orientalis), genome is used as a template to amplify upstream and downstream homology arms SEQ ID No.1 and SEQ ID No.2 of a core gene orf5 (SEQ ID No. 13) of a chlorofoermemycin anabolism potential competition pathway gene cluster 4, and the homology arms are recovered:
SEQ ID NO.1 upstream primer SEQ ID NO.3 ctaagagtcgaccgcacccgtgctggccgaaaaccga
SEQ ID NO.1 downstream primer SEQ ID NO.4 cgatggcgacccgtgggccgcagcaggacgaagtcgccgagcgacg
SEQ ID NO.2 upstream primer SEQ ID NO.5 gcggccacggtcgcccattcgggt
SEQ ID NO.2 downstream primer SEQ ID NO.6 ctcttctcacctgctgaaaagcttcggcgtgctccgccgccgcctttcttctgt
Step (2): the SEQ ID NO.1 and SEQ ID NO.2 fragments recovered in the step (1) are inserted into the HindIII cleavage site of pSET153-aadA-neo (SEQ ID NO. 7) by a seamless cloning method to obtain a plasmid pSET153-aadA-neo-ECO0501, and verification is carried out;
step (3): the plasmid obtained in the step (2) is transduced into E.coli E.coil ET12567/pUZ8002 by chemical transformation;
step (4): transferring the plasmid in the step (2) into Amycolatopsis orientalis CGMCC21140 through conjugal transfer, screening single-crossover and double-crossover strains, and knocking out orf5 genes through homologous crossover to obtain Amycolatopsis orientalis AO-A;
step (5): the Chloroeremomycin glycosyltransferase gene evaE fragment (SEQ ID NO. 8) was amplified using the Amycolatopsis orientalis CGMCC21140 genome as a template and recovered:
SEQ ID NO.8 upstream primer SEQ ID NO.9 gggatacgcggtaccataaggctgatcaccgtgctc
SEQ ID NO.8 downstream primer SEQ ID NO.10 catcttgttcatacatcatcatcatcattgctgcgcgcgagcctttcc
Step (6): the recovered fragment in the step (5) and the promoter are inserted into an expression vector pIJ8660-aadA-neo (SEQ ID NO. 11) together to obtain a plasmid pIJ8660-aadA-neo-evaE, and the promoter is a synthetic fragment which is a high-efficiency promoter P from Eggrethella lenta DSM2243 gapdh (SEQ ID NO. 12) and verified;
step (7): the plasmid obtained in the step (6) is transduced into E.coli E.coil ET12567/pUZ8002 by chemical transformation to obtain E.coli E.coil ET12567/pUZ8002/pIJ8660-aadA-neo-evaE;
step (8): transferring the plasmid in the step (6) into Amycolatopsis orientalis AO-A through conjugation transfer of E.coli E.coil ET12567/pUZ8002/pIJ8660-aadA-neo-evaE to obtain Amycolatopsis orientalis AO-B;
step (9): the fermentation yield of the Amycolatopsis orientalis AO-B strain Chloroeremomycin is 2.3 times of that of CGMCC No.21140 and reaches 322mg/L through fermentation and high performance liquid chromatography detection.
Step (10): medium composition optimization (selection of glucose, peptone, maltodextrin, naCl, KCl, mgSO using Plackett-Burman design) 4 And KH 2 PO 4 Significant factors affecting a82846B production in 7 components; adopting a three-factor three-level Box-Behnken design to further optimize fermentation conditions; the influence of conditions such as fermentation temperature, initial pH, seed age, inoculum size, culture medium volume and the like on the yield of A82846B is examined by a single factor test. Ideal conditions were obtained for 30℃at an initial pH of 6.5, 72h seed age, 2% inoculum size, 25mL medium size), and for Amycolatopsis orientalis (Amycolatopsis orientalis) AO-B (accession number: CGMCC No.29179, preservation day: 2023.11.30 The fermentation yield of the strain Chloroeemomycin reaches 3.1 times of CGMCC No.21140 and reaches 428mg/L.
The invention also aims to provide application of the engineering bacteria in preparing an olympic acid direct precursor (Chloroeremomycin) by fermentation. The engineering bacteria are amycolatopsis orientalis (Amycolatopsis orientalis), the preservation number is CGMCC No.21140, a potential competition path, namely a core gene 4-guanidine butyl synthase gene orf5 of ECO0501 is deleted, an direct precursor of the aureomycin is subjected to high expression by the everase, and the high-yield fungus amycolasin orientalis obtained after fermentation optimization, namely amycolatopsis orientalis Amycolatopsis orientalis AO-B (the preservation number is CGMCC No.29179, and the preservation date is 2023.11.30). The strain is cultured in a seed culture medium at 30 ℃ for 72 hours, then is inoculated into a GPM culture medium, is cultured at 30 ℃ for 168 hours for sampling, and the Chloroeremomycin in fermentation liquor can reach 3.1 times of the original strain and can reach 428mg/L.
The invention is thatHas the advantages that: (1) The invention adopts potential competition approach release (knockout orf 5) to limit speed synthetase gene high expression (evaE) and fermentation process optimization (adopts Plackett-Burman design to screen glucose, peptone, maltodextrin and NaCl, KCl, mgSO) 4 And KH 2 PO 4 Significant factors affecting a82846B production in 7 components; adopting a three-factor three-level Box-Behnken design to further optimize fermentation conditions; the influence of conditions such as fermentation temperature, initial pH, seed age, inoculum size, culture medium volume and the like on the yield of A82846B is examined by a single factor test. Ideal conditions are obtained, wherein the temperature is 30 ℃, the initial pH is 6.5, the seed age is 72 hours, the inoculation amount is 2 percent, and the culture medium amount is 25 mL); the method has the advantages that the aim is clear, various high-yield strategies are superimposed in forward direction combination, the incompatibility problem of each high-yield method does not occur, the superposition effect is obvious, and beneficial demonstration is made for the high-yield transformation of other glycopeptide antibiotics.
(2) The yield of the high-yield aureomycin direct precursor chloreremomycin genetic engineering bacteria constructed by the invention is 3.1 times of that of the original strain under the fermentation condition of the invention, which reaches 428mg/L, greatly reduces the production cost of the aureomycin direct precursor chloreremomycin, and has important application value in the industrial production of the aureomycin direct precursor chloreremomycin.
Drawings
FIG. 1 is a map of knockout plasmid pSET153-aadA-neo-ECO 0501.
FIG. 2 is a map of the expression plasmid pIJ 8660-aadA-neo-evaE.
FIG. 3 is a histogram of fermentation yields of the final engineering bacterium Amycolatopsis orientalis Amycolatopsis orientalis AO-B of the invention before and after optimization of the fermentation process and the initial strain Amycolatopsis orientalis (preservation number: CGMCC No. 21140).
Detailed Description
The invention is further described with reference to the drawings and examples. The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The medium used in the examples:
YMG solid medium: 4.0g of yeast extract, 10.0g of malt extract, 4.0g of glucose, 20.0g of agar, 1000mL of distilled water and pH7.3.
LB liquid medium: 10.0g of peptone, 5.0g of yeast extract, 10g of NaCl, 20.0g of agar, 1000mL of distilled water and pH7.3.
2 XYT liquid medium: 16.0g of peptone, 10.0g of yeast extract, 5g of NaCl, 20.0g of agar, 1000mL of distilled water and pH7.3.
MS solid medium: mannitol 20g, soybean meal 20g, agarose 20g, distilled water 1000mL pH7.3.
Seed culture medium: peptone 20g, naCl 5g, glucose 2.5g, K 2 HPO 4 2.5g, 1000mL of distilled water, pH7.3.
Fermentation medium: peptone 5g, glucose 20g,NaCl 1g,KCl 0.5g,MgSO 4 0.8g，KH 2 PO 4 0.1g, 1000mL of distilled water, pH7.3.
GPM medium (glucose-peptone-maltodextrin medium); glucose 22g, peptone 6g, maltodextrin 12g,NaCl 1g,KCl 0.5g,MgSO 4 0.8g,KH 2 PO 4 0.1g, 1000mL of distilled water, pH7.3.
Example 1: construction method of Chloroeremomycin high-yield bacteria
Construction of knockout vector pSET153-aadA-neo-ECO0501
The potential competitive pathway gene cluster core gene orf5 knockout vector constructed in this example is named pSET153-aadA-neo-ECO0501, and contains homologous arms on the upstream and downstream of the ECO0501 gene cluster core gene orf5, as shown in FIG. 1, and as shown in sequences SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 7.
The construction method of pSET153-aadA-neo-ECO0501 is as follows:
designing a specific primer, amplifying SEQ ID NO.1 and SEQ ID NO.2 by taking a Amycolatopsi sorientalis CGMCC21140 genome as a template, and recovering the sequences:
SEQ ID NO.1 upstream primer SEQ ID NO.3 ctaagagtcgaccgcacccgtgctggccgaaaaccga
SEQ ID NO.1 downstream primer SEQ ID NO.4 cgatggcgacccgtgggccgcagcaggacgaagtcgccgagcgacg
SEQ ID NO.2 upstream primer SEQ ID NO.5 gcggccacggtcgcccattcgggt
SEQ ID NO.2 downstream primer SEQ ID NO.6 ctcttctcacctgctgaaaagcttcggcgtgctccgccgccgcctttcttctgt
The fragments of SEQ ID No.1 and SEQ ID No.2 recovered in step (1) were ligated with the HindIII digested shuttle plasmid vector pSET153-aadA-neo to give the recombinant expression vector pSET153-aadA-neo-ECO0501, the plasmid map of which is shown in FIG. 1.
And (2) introducing the pSET153-aadA-neo-ECO0501 expression vector into a starting bacterium Amycolatopsi sorientalis CGMCC21140 to obtain a genetically engineered bacterium Amycolatopsi sorientalis AO-A, wherein the specific method is as follows.
The pSET153-aadA-neo-ECO0501 vector was transformed into demethylated E.coli ET1256/pUZ8002 by heat shock at 42℃for 90 s.
The plasmid of interest pSET153-aadA-neo-ECO0501 was transformed into E.coli ET12567/pUZ8002, coated on LB plates containing the corresponding antibiotics (spectinomycin, kanamycin, chloramphenicol), and the monoclonal was picked up into 5mL LB, incubated at 37℃and 220rpm overnight. Then transferred to 15mL LB containing the corresponding antibiotics at a ratio of 2% (expansion culture), and cultured to OD 600 About 0.4. The cells were collected by centrifugation at 6000rpm for 5min, washed 3 times with 2mL of LB medium, and suspended in 500. Mu.L of LB medium as donor bacteria for conjugation transfer. Actinomycete mycelium is used as acceptor fungus, and the culture is carried out at 28-30 ℃ and 220rpm for about 48-60 hours by TSB. After collection of 250. Mu.L of mycelia by centrifugation at 6000rpm for 5min, the mycelia were washed 3 times with 2 XYT medium and resuspended in 500. Mu.L of 2 XYT medium as recipient bacteria. Acceptor and donor bacteria mix: mixing 500 μl donor bacteria and 500 μl acceptor bacteria uniformly, (centrifuging at 6000rpm, suspending the bacteria with the rest 500 μl liquid), coating on MS culture medium (without antibiotics) containing 10mM magnesium ion, blow-drying on a clean bench, and culturing in a constant temperature incubator at 30deg.C. After 16-20h of culture, plates were covered with apramycin (final concentration of 200. Mu.g/mL), kanamycin (final concentration of 50. Mu.g/mL) and nalidixic acid (final concentration of 25. Mu.g/mL), cultured at 30℃for 4-5d, and the grown transformant passaging resistant YMG plates (final concentration of apramycin of 200. Mu.g) were picked outThe final concentrations of g/mL and kanamycin are 50 mug/mL), and the culture is carried out for 7 days at 37 ℃, and the monoclonal extract genome is picked to identify the single exchange strain. The single exchange strain is selected for relaxation culture for 3 generations, kanamycin sensitive strain is selected for genome verification, and the knocked-out strain is determined and named Amycolatopsi sorientalis AO-A.
Example 2: construction method of Amycolatopsi sorientalis AO-B
Step (1), construction of expression vector pIJ8660-aadA-neo-evaE
The expression vector of the glycosyltransferase of the speed-limiting enzyme for the biosynthesis of the Chloroeremomycin constructed in the embodiment is named as pIJ8660-aadA-neo-evaE, and contains the glycosyltransferase gene evaE for the biosynthesis of the Chloroeremomycin, and the sequence of the glycosyltransferase gene evaE is shown as SEQ ID No. 8.
The construction method of pIJ8660-aadA-neo-evaE is as follows:
designing a specific primer, amplifying the sequence of SEQ ID NO.8 by taking a Amycolatopsi sorientalis CGMCC21140 genome as a template, and recovering:
SEQ ID NO.8 upstream primer SEQ ID NO.9 gggatacgcggtaccataaggctgatcaccgtgctc
SEQ ID NO.8 downstream primer SEQ ID NO.10 catcttgttcatacatcatcatcatcattgctgcgcgcgagcctttcc
The fragment of SEQ ID NO.8 recovered in step (2) and the artificially synthesized high-efficiency promoter P from Eggrethella lenta DSM2243 were subjected to a sequence analysis gapdh The fragment (SEQ ID NO. 12) was joined to NdeI-BglII double digested expression vector pIJ8660-aadA-neo (SEQ ID NO. 11) by means of seamless cloning to give recombinant expression vector pIJ8660-aadA-neo-evaE, plasmid map as shown in FIG. 2.
And (3) introducing the pIJ8660-aadA-neo-evaE expression vector into Amycolatopsi sorientalis AO-A to obtain Amycolatopsi sorientalis AO-B genetically engineered bacteria, wherein the specific method is as follows.
The pIJ8660-aadA-neo-evaE vector was transformed into demethylated E.coli E.coil ET1256/pUZ8002 by heat shock at 42℃for 90 s.
Transformation of the plasmid of interest pIJ8660-aadA-neo-evaE into E.coli ET12567/pUZ8002 was coated onto LB plates containing the corresponding antibiotics (spectinomycin, kanamycin, chloramphenicol) and the monoclonal was picked up into 5mL LBThe cells were incubated overnight at 37℃and 220 rpm. Then transferred to 15mL LB containing the corresponding antibiotics at a ratio of 2% (expansion culture), and cultured to OD 600 About 0.4. The cells were collected by centrifugation at 6000rpm for 5min, washed 3 times with 2mL of LB medium, and suspended in 500. Mu.L of LB medium (500. Mu.L of large intestine per tube of Streptomyces) as donor bacteria for conjugal transfer. Hypha as recipient bacteria were cultured at 28-30deg.C and 220rpm with TSB for about 48-60h. After collection of 250. Mu.L of mycelia by centrifugation at 6000rpm for 5min, the mycelia were washed 3 times with LB medium and resuspended in 500. Mu.L of 2 XYT medium as recipient bacteria. Acceptor and donor bacteria mix: mixing 500 μl donor bacteria and 500 μl acceptor bacteria uniformly, (centrifuging at 6000rpm, suspending the bacteria with the rest 500 μl liquid), coating on MS culture medium (without antibiotics) containing 10mM magnesium ion, blow-drying on a clean bench, and culturing in a constant temperature incubator at 30deg.C. After 16-20h of incubation, plates were covered with kanamycin (final concentration 50. Mu.g/mL) and nalidixic acid (final concentration 25. Mu.g/mL), incubated at 30℃for 4-5d, and the grown transformant was picked up for passage-resistant YMG plates (final concentration 50. Mu.g/mL kanamycin) and the genomic identification was performed by monoclonal extraction.
Example 3: fermentation verification of parent strain Amycolatopsi sorientalis CGMCC21140 and genetically engineered strain Amycolatopsi sorientalis AO-B Chloroeremomycin
And culturing the chromogenic parent strain and the genetically engineered strain on YMG solid medium for 5 days. Scraping bacterial blocks with the length of about 1cm multiplied by 1cm, inoculating the bacterial blocks into a seed culture medium, and culturing the bacterial blocks at 30 ℃ for 48 hours at the rotating speed of 220rpm; mycelium in the seed culture medium is inoculated to the fermentation culture medium with an inoculum size of 8 percent, and is cultured for 168 hours at 30 ℃, and samples are respectively taken and measured for the yield of the Chloroeremomycin in the culture for 24, 48, 72, 96, 120, 144 and 168 hours.
Example 4: optimization of fermentation process of genetically engineered bacterium Amycolatopsi sorientalis AO-B
Screening for glucose, peptone, maltodextrin, naCl, KCl, mgSO using the Plackett-Burman design 4 And KH 2 PO 4 Significant factors affecting a82846B production in 7 components. The response surface method (response surface method, RSM) is a practical tool for optimizing fermentation factors. In order to find the optimal fermentation concentration of the three important medium compositions, three were usedThe factor three level Box-Behnken design further optimized the fermentation conditions. Fermentation experiments prove that under the optimal condition (GPM culture medium) of mathematical model prediction, the fermentation can reach the maximum value of model prediction. In order to further optimize the shake flask fermentation process, the influence of conditions such as fermentation temperature, initial pH, seed age, inoculum size, culture medium volume and the like on the yield of A82846B is examined through a single factor test. Ideal conditions of 30 ℃ temperature, 6.5 initial pH, 72 hours seed age, 2 percent of inoculation amount and 25mL of culture medium are obtained.
Example 5: the initial strain Amycolatopsi sorientalis (preservation number: CGMCC No. 21140) uses non-optimized fermentation conditions and culture medium, and the final amycolatopsis orientalis Amycolatopsis orientalis AO-B (preservation number: CGMCC No.29179, preservation day: 2023.11.30) uses optimized post-fermentation conditions and culture medium conditions for fermentation experiment, and the yield of the fermentation broth Chloroeremomycin is compared.
And culturing the chromogenic parent strain and the genetically engineered strain on YMG solid medium for 5 days. Scraping bacterial blocks with the length of about 1cm multiplied by 1cm, inoculating the bacterial blocks into a seed culture medium, and respectively culturing an original bacterial strain and a final engineering bacterium at 30 ℃ for 48 hours and 72 hours at the rotating speed of 220rpm; mycelium in the seed culture medium of the original strain and the final engineering bacteria is respectively inoculated into a fermentation culture medium and GPM, and is cultured for 168 hours at 30 ℃, and samples are respectively taken and measured for the yield of the Chloroeremomycin in the culture for 24 hours, 48 hours, 72 hours, 96 hours, 120 hours, 144 hours and 168 hours.
Example 6: chloroermemycin yield assay:
step (1), HPLC conditions: chromatographic column: c18 column (Aglient, eclipse Plus XDB,5 μm,4.6mm x 250 mm); detection wavelength: 280nm; flow rate: 1.00mL/min; sample injection amount: 20. Mu.L; experimental mobile phase: the mobile phase A phase is water containing 0.1% formic acid, and the mobile phase B phase is 100% acetonitrile; HPLC procedure: 0-15min, 5% -15% of phase B; 15-20min, 15% -100% of phase B; 20-23min, 100% of phase B; 23-30min, 5% of phase B.
Step (2), analysis of yield of Chloroeremomycin: 1mL of the fermentation broth obtained by fermentation was added with 1mL of methanol, after sufficient shaking, the mixture was centrifuged at 12000rpm/min for 10min to settle mycelia and solids, and the supernatant was filtered with a sterile microporous filter membrane of 0.45. Mu.m, and the filtrate was collected and the obtained sample was used for HPLC detection. FIG. 3 is a graph showing the yield change of the produced Chloroenomycin by using the starting strain producing Chloroenomycin and the engineering strain Amycolatopsi sorientalis AO-B (preservation number: CGMCC No.29179, preservation date: 2023.11.30) producing high yield Chloroenomycin.
And (3) the gene engineering bacteria amycolatopsis orientalis Amycolatopsi sorientalis AO-B (collection number: CGMCC No.29179, collection day: 2023.11.30) has high yield of Chloroeremomycin, the yield is 3.1 times that of the original strain and is up to 428mg/L, and the aureomomycin can well treat skin infection caused by gram-positive bacteria, so that the method for constructing the high yield of Chloroeremomycin has important application value.

Claims (3)

1. The engineering bacteria for high-yield of the direct precursor of the oritavancin is characterized in that the strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and is classified and named as follows: amycolatopsis orientalis (Amycolatopsis orientalis) AO-B, accession number: CGMCC No.29179, preservation day: 2023.11.30.
2. the preparation method of engineering bacteria according to claim 1, wherein the successful forward superposition combination of a plurality of high-yield strategies is realized by the following steps:
step (1): designing a specific primer, amplifying the sequences of SEQ ID NO.1 and SEQ ID NO.2 by taking the amycolatopsis orientalis Amycolatopsis orientalis CGMCC21140 genome as a template, and recovering:
SEQ ID NO.1 upstream primer SEQ ID NO.3 ctaagagtcgaccgcacccgtgctggccgaaaaccga
SEQ ID NO.1 downstream primer SEQ ID NO.4 cgatggcgacccgtgggccgcagcaggacgaagtcgccgagcgacg
SEQ ID NO.2 upstream primer SEQ ID NO.5 gcggccacggtcgcccattcgggt
SEQ ID NO.2 downstream primer SEQ ID NO.6 ctcttccacctgcctgaaaagcttcggcgtgctccgccgccttcttcgt;
step (2): the insert sequences of the SEQ ID NO.1 and the SEQ ID NO.2 fragment recovered in the step (1) are shown as pSET153-aadA-neo shown as SEQ ID NO.7, so that a plasmid pSET153-aadA-neo-ECO0501 is obtained, and verification is carried out, wherein the plasmid is used for knocking out a core gene orf5 of a potential metabolic competition pathway ECO0501 synthesis gene cluster, and the sequence is shown as SEQ ID NO. 13;
step (3): the plasmid obtained in the step (2) is transduced into E.coli E.coil ET12567/pUZ8002 by chemical transduction to obtain E.coli E.coil ET12567/pUZ8002/pSET153-aadA-neo-ECO0501;
step (4): transferring the plasmid in the step (2) into a Chloroeremomycin producing strain Amycolatopsis orientalis CGMCC21140 by performing conjugation transfer through escherichia coli E.coil ET12567/pUZ8002/pSET153-aadA-neo-ECO0501; the transformant is passaged, a single colony is selected, a single exchange strain is verified, the transformant is passaged, after loose culture, a strain with orf5 completely deleted is selected, and the strain is named as Amycolatopsis orientalis AO-A;
step (5): designing a specific primer, amplifying a gene evaE fragment sequence by taking the amycolatopsis orientalis Amycolatopsis orientalis CGMCC21140 genome as a template, and recovering:
the upstream primer SEQ ID NO.9: gggatacgcggtaccatgaagctgatcaccgtgctc
The downstream primer SEQ ID NO.10: catcttgttcaatcatcatatgtcatgcgcgagcctttcc;
step (6), inserting the fragment recovered in the step (5) into an expression vector pIJ8660-aadA-neo to obtain a plasmid pIJ8660-aadA-neo-evaE, wherein the promoter is a high-efficiency promoter P from Eggrethella lenta DSM2243 gapdh And verifying that the plasmid is used for expressing the speed-limiting enzyme evaE at high speed;
step (7), the plasmid obtained in the step (6) is transduced into E.coli E.coil ET12567/pUZ8002 by chemical transformation to obtain E.coli E.coil ET12567/pUZ8002/pIJ8660-aadA-neo-evaE;
step (8), transferring the plasmid in the step (6) into Amycolatopsis orientalis AO-A through conjugation transfer of E.coli E.coil ET12567/pUZ8002/pIJ8660-aadA-neo-evaE to obtain Amycolatopsis orientalis AO-B;
and (9) obtaining optimized fermentation conditions through culture medium component optimization and shake flask fermentation process optimization, wherein the yield of the Chloroeremomycin of the Amycolatopsis orientalis AO-B strain reaches 3.1 times of CGMCC21140 and reaches 428mg/L under the optimized fermentation conditions.
3. The application of the engineering bacteria in preparing the direct precursors of the olympic vancin by fermentation, which is characterized in that the engineering bacteria are classified and named as follows: amycolatopsis orientalis (Amycolatopsis orientalis) AO-B, accession number: cgmccno. 2979.
CN202410008031.5A 2024-01-04 2024-01-04 Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof Pending CN117778290A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410008031.5A CN117778290A (en) 2024-01-04 2024-01-04 Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410008031.5A CN117778290A (en) 2024-01-04 2024-01-04 Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof

Publications (1)

Publication Number Publication Date
CN117778290A true CN117778290A (en) 2024-03-29

Family

ID=90390910

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410008031.5A Pending CN117778290A (en) 2024-01-04 2024-01-04 Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof

Country Status (1)

Country Link
CN (1) CN117778290A (en)

Similar Documents

Publication Publication Date Title
WO2015000327A1 (en) Biosynthesis gene cluster of streptomyces xiamenensis, purpose, and bacterial strain
CN108441459B (en) Recombinant streptomyces tuberculatus capable of producing amphotericin B at high yield and application thereof
CN111088254B (en) Endogenous carried exogenous gene efficient controllable expression system
CN112111439A (en) Saccharopolyspora spinosa for high yield of spinosad and method for improving yield of spinosad
CN108753674B (en) Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof
CN111197020B (en) Recombinant bacterium for producing milbemycins as well as construction method and application thereof
WO2019223433A1 (en) Genetically engineered bacterium of fidaxomicin and construction method and application thereof
CN111378008A (en) Lipopeptide compound Totopotecamides, and preparation method and application thereof
CN112625925B (en) High-yield strain of dalbavancin precursor A40926B0 and application thereof
CN117778290A (en) Engineering bacterium for high-yield of Oriwaxy direct precursor and application thereof
CN110343650B (en) Recombinant streptomyces tuberculatus for producing amphotericin B and application thereof
CN105566411B (en) Lincomycin biosynthesis intermediate product and preparation method and application thereof
CN108456689B (en) Method for improving biosynthesis yield of ansamitocin P-3
CN112430608B (en) Method for constructing high-yield engineering bacteria of oritavancin precursor and application
CN116445515B (en) Gene cluster participating in Li Pusi statin and structural analogue synthesis and application thereof
CN110904079A (en) β -fructofuranosidase mutant, mutant gene and application thereof in preparation of vitamin B12In (1)
CN114150006B (en) Gene cluster and recombinant bacterium capable of improving milbemycins yield and preparation method and application thereof
CN110846264A (en) Genetically engineered bacterium and preparation method and application thereof
CN113355339B (en) Traceless fixed-point transformation method for large gene cluster and application thereof
CN114717281B (en) Method for improving fermentation yield of heterologous spinosad expression strain by optimizing carbon source
CN113846041B (en) Method for enhancing expression of transporter genes to increase salinomycin fermentation levels
Zhang et al. Mining and characterization of the PKS–NRPS hybrid for epicoccamide A: a mannosylated tetramate derivative from Epicoccum sp. CPCC 400996
CN110408643B (en) Method for improving yield of streptomyces autolyzed oleanolic acid and derivatives thereof
CN114540446A (en) High-yield culture medium for producing bleomycin E by using deep sea streptomycete gene engineering mutant strain and large-scale fermentation process thereof
CN107557376B (en) Engineering bacterium for producing lasalocid and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination