CN112430555A

CN112430555A - Actinomycete chassis strain and application thereof

Info

Publication number: CN112430555A
Application number: CN202011460485.4A
Authority: CN
Inventors: 李永泉; 郦月萍; 卜庆廷
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2021-03-02
Anticipated expiration: 2040-12-11
Also published as: CN112430555B

Abstract

The invention discloses an actinomycete chassis strain and application thereof. The strain is Actinoplanes Dechenensis YP-D8, and is obtained by targeted knockout of a redundant genome region existing in Actinoplanes Dechensis YP-1 through a CRISPR/Cpf1 gene editing system. The fidaxomicin biosynthesis gene cluster is introduced into the Deshenghao actinoplanes YP-D8 to obtain a fidaxomicin gene cluster multi-copy strain Deshenghao actinoplanes YP-M2, the yield of the strain can reach 65.6mg/L under normal fermentation conditions, the yield is improved by 200-300% compared with that of a starting strain, and the fermentation yield is stable in passage. The strain has high transformation efficiency, high energy and cofactor content, strong foreign protein expression capacity and high genetic stability, and can be applied to the fields of pharmaceutical research and industrial production, in particular to the preparation of I-type polyketone antibiotics.

Description

Actinomycete chassis strain and application thereof

Technical Field

The invention belongs to the field of microbial pharmacy, and relates to an actinomycete chassis strain dejohana planocomiana YP-D8 and application thereof.

Background

The actinomycetes are gram-positive bacteria, are rich in various drug synthesis precursors and synthesis elements in vivo, have strong secondary metabolite synthesis capacity, can synthesize polyketide, non-ribosomal peptide, aminoglycoside, ribosomal peptide, terpenoid and other compounds, and about 65 percent of currently known microbial drugs (more than 1.5 million) are derived from actinomycetes; in addition, many actinomycetes have an integral resistance/resistance mechanism that protects themselves from poisoning by the active product. Therefore, the chassis developed based on actinomycetes can be used for various drug syntheses. Bioinformatics analysis can be utilized to find that a large number of redundant genomes exist in actinomycete genomes, and the expression of the redundant genomes consumes a large number of precursors, cofactors and energy and is not beneficial to the synthesis of target secondary metabolites; meanwhile, a plurality of movable elements are contained in the redundant genome, and chromosome rearrangement events such as gene deletion, amplification, insertion and the like are easily caused, so that the genetic instability phenomenon of the strain is caused. Therefore, the actinomycete chassis with simplified genome and stable heredity can be obtained by deleting the redundant genome in a large scale through an efficient gene editing technology, and the chassis strain can be used for efficient biosynthesis of various natural products or medicines and has a good application prospect.

Fidaxomicin (fidaxomicin), also known as tiacumicin B, PAR-101, OPT-80, Difimicin, is a novel macrolide antibiotic for oral administration, has an inhibitory effect on many gram-positive pathogenic bacteria, and also has excellent anti-mycobacterium tuberculosis activity and in-vitro anti-cancer activity. Fidaxomicin was approved by the FDA for marketing in 5 months of 2011 and was the first FDA-approved antimicrobial drug for the treatment of c.difficile infection (CDI). Clinical research shows that the in vitro antibacterial activity of fidaxomicin on clostridium difficile is 8-10 times that of vancomycin, and the fidaxomicin has obvious clinical application value. At present, fidaxomicin is mainly prepared by microbial fermentation, and the problems of low fermentation level, unstable inheritance of production strains and the like exist, so that the construction of the fidaxomicin stable production strains by utilizing an actinomycete chassis and the improvement of the yield of the fidaxomicin have very important significance.

Disclosure of Invention

The invention aims to provide an actinomycete Chassis strain, which has the name: the Degan plateau Actinoplanes ypnotic YP-D8 has been preserved in China general microbiological culture Collection center (CGMCC) with the preservation number: CGMCC No.21145, preservation date: 11/9/2020, deposit address: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, North.

The construction method of the actinomycete chassis strain comprises the following construction steps:

(1) performing bioinformatics analysis on an origin Degan plateau actinomyces mobilis (Actinoplanes decenensis) YP-1 by using a known Genome island (Genome Islands) online analysis website Islandview 4(http:// www.pathogenomics.sfu.ca/islandviewer/download /), and predicting redundant Genome regions existing in a Genome; the Degan plateau actinoplanes YP-1 is purchased from China general microbiological culture Collection center (CGMCC for short) and has the preservation number as follows: CGMCC No.4.2098, classification name: actinoplanes decemlinensis (Actinoplanes decenanensis), preservation date: 8, 16 months in 2001;

(2) selecting 8 predicted larger redundant genome regions in the step (1) as subsequent knockout regions;

(3) designing a primer sequence and amplifying a corresponding homologous arm fragment according to the 8 redundant genome regions in the step (2), and integrating the homologous arms into a knockout plasmid pKCpf 1 by using a molecular biological method to obtain 8 knockout plasmids;

(4) sequentially transferring the 8 knockout plasmids constructed in the step (3) into an actinomycetes destemma plateau (Actinoplanes decenanensis) YP-1 serving as a starting bacterium through parental conjugation transduction;

(5) the actinomycete chassis strain Degan plateau actinomycete YP-D8 with 8 redundant genome regions knocked out is obtained through genetic screening.

In the above method, the primer sequences in step (3) are as follows:

SEQ ID NO.1：CCTACGAGATATCGACGCACTAGTTGCTGCTCACCACCTTCACC

SEQ ID NO.2：GTATTGGGGACGGTCGTCGACGGCGAGACTCAACCAGTG

SEQ ID NO.3：GTATCGCCGCACGCTGTCCGGACCATCTGCTTGACCTCTT

SEQ ID NO.4：TGTTGTAGATGCAGCTCGGCGAACGGACCAAGCGTCGGAACGCAAGGTGAAGGT

SEQ ID NO.5：GCTTGGTCCGTTCGCCGAGCTGCATCTACAACAGTAGAAATTTGG

SEQ ID NO.6：CGAACTCCTGGTAGATGGACATATGTGGATCCTACCAACCGGCACGATT

SEQ ID NO.7：CCTACGAGATATCGACGCACTAGTCACGTACAGCAGCCAGAGGT

SEQ ID NO.8：GGAAACCCTCACCCTCGAATCCGAGGTCATCGACGCCAAGGT

SEQ ID NO.9：AACGACGGCGACACCCAGTGCATCGACTGGAGCCAGAACG

SEQ ID NO.10：TGTTGTAGATGGCGACGGGCCGGCGACCGAGGCGCGTCCAGGTCATCGTCATC

SEQ ID NO.11：GCCTCGGTCGCCGGCCCGTCGCCATCTACAACAGTAGAAATTTGG

SEQ ID NO.12：CCTACGAGATATCGACGCACTAGTACGACGACCACGACGAGGAA

SEQ ID NO.13：TCAGTTCTCCTGCCACCACCGCTGATGCGGAACGGGATGAT

SEQ ID NO.14：ATCATCCCGTTCCGCATCAGCGGTGGTGGCAGGAGAACTGA

SEQ ID NO.15：GAGGACCACCTGTTGTCGTACGAGCTGGCCCTGGAATTGGAGA

SEQ ID NO.16：TCGTACGACAACAGGTGGTCCTCATCTACAACAGTAGAAATTATTTCGCTGGTGATGACGTCGGAATCTACAACAGTAGAAATTTGGCCA

SEQ ID NO.17：CCTACGAGATATCGACGCACTAGTCCGCCGCATAAGAAGTTGACAG

SEQ ID NO.18：GTGTTGCTCTCCGCTGCGTACCGCACGAACGAGACGAAGA

SEQ ID NO.19：TCTTCGTCTCGTTCGTGCGGTACGCAGCGGAGAGCAACAC

SEQ ID NO.20：GGAACGCGGCAGACGGAACTTCGGCCGTAGTCGATCACCTGGATG

SEQ ID NO.21：CGAAGTTCCGTCTGCCGCGTTCCATCTACAACAGTAGAAATTCGCCCTGCGGCGATCTCCGCCTCATCTACAACAGTAGAAATTTGGCCA

SEQ ID NO.22：CCTACGAGATATCGACGCACTAGTGGTTCTTGATGACGGCACTGAC

SEQ ID NO.23：GATCTTGGGTCACCAACGGCAGCGCTGTGAGTTTGGACTGGGA

SEQ ID NO.24：TCCCAGTCCAAACTCACAGCGCTGCCGTTGGTGACCCAAGATC

SEQ ID NO.25：GCGGAGCGAAAACCCGTCACTCCGCCTTCTGGTCGGTGCATTACG

SEQ ID NO.26：GGAGTGACGGGTTTTCGCTCCGCATCTACAACAGTAGAAATTGGCGTGGGCGTGTTCCT GGTCGCATCTACAACAGTAGAAATTTGGCCA

SEQ ID NO.27：CCTACGAGATATCGACGCACTAGTTGGAGGGACCAACTCGGGAA

SEQ ID NO.28：CGAAGGACGAACTGGCCATGTCCTCGGCGACCAGAATC

SEQ ID NO.29：GTAGCGGATGCCGGGTGTGTGAGTCATGGTTCCTCCTGC

SEQ ID NO.30：GCCGATCACCCCGGTGCAGGCCGACCGCCTCTACCTCTCCTTCT

SEQ ID NO.31：CGGCCTGCACCGGGGTGATCGGCATCTACAACAGTAGAAATTGCGCCACCCTGCGGGTA GGCGCCATCTACAACAGTAGAAATTTGGCCA

SEQ ID NO.32：CCTACGAGATATCGACGCACTAGTGAGTCGCTGCGTGACAACCT

SEQ ID NO.33：CGTAGTCCTTGGTTCCCGCATCGGACACCTTGGCGTAGATGAT

SEQ ID NO.34：ATCATCTACGCCAAGGTGTCCGATGCGGGAACCAAGGACTACG

SEQ ID NO.35：TGTTGTAGATGGTGGCCGGATAGCCGATGTGGAATCGGAACGGCAGCACTCTC

SEQ ID NO.36：TCCACATCGGCTATCCGGCCACCATCTACAACAGTAGAAATTTGG

SEQ ID NO.37：CCTACGAGATATCGACGCACTAGTTGATAGCCGAGGCTCATGTTGA

SEQ ID NO.38：TCATTGGCATCCGTGGCATCCGCCGGTGACGAAGTACCAGAT

SEQ ID NO.39：ATCTGGTACTTCGTCACCGGCGGATGCCACGGATGCCAATGA

SEQ ID NO.40：GTCAGCCGCAACGTCGACCACCGGTCGGCTGGTCATCCTCAACTG

SEQ ID NO.41：CGGTGGTCGACGTTGCGGCTGACATCTACAACAGTAGAAATTAGGGTCTGCGCGCGGTTCGCGGCATCTACAACAGTAGAAATTTGGCCA。

in the above method, the pKCpf 1 plasmid described in step (3) is disclosed in SCI database documents "Li L, Wei KK, Zheng GS, Liu XC, Chen SX, Jiang WH, Lu YH: CRISPR-Cpf 1-isolated Multiplex Genome Editing and transcription in plasmid expression in isolate Environ Microb 2018,84 (18)".

In the method, the screened actinomycete chassis strain Deshenplateau actinomycete (Actinoplanes dechannensis) YP-D8 has the excellent characteristics of high conversion efficiency, high energy and cofactor content, strong foreign protein expression capacity, high genetic stability and the like, provides a good chassis for the production of microbial medicaments, particularly type I polyketone antibiotics, and has a good application prospect in the fields of pharmaceutical research and industrial production.

The invention also aims to provide application of the actinomycete chassis strain delta-stem plateau Actinoplanes YP-D8 in improving the yield of type I polyketide antibiotics. Especially in improving fidaxomicin production.

The application of the invention is realized by the following scheme: a fidaxomicin biosynthesis gene cluster vector pBAC2015-fad is integrated in the actinomycete chassis strain to obtain a high-yield fidaxomicin gene cluster multi-copy strain YP-M2.

In the above method, the vector pBAC2015-fad contains a fidaxomicin biosynthesis gene cluster sequence that has been uploaded to NCBI database under NCBI accession number "MG 972807".

In the above-mentioned method, the pBAC2015-fad vector contains pBAC2015 plasmid disclosed in SCI database documents Wang H, Li Z, Jia R, et al, RecET direct cloning and Red α β cloning of biochemical genes, large microorganisms or single genes for heterologous expression [ J ]. native protocols,2016,11(7):1175 1191190.

In the method, the high-yield fidaxomicin bacterial strain YP-M2 can reach 65.6mg/L under normal fermentation conditions, is improved by 200-300% compared with the original strain, has stable fermentation yield in the process of passage 10 times, has good application prospect, and can promote the industrial development of fidaxomicin.

The invention has the advantages that: (1) the actinomycete chassis strain Deshenplateau actinomycete (Actinoplanes deacyanensis) YP-D8 constructed by the invention has the excellent characteristics of high conversion efficiency, high energy and cofactor content, strong foreign protein expression capacity, high genetic stability and the like, provides a good chassis for the production of microbial medicaments, particularly type I polyketone antibiotics, and has better application prospect in the fields of pharmaceutical research and industrial production. (2) The invention integrates a fidaxomicin biosynthesis gene cluster (fad) in an actinomycete chassis strain German stem plateau Actinoplanes YP-D8 to obtain a high-yield fidaxomicin gene cluster multi-copy strain YP-M2, and the method is efficient, accurate and convenient to operate, and provides a new research means for constructing high-yield strains of actinomycete drugs. (3) The fidaxomicin yield of the high-yield fidaxomicin gene cluster multi-copy strain YP-M2 can reach 65.6mg/L, is improved by 200-250% compared with that of a starting strain, is relatively stable in fermentation yield in the process of passage 10 times, has a good application prospect, and can promote the industrial development of fidaxomicin.

Drawings

FIG. 1 is a map of 8 knockout redundant genomic regions in the genome of Actinoplanes terrae YP-1.

FIG. 2 is a PCR verification diagram of actinomycete Chassis strain YP-D8 knockout of plateau actinomycete. M: DNA marker; lane 1: taking a German Gaultheria plateau actinoplanes YP-1 genome as a template; lane 2: taking a genome of the actinoplanes Degan YP-D8 as a template; lane 3: negative control, ddH2O as template.

FIG. 3 is a growth curve of Actinoplanes delbrueckii YP-D8 and Actinoplanes delbrueckii YP-1, the starting bacterium.

FIG. 4 is a diagram showing the analysis of the transformation efficiency of different plasmids in the actinoplanes dekawari YP-D8 and the actinoplanes dekawari YP-1.

FIG. 5 shows the intracellular ATP content analysis of the actinoplanes dekawakamii YP-D8 and the actinoplanes dekawakamii YP-1.

FIG. 6 shows intracellular cofactors (NADPH/NADP) in Actinoplanes desorpta nakai YP-D8 and Actinoplanes desorpta nakai YP-1, the starting bacterium⁺) And (4) analyzing the content.

FIG. 7 is the analysis of the capability of heterologous expression of eGFP of actinoplanes dekawari YP-D8 and actinoplanes dekawari YP-1.

FIG. 8 is a diagram showing the analysis of the yield and genetic stability of fidaxomicin in the actinoplanes dekaki YP-M2 and the actinoplanes dekaki YP-1, the starting bacterium.

Detailed Description

The invention is further described below with reference to the figures and examples. The invention will be better understood by the following examples, without limiting the invention thereto.

The experimental methods and technical means in the following examples are all conventional methods unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Media used in the examples:

(1) ISP4 solid medium: soluble starch 1%, MgSO₄.7H₂O 0.1％、K₂HPO₄ 0.1％、NaCl 0.1％、(NH₄)₂SO₄ 0.2％、CaCO₃ 0.2％、FeSO₄.7H₂0.0001 percent of O, 0.0001 percent of MnCl, 2 percent of agar and the balance of water, wherein the percentages are mass percentages and pH7.0.

(2) MS solid culture medium: 2 percent of mannitol, 2 percent of soybean meal, 2 percent of agarose and the balance of water, wherein the percentages are mass percentages, 10mM MgCl₂And the pH is natural.

(3) Seed culture medium: 1.75% of glucose, 1.5% of peptone, 1.0% of NaCl and the balance of water, wherein the percentages are mass percentages and the pH is natural.

(4) Fermentation medium B: 0.3% of yeast extract, 0.5% of peptone, 0.3% of malt extract, 1% of glucose and the balance of water, wherein the percentages are mass percentages and the pH is natural.

Example 1 construction of Actinoplanes underpan Strain, Deshenplateau Actinoplanes (Actinoplanes decenanensis) YP-D8

The specific construction steps are as follows:

(1) performing bioinformatics analysis on an origin Degan plateau actinomyces mobilis (Actinoplanes decenensis) YP-1 by utilizing a known Genome island (Genome Islands) online analysis website Islandview 4(http:// www.pathogenomics.sfu.ca/islandviewer/download /), and predicting redundant Genome group regions existing in a Genome;

(2) selecting 8 larger redundant genomic regions as shown in figure 1;

(3) designing a primer sequence and amplifying corresponding homologous arm fragments according to the 8 redundant genome regions in the step (2), and respectively integrating the homologous arms into a knockout plasmid pKCpf 1 by using a molecular biological method to obtain 8 knockout plasmids.

(4) The 8 knock-out plasmids were introduced into the demethylated starting E.coli E.coil ET12567/pUZ8002 by heat shock, plated on LB solid plates containing kanamycin (50. mu.g/mL), apramycin (50. mu.g/mL) and chloramphenicol (25. mu.g/mL), and placed in an inverted culture at 37 ℃ for 16 h; ET12567/pUZ8002 is disclosed in the paper Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., & Hopwood, D.A. practical streptomyces genetics (Vol.291). Norwich: John Innes Foundation.2000.

(5) Sequentially transferring the 8 knockout plasmids constructed in the step (3) into an actinomycetes destemma plateau (Actinoplanes decenanensis) YP-1 serving as a starting bacterium through parental conjugation transduction; the Degan plateau actinoplanes YP-1 is purchased from China general microbiological culture Collection center (CGMCC for short) and has the preservation number as follows: CGMCC No.4.2098, classification name: actinoplanes decemlinensis (Actinoplanes decenanensis), preservation date: 8/16/2001.

(6) The specific steps of dual-parent conjugation transduction are as follows: e.coil ET12567/pUZ8002 containing the corresponding knockout plasmid on the plate in step (4) was picked, inoculated into 5ml LB liquid medium (chloramphenicol, kanamycin and apramycin), and shaken overnight at 37 ℃ and 220 rpm; 500ul of the above culture medium was transferred to 50mL of fresh LB liquid medium and cultured at 37 ℃ to OD₆₀₀0.4-0.6; centrifuging at 4000rpm at room temperature, collecting the thallus, washing twice with 10ml LB liquid culture medium, and re-suspending with 0.5ml 2 XYT liquid culture medium; culturing Actinoplanes delavayi YP-1(Actinoplanes deaceensis YP-1) in TSB liquid culture for 36h, collecting 500 μ l mycelium, discarding supernatant, and culturing the precipitate with 10ml LB liquidThe medium was washed twice and finally resuspended in 0.5ml of 2 XYT liquid medium; mixing the collected mycelia of Escherichia coli and Actinoplanes, uniformly coating on MS solid culture medium, and culturing at 30 deg.C for 16-18 h; adding 50 mug/ml of apramycin and 25 mug/ml of nalidixic acid into the MS solid culture medium, and standing and culturing for 5-7 days at 30 ℃ until monoclonals grow out.

(7) Transferring the single clone to an ISP4 solid culture medium containing 50 mu g/ml apramycin to culture for 4-5 days, and obtaining an actinomycete chassis strain Degan plateau actinomycete (Actinoplanes decenanensis) YP-D8 with 8 redundant genome regions successfully knocked out through PCR and photocopy screening; FIG. 2 is a PCR verification diagram of knockout of actinomycete Chassis strain Deshenghao actinomycete YP-D8.

(8) The actinomycete chassis strain German Stem plateau Actinoplanes (Actinoplanes deaceanensis) YP-D8 provided by the invention is preserved in China general microbiological culture Collection center (CGMCC for short) in 11 months and 9 months in 2020, and the preservation number is as follows: CGMCC No. 21145.

Example 2 comparison of growth curves of Actinoplanes delbrueckii YP-D8 and Actinoplanes delbrueckii YP-1, the starting bacterium

(1) Placing the deinochronopsis dejerk YP-D8 and deinochronopsis dejerk YP-1 on ISP4 solid culture medium to culture for 10 days.

(2) Inoculating the fungus blocks of about 1cm × 1cm from the ISP4 solid culture medium in the step (1) into a seed culture medium respectively, and culturing at 30 deg.C and 220rpm for 24-48 h.

(3) Transferring the mycelium of the seed culture medium into a fermentation culture medium B to the initial OD₆₀₀0.15, and was cultured at 30 ℃ and 220rpm for 144 hours.

(4) After culturing for 12, 24, 48, 60, 72, 84, 96, 108, 120, 132, and 144 hours, 1ml of each of the fermentation liquids was collected by centrifugation, and the cells were collected by centrifugation again after washing with 1ml of sterile water.

(5) And (3) placing the collected thalli in an oven at 65 ℃ for 3-5 days, weighing, calculating the weight of the thalli (the mass of the centrifuge tube + the mass of the thalli-the mass of an air centrifuge tube) at different time points, and drawing a growth curve.

(6) FIG. 3 is a growth curve of Actinoplanes delbrueckii YP-D8 and Actinoplanes delbrueckii YP-1, and the results show that the growth cycle of YP-D8 is not changed significantly.

Example 3 comparison of the transformation efficiencies of different plasmids in Actinoplanes desorpta parvula YP-D8 and the starting bacterium Actinoplanes desorpta parvula YP-1.

(1) Selecting a carrier commonly used in actinomycetes: the integrated vector pIJ8660, the temperature-sensitive vector pKCpf 1 and the free vector pL97 are introduced into the demethylated starting Escherichia coli E.coil ET12567/pUZ8002 by a heat shock method, coated on an LB solid plate containing kanamycin (50. mu.g/mL), apramycin (50. mu.g/mL) and chloramphenicol (25. mu.g/mL), and placed at 37 ℃ for inverted culture for 16 h; pIJ8660 is disclosed in the paper Sun J, Kelemen G H, Fern a ndez-Absalos J M, et al Green fluorescent protein as a reporter for specific and temporal gene expression A3(2), Microbiology,1999,145(9), 2221-2227; pL97 has been disclosed in the article "Sun N, Wang Z B, Wu H P, et al.construction of over-expression program vectors in microorganisms [ J ]. Annals of microbiology,2012,62(4): 1541-.

(2) E.coil ET12567/pUZ8002 single clones containing the corresponding plasmids on the plates in step 1 were picked, inoculated into 5ml LB liquid medium (chloramphenicol, kanamycin and apramycin) and shaken overnight at 37 ℃ and 220 rpm.

(3) 500ul of the above culture medium was transferred to 50mL of fresh LB liquid medium and cultured at 37 ℃ to OD₆₀₀0.4-0.6; centrifuging at 4000rpm at room temperature, collecting the thallus, washing twice with 10ml LB liquid culture medium, and re-suspending with 0.5ml 2 XYT liquid culture medium; respectively culturing Drynaldia plateau Actinoplanes YP-D8 and Drynaldia plateau Actinoplanes YP-1(Actinoplanes dechannensis YP-1) in TSB liquid culture for 36h, collecting 500 μ l of mycelia, discarding supernatant, washing precipitate twice with 10ml LB liquid culture medium, and finally resuspending with 0.5ml 2 XYT liquid culture medium; the 3 kinds of collected Escherichia coli cells were separately combined with2 kinds of actinoplanes mycelia are mixed and evenly coated on an MS solid culture medium, and cultured for 16-18h at 30 ℃; adding 50 mug/ml of apramycin and 25 mug/ml of nalidixic acid into the MS solid culture medium, and standing and culturing for 5-7 days at 30 ℃ until monoclonals grow out.

(4) The MS plates with the grown monoclonals are respectively subjected to plate counting and conversion efficiency calculation, and the attached figure 4 shows that the conversion efficiency analysis of different plasmids in the Desheng plateau actinoplanes YP-D8 and the starting bacteria Desheng plateau actinoplanes YP-1 shows that the Desheng plateau actinoplanes YP-D8 have higher conversion efficiency for the 3 plasmids and are respectively 3.3 times, 7.9 times and 7.2 times of the starting strains.

Example 4 comparison of intracellular ATP content and intracellular cofactor (NADPH/NADPH) in Actinoplanes desorpta nakai YP-D8 and the Actinoplanes desorpta nakai YP-1 starting bacterium⁺) And (4) content.

(1) Placing Degan plateau actinoplanes YP-D8 and Degan plateau actinoplanes YP-1 on ISP4 solid culture medium, culturing for 10 days, respectively inoculating about 1cm × 1cm of fungus block into seed culture medium, and culturing at 30 deg.C and 220rpm for 24-48 h.

(2) Transferring the mycelium of the seed culture medium into a fermentation culture medium B to the initial OD₆₀₀0.15, and was cultured at 30 ℃ and 220rpm for 144 hours.

(3) After 24, 48, 72, 96, 120 and 144 hours of culture, respectively taking 1ml of fermentation liquor in the step 2, centrifuging, collecting thalli, washing with 1ml of PBS for three times, centrifuging again, collecting thalli, measuring the intracellular ATP content according to the operation steps in an ATP detection kit (product number: QS1702 Shanghai Solarbio) and drawing an analysis chart, wherein the attached figure 5 shows the intracellular ATP content analysis in the Degan plateau actinoplanes YP-D8 and the original bacterium Degan actinoplanes YP-1.

(4) After culturing for 24, 48, 72, 96, 120, 144 hours, 1ml of the fermentation broth obtained in step 2 was collected, centrifuged to collect the cells, washed three times with 1ml of PBS, centrifuged again to collect the cells, and intracellular NADPH/NADP was measured according to the procedure in the coenzyme II NADP (H) content kit (QS 1100 Shanghai Solarbio)⁺Content and drawing analysis chart6 is intracellular cofactor (NADPH/NADP) in the actinoplanes dekawakamii YP-D8 and the actinoplanes dekawakamii YP-1⁺) And (4) analyzing the content.

(5) Based on the results of the analysis, it was found that ATP content and NADPH/NADP in YP-D8 cells were present throughout the fermentation⁺The ratio is obviously higher than that of the prokaryote YP-1.

Example 5 comparison of the ability of Actinoplanes terrae Germanica YP-D8 to heterologously express eGFP with the starting bacterium Actinoplanes terrae Germanica YP-1.

(1) The eGFP expression plasmid pIJ 8668-ermEp-eGFP is respectively introduced into the actinoplanes deleteria YP-D8 and the actinoplanes deleteria YP-1 through the parental conjugation transduction to obtain strains YP-D8-G and YP-1-G.

(2) The YP-D8-G and YP-1-G strains were inoculated into seed culture media, respectively, and cultured at 30 ℃ and 220rpm for 24-48 hours.

(3) Transferring the mycelium of the seed culture medium into a fermentation culture medium B to the initial OD₆₀₀Is 0.15.

(4) Culturing at 30 deg.C and 220rpm for 48 hr, placing equal amount of mycelium under fluorescence microscope to observe eGFP expression level, and analyzing the ability of Actinoplanes delbrueckii YP-D8 and Actinoplanes delbrueckii YP-1 to heterologously express eGFP in FIG. 7.

(5) According to the analysis result, the actinoplanes dekawari YP-D8 has stronger foreign protein expression capacity compared with the original strain.

Example 6 application of Actinoplanes terrae striolata YP-D8 as actinomycete Chassis strain in increasing yield of fidaxomicin

(1) A gene cluster multi-copy strain YP-M2 is obtained by transferring a fidaxomicin biosynthesis gene cluster (fad) vector pBAC2015-fad into actinoplanes dekaki YP-D8 through parental conjugation transduction.

(2) The gene cluster multi-copy strain YP-M2 and the Degan plateau actinoplanes YP-1 are placed on an ISP4 solid culture medium to be cultured for 7-10 days to form a generation, and are respectively subcultured for 10 times, and sequentially fermented to detect the yield of fidaxomicin.

(3) Fidaxomicin yield analysis: respectively taking 1mL fermentation liquor to be detected, adding 9mL methanol, fully oscillating, centrifuging for 10min at room temperature and 12000rpm, removing settled mycelium and solid, filtering supernatant with 0.22um sterile microporous membrane, collecting filtrate, and analyzing the obtained sample by HPLC detection. HPLC conditions: a chromatographic column: c18 column (agent, Eclipse Plus XDB, 5um, 4.6mm 250 mm); detection wavelength: 254 nm; flow rate: 1.00 mL/min; sample introduction amount: 10 ul; experimental mobile phase: mobile phase a was 10% acetonitrile containing 0.08% trifluoroacetic acid (TFA) and mobile phase B was 90% acetonitrile; HPLC run-off procedure: 0-20min, 30% -100% of phase B; 20-25min, 100% phase B; 25-30min, 100% -30% of phase B.

(4) The fermentation result shows that the yield of fidaxomicin of YP-M2 under the normal fermentation condition can reach 65.6mg/L, which is 200-300% higher than that of the original bacterium of degan plateau actinoplanes YP-1; and YP-M2 has stable fermentation yield in the process of 10 passages, has good application prospect and can promote the industrial development of fidaxomicin. FIG. 8 is a diagram showing the analysis of the yield and genetic stability of fidaxomicin in the actinoplanes dekaki YP-M2 and the actinoplanes dekaki YP-1, the starting bacterium.

Sequence listing

<110> Zhejiang university

<120> actinomycete chassis strain and application thereof

<160> 41

<170> SIPOSequenceListing 1.0

<210> 1

<211> 44

<212> DNA

<213> Artificial sequence (Unknown)

<400> 1

cctacgagat atcgacgcac tagttgctgc tcaccacctt cacc 44

<210> 2

<211> 39

<212> DNA

<213> Artificial sequence (Unknown)

<400> 2

gtattgggga cggtcgtcga cggcgagact caaccagtg 39

<210> 3

<211> 40

<212> DNA

<213> Artificial sequence (Unknown)

<400> 3

gtatcgccgc acgctgtccg gaccatctgc ttgacctctt 40

<210> 4

<211> 54

<212> DNA

<213> Artificial sequence (Unknown)

<400> 4

tgttgtagat gcagctcggc gaacggacca agcgtcggaa cgcaaggtga aggt 54

<210> 5

<211> 45

<212> DNA

<213> Artificial sequence (Unknown)

<400> 5

gcttggtccg ttcgccgagc tgcatctaca acagtagaaa tttgg 45

<210> 6

<211> 49

<212> DNA

<213> Artificial sequence (Unknown)

<400> 6

cgaactcctg gtagatggac atatgtggat cctaccaacc ggcacgatt 49

<210> 7

<211> 44

<212> DNA

<213> Artificial sequence (Unknown)

<400> 7

cctacgagat atcgacgcac tagtcacgta cagcagccag aggt 44

<210> 8

<211> 42

<212> DNA

<213> Artificial sequence (Unknown)

<400> 8

ggaaaccctc accctcgaat ccgaggtcat cgacgccaag gt 42

<210> 9

<211> 40

<212> DNA

<213> Artificial sequence (Unknown)

<400> 9

aacgacggcg acacccagtg catcgactgg agccagaacg 40

<210> 10

<211> 53

<212> DNA

<213> Artificial sequence (Unknown)

<400> 10

tgttgtagat ggcgacgggc cggcgaccga ggcgcgtcca ggtcatcgtc atc 53

<210> 11

<211> 45

<212> DNA

<213> Artificial sequence (Unknown)

<400> 11

gcctcggtcg ccggcccgtc gccatctaca acagtagaaa tttgg 45

<210> 12

<211> 44

<212> DNA

<213> Artificial sequence (Unknown)

<400> 12

cctacgagat atcgacgcac tagtacgacg accacgacga ggaa 44

<210> 13

<211> 41

<212> DNA

<213> Artificial sequence (Unknown)

<400> 13

tcagttctcc tgccaccacc gctgatgcgg aacgggatga t 41

<210> 14

<211> 41

<212> DNA

<213> Artificial sequence (Unknown)

<400> 14

atcatcccgt tccgcatcag cggtggtggc aggagaactg a 41

<210> 15

<211> 43

<212> DNA

<213> Artificial sequence (Unknown)

<400> 15

gaggaccacc tgttgtcgta cgagctggcc ctggaattgg aga 43

<210> 16

<211> 90

<212> DNA

<213> Artificial sequence (Unknown)

<400> 16

tcgtacgaca acaggtggtc ctcatctaca acagtagaaa ttatttcgct ggtgatgacg 60

tcggaatcta caacagtaga aatttggcca 90

<210> 17

<211> 46

<212> DNA

<213> Artificial sequence (Unknown)

<400> 17

cctacgagat atcgacgcac tagtccgccg cataagaagt tgacag 46

<210> 18

<211> 40

<212> DNA

<213> Artificial sequence (Unknown)

<400> 18

gtgttgctct ccgctgcgta ccgcacgaac gagacgaaga 40

<210> 19

<211> 40

<212> DNA

<213> Artificial sequence (Unknown)

<400> 19

tcttcgtctc gttcgtgcgg tacgcagcgg agagcaacac 40

<210> 20

<211> 45

<212> DNA

<213> Artificial sequence (Unknown)

<400> 20

ggaacgcggc agacggaact tcggccgtag tcgatcacct ggatg 45

<210> 21

<211> 90

<212> DNA

<213> Artificial sequence (Unknown)

<400> 21

cgaagttccg tctgccgcgt tccatctaca acagtagaaa ttcgccctgc ggcgatctcc 60

gcctcatcta caacagtaga aatttggcca 90

<210> 22

<211> 46

<212> DNA

<213> Artificial sequence (Unknown)

<400> 22

cctacgagat atcgacgcac tagtggttct tgatgacggc actgac 46

<210> 23

<211> 43

<212> DNA

<213> Artificial sequence (Unknown)

<400> 23

gatcttgggt caccaacggc agcgctgtga gtttggactg gga 43

<210> 24

<211> 43

<212> DNA

<213> Artificial sequence (Unknown)

<400> 24

tcccagtcca aactcacagc gctgccgttg gtgacccaag atc 43

<210> 25

<211> 45

<212> DNA

<213> Artificial sequence (Unknown)

<400> 25

gcggagcgaa aacccgtcac tccgccttct ggtcggtgca ttacg 45

<210> 26

<211> 90

<212> DNA

<213> Artificial sequence (Unknown)

<400> 26

ggagtgacgg gttttcgctc cgcatctaca acagtagaaa ttggcgtggg cgtgttcctg 60

gtcgcatcta caacagtaga aatttggcca 90

<210> 27

<211> 44

<212> DNA

<213> Artificial sequence (Unknown)

<400> 27

cctacgagat atcgacgcac tagttggagg gaccaactcg ggaa 44

<210> 28

<211> 38

<212> DNA

<213> Artificial sequence (Unknown)

<400> 28

cgaaggacga actggccatg tcctcggcga ccagaatc 38

<210> 29

<211> 39

<212> DNA

<213> Artificial sequence (Unknown)

<400> 29

gtagcggatg ccgggtgtgt gagtcatggt tcctcctgc 39

<210> 30

<211> 44

<212> DNA

<213> Artificial sequence (Unknown)

<400> 30

gccgatcacc ccggtgcagg ccgaccgcct ctacctctcc ttct 44

<210> 31

<211> 90

<212> DNA

<213> Artificial sequence (Unknown)

<400> 31

cggcctgcac cggggtgatc ggcatctaca acagtagaaa ttgcgccacc ctgcgggtag 60

gcgccatcta caacagtaga aatttggcca 90

<210> 32

<211> 44

<212> DNA

<213> Artificial sequence (Unknown)

<400> 32

cctacgagat atcgacgcac tagtgagtcg ctgcgtgaca acct 44

<210> 33

<211> 43

<212> DNA

<213> Artificial sequence (Unknown)

<400> 33

cgtagtcctt ggttcccgca tcggacacct tggcgtagat gat 43

<210> 34

<211> 43

<212> DNA

<213> Artificial sequence (Unknown)

<400> 34

atcatctacg ccaaggtgtc cgatgcggga accaaggact acg 43

<210> 35

<211> 53

<212> DNA

<213> Artificial sequence (Unknown)

<400> 35

tgttgtagat ggtggccgga tagccgatgt ggaatcggaa cggcagcact ctc 53

<210> 36

<211> 45

<212> DNA

<213> Artificial sequence (Unknown)

<400> 36

tccacatcgg ctatccggcc accatctaca acagtagaaa tttgg 45

<210> 37

<211> 46

<212> DNA

<213> Artificial sequence (Unknown)

<400> 37

cctacgagat atcgacgcac tagttgatag ccgaggctca tgttga 46

<210> 38

<211> 42

<212> DNA

<213> Artificial sequence (Unknown)

<400> 38

tcattggcat ccgtggcatc cgccggtgac gaagtaccag at 42

<210> 39

<211> 42

<212> DNA

<213> Artificial sequence (Unknown)

<400> 39

atctggtact tcgtcaccgg cggatgccac ggatgccaat ga 42

<210> 40

<211> 45

<212> DNA

<213> Artificial sequence (Unknown)

<400> 40

gtcagccgca acgtcgacca ccggtcggct ggtcatcctc aactg 45

<210> 41

<211> 90

<212> DNA

<213> Artificial sequence (Unknown)

<400> 41

cggtggtcga cgttgcggct gacatctaca acagtagaaa ttagggtctg cgcgcggttc 60

gcggcatcta caacagtaga aatttggcca 90

Claims

1. An actinomycete chassis strain, which is classified and named as: degan plateau Actinoplanes (Actinoplanes decenanensis) YP-D8, depository: china general microbiological culture Collection center, accession number: CGMCC No.21145, preservation date: 11/9/2020, deposit address: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, North.

2. Use of an actinomycete underpan strain according to claim 1 for increasing the production of a type I polyketide antibiotic.

3. Use according to claim 2, for increasing the production of fidaxomicin.

4. The use according to claim 2 or 3, wherein the fidaxomicin biosynthesis gene cluster vector pBAC2015-fad is integrated into the actinomycete chassis strain to obtain the high-yield fidaxomicin gene cluster multi-copy strain of plateau actinomycete YP-M2.

5. Use according to claim 2 or 3, characterized in that the vector pBAC2015-fad contains the sequence of the fidaxomicin biosynthesis gene cluster that has been uploaded to the NCBI database under NCBI accession numbers: MG 972807; plasmid pBAC2015 has been published in the SCI database literature.