CN103409341A - Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain - Google Patents
Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain Download PDFInfo
- Publication number
- CN103409341A CN103409341A CN2013102861227A CN201310286122A CN103409341A CN 103409341 A CN103409341 A CN 103409341A CN 2013102861227 A CN2013102861227 A CN 2013102861227A CN 201310286122 A CN201310286122 A CN 201310286122A CN 103409341 A CN103409341 A CN 103409341A
- Authority
- CN
- China
- Prior art keywords
- gene
- moenomycin
- fort
- class
- streptomycete
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides an application of a relA gene in increase of the moenomycin yield of streptomyces bambergiensis, as well as obtained relA gene blocking engineering bacteria, namely, streptomyces bambergiensis 1203 for producing moenomycin and an application of the streptomyces bambergiensis 1203, wherein the strain is preserved in China General Microbiological Culture Collection Centre, the preservation number is CGMCC No. 7237, and the collection date is January 31, 2013. According to the application and the strain provided by the invention, relA homologous genes on streptomyces bambergiensis chromosomes are blocked by virtue of a molecular biological technique, thus increasing the moenomycin yield, and overcoming the defects of blindness, high screening workload and the like of mutagenesis adopting traditional physical and chemical methods.
Description
(1) technical field
The present invention relates to the application of relA gene in improving class's fort streptomycete (Streptomyces bambergiensis) moenomycin output, and the gene disruption of the relA for the production of the moenomycin engineering bacteria obtained---class fort streptomycete (Streptomyces bambergiensis) 1203 and application thereof.
(2) background technology
Moenomycin (Moenomycin) is a class PGL class microbiotic, and it has four kinds of active principle: A, B1, B2 and C at least, and wherein A is main component.Moenomycin A can be produced by four kinds of streptomycetes: spot fort streptomycete (Streptomyces bambergiensis) ATCC13879, Ghana streptomycete (Streptomyces ghanaensis) ATCC14672, fountain streptomycete (Streptomyces geysiriensis) ATCC15303, dust Dare streptomycete (Streptomyces ederensis) ATCC15304, wherein spot fort streptomycete (Streptomyces bambergiensis) is the main generation bacterium of moenomycin.Moenomycin is the peptidoglycan glycosyltransferase (peptidoglycan glycosyltransferase, PGT) in anti-bacteria cell walls biosynthetic pathway directly, thus the effective growth and breeding of anti-bacteria.Because peptidoglycan is a kind of distinctive moiety in bacteria cell wall, and in eukaryotic cells, do not contain peptidoglycan, so moenomycin is a kind of desirable microbiotic.Moenomycin can suppress the growth of Gram-positive and gram negative bacterium effectively, especially more effective to gram positive bacterium.At present, moenomycin as animal feedstuff additive and growth stimulant by successful commercial applications, commodity are called " bambermycin (flavomycin) " and " yellow phosphorus lipidol (flavophospholipol) ", the infection caused because of intestinal bacteria be used to preventing and treating livestock and poultry.Simultaneously, " superbacteria " of Multiple Classes of Antibiotics appears resisting in recent years repeatedly, as methicillin-resistant staphylococcus aureus (MRSA), anti-vancocin faecalis (VRE), anti-multiple medicines streptococcus pneumoniae (MDRSP) etc.Research finds that moenomycin has good restraining effect to the bacterial strain of many methicillin-resistants and vancomycin, so moenomycin can be developed as the medicine of anti-drug resistance bacterium.
The microbiotic biosynthesis gene generally comprises tens step biochemical reactions, relates to tens genes, comprises structure gene, regulatory gene and resistant gene.A series of enzymes in structural gene coding microbiotic biosynthetic process, these enzymes have participated in antibiotic biosynthesizing.Molecular biology research shows, the biological synthesis gene cluster of moenomycin comprises more than 20 gene, their different enzymes of encoding respectively, participating in the biosynthesizing reaction of moenomycin, is very complicated biosynthetic process (Ostash, a B., A.Saghatelian, and S.Walker, A streamlined metabolic pathway for the biosynthesis of moenomycin A.Chem Biol, 2007.14(3): p.257-67.).And, in its biological synthesis gene cluster, do not find the narrow spectrum regulatory gene of approach.Therefore, directly by Protocols in Molecular Biology, transform output that its biological synthesis gene cluster the improves moenomycin comparatively difficulty that becomes.
The relA gene is a pleiotropic regulatory gene of at first finding in intestinal bacteria, its coding tetra-sodium guanylic acid (p) ppGpp synthetic enzyme.Research subsequently finds that the relA gene is present in the multiple streptomycetes such as streptomyces coelicolor, clavuligerus, and the sequence high conservative, to streptomycete Morphological Differentiation and the antibiotic synthetic regulating effect that all has.Gomez-Escribano etc. study discovery, blocking-up clavuligerus (Streptomyces clavuligerus) relA gene, this bacterium can not form aerial hyphae and can not produce spore, but the output of clavulanic acid (clavulanic acid) and cephamycin C (cephamycin C) significantly increases (Gomez-Escribano J P, Mart í n J F, Hesketh A, et al.Streptomyces clavuligerus relA-null mutants overproduce clavulanic acid and cephamycin C:negative regulation of secondary metabolism by(p) ppGpp.Microbiology, 2008, 154:744-755.).At present, also do not utilize the relA gene to improve the report of a class fort streptomycete (Streptomyces bambergiensis) moenomycin output.
(3) summary of the invention
The object of the invention is to provide the application of relA gene in improving class's fort streptomycete (Streptomyces bambergiensis) moenomycin output, and class's fort streptomycete relA gene disruption engineering bacteria and the application thereof for the production of the moenomycin that obtain.
The technical solution used in the present invention is:
The application of relA gene in improving class's fort streptomycete (Streptomyces bambergiensis) moenomycin output.
Concrete, described being applied as: the class's fort streptomycete wild strain of take is starting strain, in its relA gene, inserts the antibiotics resistance gene that can express in class fort streptomycete, obtains class's fort streptomyces gene breaking engineering bacterium that moenomycin output improves; Described antibiotics resistance gene is one of following: kalamycin resistance gene, thiostrepton resistant gene, neomycin resistance gene, spectinomycin resistant gene or hygromycin gene.
Work of the present invention is carried out in the fort streptomycete CGMCC No.4.1439 of class, according to the design of the relA gene conservative region in the multiple streptomycetes such as streptomyces coelicolor, clavuligerus primer, the fort streptomyces gene group DNA of class of take is template, carry out pcr amplification, find to exist the homologous gene of relA gene on class's fort streptomycete chromosome.
Preferably, described antibiotics resistance gene is kalamycin resistance gene.
The invention still further relates to the relA gene disruption engineering bacteria of a strain for the production of moenomycin---class fort streptomycete (Streptomyces bambergiensis) 1203, this bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, postcode: 100101, deposit number CGMCC No.7237, preservation date on 01 31st, 2013.The present invention utilizes Protocols in Molecular Biology to block the relA homologous gene on class's fort streptomycete chromosome, has obtained stable relA gene disruption engineering bacteria.With wild type strain, compare, the fermentation yield of this project bacterium moenomycin is improved, thereby can reduce production costs, and increases economic efficiency.
Concrete, described being applied as: by described class fort streptomycete 1203 inoculation liquid fermentation mediums, 28～32 ℃, 150～200r/min shaker fermentation 7～10 days, fermented liquid, through separation and purification, obtains described moenomycin; Described liquid fermentation medium is prepared by following composition: Zulkovsky starch 30～60g, yeast powder 3～8g, soybean cake powder 20～50g, (NH
4)
2 SO
41～5g, MgSO
47H
2O0.1～2.0g, K
2HPO
43H
2O0.1～2.0g, CaCO
33～8g, distilled water 1L, pH7.2～7.5.
The invention still further relates to the application of described class fort streptomycete 1203 in preparing moenomycin.
Beneficial effect of the present invention is mainly reflected in: the present invention is by utilizing Protocols in Molecular Biology to block the relA homologous gene on class's fort streptomycete chromosome, improve the output of moenomycin, overcome the shortcomings such as the blindness of traditional physics, chemical process mutagenesis and screening operation amount be large.
(4) accompanying drawing explanation
Fig. 1 is the partial nucleotide sequence of class's fort streptomycete relA gene 5 ' end and 3 ' end; (A) be relA gene 5 ' terminal nucleotide sequence, (B) relA gene 3 ' terminal nucleotide sequence;
Fig. 2 is the structure schematic diagram of relA gene disruption plasmid pKBRK;
Fig. 3 is principle and the PCR checking design of primers schematic diagram of relA Gene Double exchange;
Fig. 4 is the design sketch that after the relA gene disruption, moenomycin A output improves.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1: the structure of class's fort streptomycete relA gene disruption engineering bacteria 1203
(1) clone, the order-checking of class's fort streptomycete relA gene fragment
By bioinformatic analysis streptomyces coelicolor A3(2) and clavuligerus ATCC27064 in the relA gene order, according to two couples of primer P1/P2 of relA gene conservative region design and P3/P4, take the fort streptomycete CGMCC NO.4.1439(=ATCC13879 of class) genomic dna is template, by two gene fragments (hereinafter being called relA gene left arm and right arm) of pcr amplification relA gene 5 ' end and 3 ' end conservative region, size is about respectively 910bp(SEQ ID No.1 respectively) and 705bp(SEQ ID No.2).Above two pairs of primer sequences are as follows:
P1:5 '-GA
GAATTCCTCTTGCCAGACGAGGCC-3 ' (underscore is EcoR I restriction enzyme site)
P2:5 '-AA
GATATCGCGAAGGCGAGGTCCTCC3-' (underscore is EcoR V restriction enzyme site)
P3:5 '-CA
TCTAGATCCGCGCCTGGTTCTCC-3 ' (underscore is Xba I restriction enzyme site)
P4:5 '-TG
AAGCTTCCGCTACGACGGCCTG-3 ' (underscore is Hind III restriction enzyme site)
The PCR reaction conditions is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 1min, 55 ℃ of annealing 1min; 72 ℃ of 1min, 30 circulations; 72 ℃ are extended 10min.
Agarose gel electrophoresis detects, and reclaim respectively two purpose fragments obtaining, then with pMD19-T plasmid vector (purchased from the TA clone test kit of Takara company), be connected and Transformed E .coli DH5 α competent cell, the picking transformant, through plasmid extraction, enzyme, cut and the PCR checking, the gained recombinant plasmid is called after pBRL and pBRR respectively.
The intestinal bacteria that will contain correct plasmid are sent the order-checking of the large genome company of China.Respectively by this two portions nucleotide sequence and S.coelicolor A3(2) discovery of comparing of the corresponding Nucleotide conserved sequence of relA, their sequence similarity is respectively 86.1% and 93.1%, illustrates that the gene order obtained is the partial sequence of relA gene in S.bambergiensis CGMCC NO.4.1439.
(2) structure of relA gene disruption plasmid pKBRK
The plasmid pBRL that will contain the fragment of the about 910bp of relA gene left arm carries out double digestion by EcoR I and EcoR V, reclaim this DNA fragmentation, be connected into the carrier pKC1139 through EcoR I and EcoR V double digestion, be converted into competent cell E.coli DH5 α, containing screening positive clone on the LB resistant panel of apramycin, X-gal and IPTG, the checking of extraction plasmid enzyme restriction, obtain recombinant plasmid pKBRL.
The plasmid pBRR that will contain the fragment of relA gene right arm 705bp carries out double digestion by Xba I and Hind III, reclaim this DNA fragmentation, be connected on the carrier pKBRL of Xba I and Hind III double digestion, be converted into competent cell E.coli DH5 α, the transformant that picking is correct, obtain recombinant plasmid pKBR.
With EcoR V and Xba I double digestion plasmid pKBR, and by the Klenow I, fill end, the CIAP dephosphorylation; Use simultaneously BamH I and Kpn I digested plasmid pUC119-kan, reclaim the kalamycin resistance gene fragment that size is about 1.0kb, by the Klenow I, fill end, with T4DNA Polymerase, make the smoothing of kalamycin resistance gene fragment end again, the T4DNA ligase enzyme is connected to above two DNA fragmentations; To connect product transformed competence colibacillus cell E.coli DH5 α, from transformant, extracting plasmid, enzyme is cut checking, obtains the recombinant plasmid pKBRK(9.09kb for the exchange of relA Gene Double) (Fig. 2).In this plasmid, there is the fragment of 882bp to be replaced by the kalamycin resistance gene fragment in the coding region of relA gene, thereby the relA gene is blocked.
(3) plasmid pKBRK is proceeded in class fort streptomycete CGMCC NO.4.1439 by conjugal transfer
From E.coli DH5 α, extracting plasmid pKBRK, Transformed E .coli ET12567(pUZ8002) competent cell, obtain containing intestinal bacteria E.coli ET12567(pUZ8002, the pKBRK of pUZ8002 and two plasmids of pKBRK).To contain the E.coli ET12567(pUZ8002 of transferable plasmid, pKBRK) as donor, S.bambergiensis CGMCC NO.4.1439 spore, as acceptor, carries out conjugal transfer, and plasmid pKBRK is proceeded in S.bambergiensis CGMCC NO.4.1439.The concrete operation method of conjugal transfer: at first, by E.coli ET12567(pUZ8002, pKBRK) single bacterium colony is in the LB liquid nutrient medium 37 ℃, the 200r/min overnight incubation, and then transferred species is cultivated (OD while reaching logarithmic phase
600=0.4～0.6) collect bacterium liquid, the LB liquid nutrient medium washed twice with fresh, finally be suspended in thalline in 1mL LB liquid nutrient medium.Select YMS culture medium inoculated S.bambergiensis CGMCC NO.4.1439 to prepare spore suspension after 28 ℃ of constant temperature culture 7d, by 2 * YT substratum washed twice, after 50 ℃ of heat shock 10min, 37 ℃ of hatching 3～4h, every the 30min microscopy once, until observe the tooth tube germination.By donor E.coli ET12567(pUZ8002, the pKBRK handled well) 500 μ L mix with acceptor S.bambergiensis CGMCC NO.4.1439 spore 500 μ L, centrifugation, by a small amount of residual solution, suspend, be coated on the AS-1 substratum and (by following composition, prepare: Zulkovsky starch 5g, sodium-chlor 2.5g, sal epsom 10g, yeast extract powder 1g, L-Ala 0.2g, arginine 0.2g, l-asparagine 0.5g, agar 20g, distilled water 1L, pH7.5,115 ℃ of sterilizing 30min) on.After 28 ℃ of cultivation 17h, with 1mL, contain 100 μ g/mL apramycins, 50 μ g/mL kantlex and 500 μ g/mL naphthyridones aqueous acids and cover.28 ℃ continue to cultivate 6～7d after, on flat board, have bacterium colony to grow, each plate all has tens to grow to a hundreds of bacterium colony.The picking transformant is rule on the AS-1 substratum that contains 50 μ g/mL apramycins, 50 μ g/mL kantlex and 50 μ g/mL nalidixic acids, can go down to posterity.
(4) screening class fort streptomycete relA gene disruption engineering bacteria
By S.bambergiensis(pKBRK) transformant is forwarded on the AS-1 substratum that contains kantlex (50 μ g/mL) and apramycin (50 μ g/mL), 28 ℃ cultivate 7d after, prepare spore suspension.After suitable dilution, with each plate 10
4The concentration of individual spore is coated on the AS-1 culture medium flat plate that contains kantlex, in 40 ℃ of high-temperature cultivation.PKC1139 is a kind of intestinal bacteria-streptomycete shuttle vectors of responsive to temperature type, and it can self-replicating in the time of 28 ℃, and can not self-replicating in the time of 40 ℃.Therefore, in the time of 40 ℃, only have relA gene and flanking sequence and class bacterial strain that fort streptomycete CGMCC NO.4.1439 karyomit(e) homologous recombination has occurred and carried out double exchange on pKBRK, could grow containing on the AS-1 substratum of kantlex, but can not contain growth (Fig. 3) on the AS-1 substratum of apramycin.By resistant proof, screen that a strain has kalamycin resistance but, to the bacterial strain of apramycin sensitivity, be CGMCC No.7237 by the fort streptomycete 1203(of its called after class), this bacterial strain is a class fort streptomycete relA gene disruption engineering bacteria.
(5) the PCR checking of class fort streptomycete 1203
The genome DNA of the class of extraction fort streptomycete 1203, carry out the PCR checking.At first primer Pkan and P5 are designed in inner at the kalamycin resistance gene inserted and relA right arm downstream, on the relA of kalamycin resistance gene both sides left arm and relA right arm, design respectively primer P6 and P7(Fig. 3).Above two pairs of primer sequences are as follows:
Pkan（5′-GCGTTGGCTACCCGTGATATTGCTG-3′）；
P5（5′-AAGTCACCCGGTACACGTCGTA-3′）；
P6（5′-TGCGCAAGATGGTCGTCGCCATG-3′）；
P7（5′-ACGATGGCGTCCTTGCCCTGCTC-3′）；
The genome DNA of wild type strain and mutant strain of take is template, first take Pkan and P5 carries out pcr amplification as primer, if the band that mutant strain DNA is template to be produced is in the 920bp left and right, homologous recombination has occurred in explanation, and wild type strain because primer Pkan without binding site, therefore without specific band.Again with primer P6 and P7 amplification, if the band that mutant strain DNA is template to be produced illustrates that in the 1200bp left and right double exchange has occurred mutant strain.
PCR reaction conditions: 94 ℃ of 5min; 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1min, 30 circulations; 72 ℃ are extended 10min.The agarose gel electrophoresis detected result shows, the genome DNA of class fort streptomycete 1203 of take is template, while adopting primer Pkan and P5, can amplify the specific band of 920bp left and right, and the genome DNA of the fort streptomycete CGMCC NO.4.1439 of class is while being template, without specific band.And the genome DNA of class fort streptomycete 1203 of take is template, adopt primer P6 and P7 can amplify the specific band of 1200bp left and right.Therefore, verified that further class fort streptomycete 1203 is relA gene disruption engineering bacteria.
Embodiment 2: moenomycin fermentation test and the HPLC of class fort streptomycete analyze
At first, by the fort streptomycete original starting strain CGMCC NO.4.1439 of class and relA gene disruption engineering 1203(CGMCC No.7237) (pressing following composition prepares: Zulkovsky starch 30g to be seeded to respectively the moenomycin seed culture medium, yeast powder 5g, soybean cake powder 10g, MgSO
47H
2O0.5g, K
2HPO
43H
2O0.5g, distilled water 1L, pH7.2～7.5,115 ℃ sterilizing 30min), 30 ℃ of 200r/min shaking tables are cultivated 48h.Then, get inoculum 5mL and be inoculated into 50mL moenomycin liquid fermentation medium (by following composition preparation: Zulkovsky starch 50g, yeast powder 5g, soybean cake powder 30g, (NH by 10% inoculum size
4)
2SO
43g, MgSO
47H
2O0.5g, K
2HPO
43H
2O0.5g, CaCO
35g, distilled water 1L, pH7.2～7.5,115 ℃ sterilizing 30min) in, 30 ℃, 200r/min shaker fermentation 7 days.Each bacterium is cooked 4 repetitions.
Get same batch of different shaking flasks two strain class fort streptomycete fermentation liquid samples each 4 bottles, respectively get the 2mL fermented liquid, add respectively 8mL50% methanol aqueous solution (extraction liquid), supersound process 30min, the centrifugal 10min of 12000r/min, get supernatant liquor, after the organic membrane filtration of 0.30 μ m, carry out high performance liquid chromatography (HPLC) analysis.Analysis condition: C
18Reversed-phase column (Inertsil ODS-SP, 5 μ m, 4.6 * 250mm); Moving phase is acetonitrile: 0.2% ammonium formiate (pH4.9)=45:55(v/v), flow velocity are 0.5mL/min, and column temperature is 25 ℃, and the detection wavelength is 258nm.HPLC analyzes the integration peak area that obtains moenomycin A, and class fort streptomycete 1203 has improved 26.5% than the output of original starting strain class fort streptomycete CGMCC NO.4.1439 moenomycin A.
Claims (5)
1.relA the application of gene in improving class's fort streptomycete (Streptomyces bambergiensis) moenomycin output.
2. application as claimed in claim 1, it is characterized in that described being applied as: the class's fort streptomycete wild strain of take is starting strain, in its relA gene, insert the antibiotics resistance gene that can express in class fort streptomycete, obtain class's fort streptomyces gene breaking engineering bacterium that moenomycin output improves; Described antibiotics resistance gene is one of following: kalamycin resistance gene, thiostrepton resistant gene, neomycin resistance gene, spectinomycin resistant gene or hygromycin gene.
3. application as claimed in claim 2, is characterized in that described antibiotics resistance gene is kalamycin resistance gene.
4. a strain is for the production of the relA gene disruption engineering bacteria of moenomycin---class fort streptomycete (Streptomyces bambergiensis) 1203, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number CGMCC No.7237, preservation date on 01 31st, 2013.
5. the application of class as claimed in claim 4 fort streptomycete 1203 in preparing moenomycin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013102861227A CN103409341A (en) | 2013-07-08 | 2013-07-08 | Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013102861227A CN103409341A (en) | 2013-07-08 | 2013-07-08 | Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103409341A true CN103409341A (en) | 2013-11-27 |
Family
ID=49602384
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013102861227A Pending CN103409341A (en) | 2013-07-08 | 2013-07-08 | Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103409341A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434406A (en) * | 2016-04-13 | 2017-02-22 | 塔里木大学 | Actinomycete producing borrelidin, and applications thereof |
| CN112410278A (en) * | 2020-11-30 | 2021-02-26 | 上海交通大学 | Method for efficiently synthesizing moenomycin A in streptomyces albus |
| CN114806992A (en) * | 2022-05-23 | 2022-07-29 | 中国计量大学 | RSH overexpression genetic engineering streptomyces diastatochromogenes and method for improving fermentation yield of toyocamycin |
| CN114921357A (en) * | 2022-02-16 | 2022-08-19 | 北方民族大学 | Streptomyces fisheri new strain and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998059043A1 (en) * | 1997-06-20 | 1998-12-30 | Novo Nordisk A/S | NOVEL ppGpp SYNTHETASE AND EXPRESSION SYSTEMS FOR IMPROVED PRODUCTION OF PROTEIN OF INTEREST |
-
2013
- 2013-07-08 CN CN2013102861227A patent/CN103409341A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998059043A1 (en) * | 1997-06-20 | 1998-12-30 | Novo Nordisk A/S | NOVEL ppGpp SYNTHETASE AND EXPRESSION SYSTEMS FOR IMPROVED PRODUCTION OF PROTEIN OF INTEREST |
Non-Patent Citations (3)
| Title |
|---|
| HOSOYA,Y. 等: "Acquisition of certain streptomycin-resistant mutations enhances antibiotic production in bacteria", 《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》, vol. 42, 31 December 1998 (1998-12-31), pages 2041 - 2047, XP002986748 * |
| JUN SHIMA 等: "Induction of actinorhodin production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin resistance in Streptomyces lividans and streptomyces coelicolor A3(2)", 《JOURNAL OF BACTERIOLOGY》, vol. 178, no. 24, 31 December 1996 (1996-12-31), pages 7276 - 7284, XP002225029 * |
| 赵春田 等: "斑堡链霉菌(Streptomyces bambergiensis) relA基因对形态分化和默诺霉素产量的影响", 《纪念中国微生物学会成立六十周年大会暨2012年中国微生物学会学术年会论文集》, 31 December 2012 (2012-12-31), pages 328 - 329 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434406A (en) * | 2016-04-13 | 2017-02-22 | 塔里木大学 | Actinomycete producing borrelidin, and applications thereof |
| CN106434406B (en) * | 2016-04-13 | 2019-10-22 | 塔里木大学 | It is a kind of generate borrelidin actinomyces and its application |
| CN112410278A (en) * | 2020-11-30 | 2021-02-26 | 上海交通大学 | Method for efficiently synthesizing moenomycin A in streptomyces albus |
| CN112410278B (en) * | 2020-11-30 | 2023-01-10 | 上海交通大学 | Method for efficiently synthesizing moenomycin A in streptomyces albus |
| CN114921357A (en) * | 2022-02-16 | 2022-08-19 | 北方民族大学 | Streptomyces fisheri new strain and application thereof |
| CN114921357B (en) * | 2022-02-16 | 2023-10-31 | 北方民族大学 | New strain of Streptomyces fei and application thereof |
| CN114806992A (en) * | 2022-05-23 | 2022-07-29 | 中国计量大学 | RSH overexpression genetic engineering streptomyces diastatochromogenes and method for improving fermentation yield of toyocamycin |
| CN114806992B (en) * | 2022-05-23 | 2023-08-22 | 中国计量大学 | RSH over-expression genetic engineering amylase streptomyces chromogenes and method for improving fermentation yield of toyocamycin |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103468625B (en) | Gene disruption mutant of streptomyces bingchenggensis as well as preparation method and application thereof | |
| CN105624080B (en) | Produce the bacillus licheniformis genetic engineering bacterium and its construction method of polysaccharide flocculant | |
| CN103740734B (en) | Xiamen mycin biological synthesis gene cluster, purposes and bacterial strain | |
| Wang et al. | Improved ε-poly-l-lysine production of Streptomyces sp. FEEL-1 by atmospheric and room temperature plasma mutagenesis and streptomycin resistance screening | |
| CN101402959B (en) | Promotor replacement method for improving volume of production of bacillus subtilis surfactin | |
| CN104762247A (en) | A genetic engineering strain for increasing the yield of ascomycin and a constructing method | |
| CN103409341A (en) | Application of relA gene in increase of moenomycin yield of streptomyces bambergiensis and strain | |
| CN102181470A (en) | Method for improving yield of Streptomyces antibiotics and plasmid thereof | |
| CN109161559A (en) | A kind of building and application of efficient streptomyces gene group simplified system | |
| CN111621454B (en) | Gene engineering high-yield strain streptomyces diastatochromogenes, production method and application of epsilon-polylysine | |
| CN102703495A (en) | Method for improving yield of streptomycete antibiotic and plasmid thereof | |
| CN105255936A (en) | Method for establishing salinispora arenlocola CNS-205 gene genetic manipulation system | |
| CN113801834B (en) | Gene engineering streptomyces diastatochromogenes for high yield of toyocamycin and construction method and application thereof | |
| CN102719388A (en) | Method for improving yield of streptomyces antibiotics and plasmids thereof | |
| CN113897301B (en) | Production method and application of genetically engineered high-yield strain streptomyces diastatochromogenes and epsilon-polylysine | |
| CN111019965A (en) | Engineering bacterium for genetic modification of neomycin biosynthesis gene cluster and application thereof | |
| CN103820362A (en) | Construction of biosynthesis gentamicin X2 engineering bacteria and application thereof | |
| CN103626855A (en) | Protein associated with biosynthesis of wuyiencin and encoding gene and application thereof | |
| CN110343650B (en) | Recombinant streptomyces tuberculatus for producing amphotericin B and application thereof | |
| CN110029081B (en) | Engineering bacterium for over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof | |
| CN103183729A (en) | Protein system associated with biosynthesis of gougerotin, and encoding gene cluster and application thereof | |
| CN103667162A (en) | High-yield G418 engineering strain, and construction method and application thereof | |
| CN112239740B (en) | Streptomyces strain for producing piericidin A1 and inhibiting growth of plant pathogenic xanthomonas | |
| CN112430555B (en) | Actinomycete chassis strain and application thereof | |
| CN102174539A (en) | Piericidin A1 biosynthetic gene cluster |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131127 |