CN107699532B

CN107699532B - 3, 7-dihydroxy tropolone high-yield strain and fermentation culture method thereof

Info

Publication number: CN107699532B
Application number: CN201710719258.0A
Authority: CN
Inventors: 陶美凤; 陈雪斐; 徐敏; 王业民; 邓子新
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2017-08-21
Filing date: 2017-08-21
Publication date: 2020-12-29
Anticipated expiration: 2037-08-21
Also published as: CN107699532A

Abstract

The invention discloses a 3, 7-dihydroxy tropolone high-yield strain and a fermentation culture method thereof; the invention discloses streptomyces coelicolor M1152/pCXF1 and M1154/pCXF1 which are constructed by cloning and heterogeneously expressing biosynthetic gene clusters, and can produce a large amount of 3, 7-dihydroxy tropolone, and the culture yield can reach 606mg/L by utilizing an R3 solid culture medium; compared with the yield (0.02mg/L) of 3, 7-dihydroxy tropolone producing strain Streptomyces tropipolofacens No. K611-97(ATCC 53548) reported in the literature, the yield is improved by about 30,000 times.

Description

3, 7-dihydroxy tropolone high-yield strain and fermentation culture method thereof

Technical Field

The invention belongs to the field of antibiotic application, and particularly relates to a 3, 7-dihydroxy tropolone high-yield strain and a fermentation culture method thereof.

Background

Tropolone is a rare natural product with a 2, 4, 6-tropolone seven-membered aromatic ring structure, is commonly found in plants and fungi, and is rarely reported in bacteria. Stipittic acid synthesized by Penicillium stipitatus and beta-thujaplicin (hinokitiol) synthesized by Thuja plicata and Chamaetyparis taiwanensis are the earliest reported natural products with rare 2, 4, 6-tropolone seven-membered aromatic ring structures in fungi and plants; wherein Stipittic acid was first discovered by Harold Raistrik et al 1942 and its structure was resolved by Michael Dewar et al 1945; the structure of beta-thujaplicin (Hinokitiol) is also analyzed by Erdtman, Tetsuo Nozoe and the like in the same period; thereby disclosing a non-benzene ring seven-membered ring aromatic compound and opening the research hot trend of the natural products. However, tropolone among bacteria was not found and reported for the first time in Pseudomonas ATCC 31099 until the last 80 th century, and was subsequently reported successively in Streptomyces neyagawanensis, Burkholdia plantarii ATCC 43733 and Streptomyces ropolofaciens No. K611-97(ATCC 53548). However, the productivity of the producing strain was not high, and in the isolation method reported earlier, only 6mg of the compound was isolated in 208L of fermentation culture.

The 3, 7-dihydroxy tropolone has excellent broad-spectrum antibacterial activity against gram-positive bacteria, gram-negative bacteria, mycobacteria, fungi and the like, and also has excellent activity against tumors, particularly B16 melanoma, and antiviral activity against HIV, Hepatitis B Virus (HBV), herpes virus (HSV) and the like. The 3, 7-dihydroxy tropolone can chelate metal ions due to the special structure of alpha-hydroxy ketone, so that the 3, 7-dihydroxy tropolone can play a role of a metal ion chelating agent and inhibit the activity of metalloenzyme. In recent years, the research on improving the biological activity of the compound by modifying the structure thereof has been greatly advanced, and the research on the production of tropone and the biosynthesis pathway thereof has been paid much attention. However, due to limitations in yield and uncertainty in its biosynthetic gene cluster, the development and utilization of tropone is greatly hampered.

Disclosure of Invention

The invention aims to provide a 3, 7-dihydroxy tropolone high-yield strain and a fermentation culture method thereof; relates to separation and purification of 3, 7-dihydroxy tropolone, yield identification, gene cluster cloning, heterologous expression and resistance screening. Specifically, a cosmid library of streptomyces ochraceus B222 (S.ochraceus B222) is constructed, a biosynthetic gene cluster of 3, 7-dihydroxytropone is screened, cloned and heterologously expressed by an LEXAS high-throughput heterologous expression screening system, heterologously expressed strains of 3, 7-dihydroxytropone, i.e., streptomyces coelicolor M1152/pCXF1 and streptomyces coelicolor M1154/pCXF1 are obtained, and the yields of the 3, 7-dihydroxytropone of the two strains are detected. The invention provides two high-yield strains of 3, 7-dihydroxy tropolone, provides a separation and purification method thereof, provides an effective means for production and purification of tropolone, and provides a basis for modification of tropolone.

In the invention, the streptomyces coelicolor M1152/pCXF1 has been submitted to the common microorganism center of China Committee for culture Collection of microorganisms at 23.3.2017, the preservation address is No. 3 of West Lu No.1 of Beijing city Kogyo-Yangxi, the microorganism research institute of Chinese academy of sciences, and the culture preservation number is CGMCC No. 13914.

The streptomyces coelicolor M1154/pCXF1 has been submitted to CGMCC (China general microbiological culture Collection center) for preservation management of microbial strains in China on 23.3.2017, the preservation address is No. 3 of Xilu No.1 of Beijing republic of Chaoyang, and the microbial research institute of China academy of sciences, and the strain preservation number is CGMCC No. 13916.

The empty vector control bacterium streptomyces coelicolor M1152/pJTU2554 is submitted to CGMCC (China general microbiological culture Collection center) for preservation management of microbial strains in 2017, 3 and 23, and the preservation address is No. 3 of the West Lu No.1 of the Beijing Korean area, and the microbial research institute of the Chinese academy of sciences, and the strain preservation number is CGMCC No. 13915.

The empty vector contrast streptomyces coelicolor M1154/pJTU2554 is submitted to CGMCC (China general microbiological culture Collection center) for preservation management of microbial strains in China at 23.3.2017, the preservation address is No. 3 of Xilu No.1 of Beijing Korean district, and the microbial research institute of China academy of sciences, and the strain preservation number is CGMCC No. 13917.

The purpose of the invention is realized by the following technical scheme:

in a first aspect, the invention relates to a 3, 7-dihydroxy tropolone high-producing strain, Streptomyces coelicolor M1152/pCXF1CGMCC No. 13914; the strain contains a biosynthetic gene cluster of 3, 7-dihydroxy tropolone with a base sequence shown in SEQ ID NO. 1.

In a second aspect, the invention relates to a 3, 7-dihydroxy tropolone high-producing strain, Streptomyces coelicolor M1154/pCXF1CGMCC No. 13916; the strain contains a biosynthetic gene cluster of 3, 7-dihydroxy tropolone with a base sequence shown in SEQ ID NO. 1.

In a third aspect, the invention relates to the use of the aforementioned strain for the production of 3, 7-dihydroxytropolone.

In a fourth aspect, the present invention relates to a method for the fermentative culture of the aforementioned strain, comprising the following steps:

s1, performing MS culture at 28-30 ℃ for 4-6 days to collect streptomycete spores;

s2, coating the collected spores with an R3 culture medium, and fermenting and accumulating 3, 7-dihydroxy tropolone for 5-6 days at 28-30 ℃.

Preferably, the method further comprises a step of purifying the 3, 7-dihydroxytropolone, as follows:

s3, leaching the R3 fermentation culture in the step S2 by using ethyl acetate (0.5% acetic acid);

s4, separating and purifying the obtained fermentation product extract by using CHP20P macroporous resin, performing gradient elution by using methanol water, wherein the elution gradient is 40% methanol/water, and standing overnight at room temperature to observe a large amount of 3, 7-dihydroxy tropolone crystals to be separated out.

Preferably, the method further comprises the step of performing liquid phase detection after purification; the analytical liquid chromatographic column was Agilent Zorbax SB-C18, the detection instrument was Agilent 1260Infinity system, and the mobile phase was: the phase A is a water phase added with 1 per mill of trifluoroacetic acid, and the phase B is acetonitrile; the elution conditions were: 0min, 5% B; 15min, 40% B; 25-30min, 100% B; 31-38min, 5% B; the mobile phase proportion is calculated according to the volume ratio.

In a fifth aspect, the present invention relates to a method for screening 3, 7-dihydroxytropolone-producing bacteria, the method comprising the steps of: covering 3, 7-dihydroxy tropolone with the final concentration of 18-20 mu g/ml on an MS culture medium, covering streptomycete spores on a flat plate with the surface liquid dried, culturing for 4-6 days at 28-30 ℃, and screening out streptomycete capable of normally growing.

The principle of the invention is as follows: the tropolone compounds are secondary metabolites with rare seven-membered aromatic ring structures, and have very good antibacterial, anticancer and antiviral activities. The chemical synthesis has low yield and complicated steps, and also needs high temperature and high pressure and doping of polluting compounds such as halogen elements. However, the yield of the previously reported biosynthesis of 3, 7-dihydroxytropolone is very low, and the biosynthesis gene cluster is not reported, so that a 3, 7-dihydroxytropolone high-producing strain needs to be searched, Streptomyces is a main source of secondary metabolites, and the early Streptomyces tropipolofacies No. K611-97(ATCC 53548) is also reported. The invention selects streptomycete as a screening strain.

By utilizing the characteristic that the genes synthesized by the secondary metabolites of microorganisms are aggregated into clusters and arranged, the invention constructs a genetic engineering strain capable of heterologously expressing the biosynthetic gene clusters by utilizing an LEXAS gene cluster cloning and heterologously expressing method, and because the last-stage metabolites of different strains in different fermentation culture media are different, the high-yield genetic engineering modified strain of 3, 7-dihydroxy tropolone is constructed by testing different strains and culture media and utilizing the characteristics of clean background and sufficient metabolic precursors of streptomyces coelicolor.

Compared with the prior art, the invention has the following beneficial results:

1) the invention realizes the high-efficiency expression of the 3, 7-dihydroxy tropolone biosynthetic gene cluster in heterologous expression hosts streptomyces coelicolor M1152 and M1154, and improves the yield; through cloning a biosynthesis gene cluster and a heterologous expression mode, the constructed streptomyces coelicolor M1152/pCXF1 and streptomyces coelicolor M1154/pCXF1 improve the solid fermentation yield of 3, 7-dihydroxy tropolone in R3 to 606mg/L, which is more than 30,000 times of the yield of a strain reported in the literature.

1) The invention reports a biosynthetic gene cluster of 3, 7-dihydroxy tropolone, provides conditions for the research of a biosynthetic pathway of the biosynthetic gene cluster, and provides convenience for the synthesis and the modification of structural units of tropolone compounds.

2) According to the invention, by testing different fermentation conditions and fermentation time, the optimal fermentation conditions and fermentation time are determined, so that the mass production of 3, 7-dihydroxy tropolone is facilitated, and the yield is determined.

3) The invention reports an effective method for leaching, separating and purifying 3, 7-dihydroxy tropolone through groping of separation and purification conditions, and provides convenience for the production of the compound.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 is a flow chart (A) for screening a 3, 7-dihydroxytropolone heterologous expression strain by using a high-throughput heterologous expression and activity screening method (LEXAS) of a genome library and a liquid phase detection map (B) of a fermentation product of a 3, 7-dihydroxytropolone heterologous expression genetic engineering strain; wherein, A, a flow chart of high-throughput screening of the 3, 7-dihydroxy tropolone heterologous expression strain: through constructing a cosmid library of Streptomyces ochraceus B222, heterologous expression is carried out by taking Streptomyces coelicolor M1152 or Streptomyces coelicolor M1154 as a host, bacillus subtilis is taken as an indicator, and a conjugative transfer (recombinant strain) Streptomyces coelicolor M1152/pCXF1 and Streptomyces coelicolor M11524/pCXF1 for expressing 3, 7-dihydroxytropolone are screened out, so that the growth of the bacillus subtilis can be obviously inhibited;

FIG. 2 is a schematic diagram showing the determination of a 3, 7-dihydroxytropolone biosynthesis gene cluster; wherein, A, a large fragment deletion schematic diagram of pCXF1 plasmid; b, liquid phase detection map of pCXF1 large fragment knockout plasmid heterologous expression product;

FIG. 3 is a graph showing the yields of heterologous expression strains of 3, 7-dihydroxytropolone-producing bacteria, Streptomyces coelicolor M1152/pCXF1 and Streptomyces coelicolor M1154/pCXF 1;

FIG. 4 shows the culture phenotypes of heterologously expressed 3, 7-dihydroxytropolone producing strains and empty vector control strains thereof, and heterologously expressed 3, 7-dihydroxytropolone producing strains Streptomyces coelicolor M1152/pCXF1 and Streptomyces coelicolor M1154/pCXF 1; the empty vector control bacteria Streptomyces coelicolor M1152/pJTU2554 and Streptomyces coelicolor M1154/pJTU 2554.

Detailed Description

The present invention is described in detail below with reference to the attached drawings and specific examples, which will help practitioners in the art to understand the present invention more deeply. The experimental methods not specifically described in the following examples are all conventional methods, and materials and reagents not specifically described are commercially available.

LB culture medium: culturing Escherichia coli;

10g of tryptone, 5g of yeast extract, 5g of sodium chloride and deionized water to a constant volume of 1,000ml and a pH of 7.0.

2 × YT medium: carrying out joint transfer between escherichia coli and streptomyces;

16g of tryptone, 10g of yeast extract, 5g of sodium chloride and deionized water to a constant volume of 1,000ml and a pH of 7.0.

SFM medium: culturing streptomycete to produce spores;

20g of soybean cake powder, 20g of mannitol and tap water to a constant volume of 1,000ml, wherein the pH value is 7.2-7.4.

Soaking 20g of soybean cake powder in 1,000ml of tap water, sterilizing at 121 ℃ for 20min, filtering, collecting soybean cake powder leaching liquor, and preparing a culture medium.

R3 medium: fermenting streptomycete;

10g of glucose, 5g of yeast extract, 0.1g of casamino acid, 3g of L-proline and MgCl₂·6H₂O 10g，CaCl₂·2H₂O 4g，K₂SO₄ 0.25g，KH₂PO₄0.05g, TES 5.6g, 2ml of trace element solution and deionized water to a constant volume of 1,000ml and a pH value of 7.2.

The trace element solution (/ L) includes:

15g of agar powder is required to be added into a corresponding solid culture medium, and 20g of agar powder is required to be added into an SFM solid culture medium.

The Streptomyces ochraceus S.ochraceus B222 (i.e. Streptomyces ochraceus B222) strain is separated from Shinyleau mountain area and disclosed in the literature of Shinyleau mushroom, Wufuqiao, Yueying jade, Taoisshen, Shinyleau mountain area and Natural conservation area Streptomyces resource investigation [ J ]. amino acids and biological resources, 2002 (02): 1-4.

Heterologous expression hosts Streptomyces coelicolor for heterologous expression of a second gene cluster, Microbiological Biotechnology,2011,4(2): 207: "Streptomyces coelicolor for heterologous expression of Streptomyces coelicolor expression of S.coelicolor gene cluster", publicly available from professor Mervyn J Bibb of John Innes Centre.

The vector pJTU2554 used for constructing the cosmid library is disclosed in the literature "Li L, Xu Z, Xu X, et al, the Mildiomycin Biosynthesis: Initial Steps for sequencing Generation of 5-Hydroxymethythyytidine 5' -monophopnote and 5-Hydroxyethylthyytidine in Streptomyces rimofaciens ZJU5119.ChemBiochem,2008,9(8): 1286-1294", publicly available from professor N.J.Shanghai traffic Dengdong.

The cosmid library host E.coli XL-1Blue MR/pUZ8002 strain is disclosed in the literature "Chen L, Wang Y, Guo H, et al.high-throughput screening for Streptomyces antibiotic biosynthesis activators. applied and environmental microbiology,2012,78(12): 4526-.

Example 1 cultivation of Streptomyces ochraceus B222

The streptomyces ochraceus B222 provided by the invention is also the streptomyces ochraceus with the number of CCTCC AA92032 provided by China Center for Type Culture Collection (CCTCC), strains are picked by using a platyhead toothpick, the strains are streaked on an SFM medium by a three-region streaking method, and the strains are cultured for 4-6 days at 30 ℃ until the strains produce spores. Green-yellow. The basic silky greenish brown or brown, and the spores are light green, and belong to Streptomyces cyaneus of Streptomyces lanoruiensis.

Example 2 construction of Streptomyces ochraceus B222cosmid library

Firstly, fresh spores of streptomyces ochraceus B222 are inoculated into 30ml of TSBY culture medium (added with 0.6% glycine), and the mixture is cultured for 16-24h at 30 ℃ and 220 rpm.

(II) centrifugally collecting the thalli, weighing 0.5g of wet thalli into a 50ml centrifuge tube, adding 5ml of SET buffer (75mM NaCl,25mM EDTA,20mM Tris, pH 7.5), and shaking to disperse. Adding lysozyme with final concentration of 1mg/ml, and warm-bathing at 37 deg.C for 10-30 min. 1/10 volumes of 10% SDS solution were added, and proteinase K was added thereto to a final concentration of 0.5mg/ml, followed by incubation at 55 ℃ for 2 hours. Cooling to room temperature, adding 1/3 volume of 5M NaCl solution, adding one volume of neutral phenol chloroform, and mixing by inversion for 30 min; after centrifugation at 4,000rpm for 30min, the supernatant was aspirated into another new 50ml centrifuge tube, and an equal volume of chloroform was added thereto and mixed by inversion again for 30min to remove residual protein. After centrifugation at 4,000rpm for 30min, the supernatant was aspirated into another new 50ml centrifuge tube, and two volumes of absolute ethanol were added to precipitate genomic DNA. Picking white flocculent genome DNA into 30ml of 75% absolute ethyl alcohol, standing for 10min at room temperature to remove salt ions, and repeating the washing step twice by using 75% absolute ethyl alcohol. After 75% of the absolute ethanol was poured out and the DNA was air-dried at room temperature, 3ml of TE buffer (pH 8.0) was added to dissolve it.

And (III) carrying out partial enzyme digestion on the genomic DNA of the streptomyces ochraceus B222 by using a restriction enzyme Sau3 AI. 2-fold gradient dilution enzyme digestion systems (12 gradients) are arranged, and each gradient enzyme digestion system is 200 mu l/tube. Add 200. mu.l genomic DNA, 40. mu.l 10 XH buffer, 159. mu.l sterile water and 1. mu.l Sau3AI to the first tube and mix well; mu.l of 10 XH buffer and 180. mu.l of genomic DNA were added to tubes 2 to 12. Sucking 200 mul of solution from the first tube solution to the 2 nd tube, mixing uniformly to obtain an enzyme digestion system diluted by 2 times of Sau3AI, sucking 200 mul of solution from the 2 nd tube to the 3 rd tube, mixing uniformly to obtain an enzyme digestion system further diluted by 2 times of Sau3AI, and diluting to the 12 th tube by analogy to obtain an enzyme digestion system with 2 times of serial dilution. After 30min of incubation at 37 ℃,20 min of incubation at 65 ℃ deactivates the restriction enzyme. 10 mul of enzyme digestion sample is taken from each tube to carry out PFGE detection on enzyme digestion effect. The detection conditions of PFGE electrophoresis are as follows: an Initial switch time is 1 s; final switch time is 6 s; the Voltage is 6V/cm; included angle 120 °; run time is 14-16 h; temperature 14 ℃. Selecting a gradient system with the size of enzyme digestion products of about 45-60kb, and carrying out PFGE gel electrophoresis to recover DNA, wherein the PFGE electrophoresis method is the same as the above; cutting off the adhesive tape containing DNA about 45-60kb, preparing a new gel with low melting point agarose gel, embedding the adhesive tape containing DNA into the gel, and performing PFGE electrophoresis separation again to remove the carried small fragment DNA, wherein the detection conditions are as follows: an Initial switch time of 4 s; final switch time is 4 s; the Voltage is 6V/cm; included angle 120 °; run time is 14-16 h; temperature 14 ℃. The genomic DNA was recovered by cutting out the gel band of about 45-60kb and dissolved in 10. mu.l of TE (pH 8.0).

(IV) dephosphorylating the recovered genome DNA, wherein the dephosphorylating system is as follows: mu.l of genomic DNA, 1. mu.l of FastAP buffer, 1. mu.l of FastAP. After being heated for 15min at 37 ℃, the mixture is heated for 5min at 75 ℃ for inactivation. And simultaneously carrying out enzyme digestion treatment on pJTU2554 vector DNA: HpaI was dephosphorylated by digestion with BamHI, and the linearized vector DNA was recovered. Carrying out enzyme linkage on dephosphorylated genomic DNA and a pJTU2554 vector subjected to double enzyme digestion treatment by HpaI and BamHI, wherein the enzyme linkage system is as follows: mu.l dephosphorylated genomic DNA solution, 1. mu.l linearized pJTU2554 vector DNA, 1. mu.l 10 Xfast-link ligand buffer, 1. mu.l 10mM rATP, 1. mu.l Fast-link ligand.

(V) by using MaxPlax^TMLamda Packaging Extracts the enzyme linked products were packaged and transfected into E.coli XL-1Blue MR/pUZ8002 competent cells. LB plates were plated (0.1% adriamycin and 0.1% kanamycin were added) and transfectants were screened to obtain a cosmid library containing 2,000 clones. The clones were picked into 96-well plates for culture and stored at-80 ℃.

EXAMPLE 3 cloning and screening of 3, 7-Dihydroxytripolone biosynthetic Gene Cluster

Cloning and screening of the 3, 7-dihydroxytropolone biosynthetic Gene cluster by means of the high-throughput Heterologous Expression and Activity screening method (LEXAS) of Streptomyces genomic libraries is described in "Chen L, Wang Y, Guo H, et al, high-throughput screening for Streptomyces anti-inflammatory biosynthesis, 2012,78(12): 4526-4528" and "Xu M, Wang Y, Zhao Z, et al, functional Genome Mining for metabolism encoding Gene Expression Gene Expression of A batch-genomic biosynthesis, 5719, 2016 (2016) (82).

Firstly, the cosmid library of Streptomyces ochraceus B222 (preserved in 12 96-well plates) is taken out from a refrigerator at the temperature of-80 ℃, and the culture box is placed at the temperature of 37 ℃ for 2 hours until the thawing is complete.

(II) activating the genomic library: adding 130 mu l of fresh LB culture medium into a 96-well plate, inoculating a cosmid library of streptomyces ochraceus B222 into the 96-well plate by using a replicator, and culturing at 37 ℃ and 220rpm for 4-6 h to OD₆₀₀ 0.4～0.6。

(III) library high-throughput conjugal transfer: and (3) utilizing a duplicator to photocopy the escherichia coli bacterial liquid to an SFM flat plate uniformly coated with a layer of heat-shock-treated Streptomyces lividans (Streptomyces lividans) SBT5 spores, drying surface liquid in a biological safety cabinet, and culturing for 12-16 h at 30 ℃ to obtain the conjugation transfer plate of the library.

And (IV) covering trimethoprim and apramycin on a conjugal transfer plate of the library to the final concentration of 50 mu g/ml respectively, blow-drying surface liquid in a biological safety cabinet, and culturing at 30 ℃ for 4-6 days until conjugal transfer seeds grow out.

And (V) using a duplicator to photocopy the grown conjugal transferron on an SFM plate containing naphthyridone acid (25 mu g/ml) and apramycin (50 mu g/ml) for culture, removing residual escherichia coli donor bacteria and conjugal transferral transfer recipient bacteria Streptomyces lividans SBT5, and culturing for 4-6 days at 30 ℃ until the conjugal transferron produces spores completely.

And (VI) transferring the zygospermosomes to a fermentation medium R3 by using a duplicator, and performing fermentation culture at 30 ℃ for 4-6 days until the production of the elements is complete.

And (seventhly) covering a layer of soft agar (0.5% agar) containing 1% of bacillus subtilis on a plate completely producing the antibiotic, culturing overnight at 37 ℃, and observing the generation of a bacteriostatic zone. The observed inhibition zone is shown in fig. 1A, and the conjugative transfer bacteria fermentation product corresponding to the liberty clone 11A11 can obviously inhibit the growth of the bioassay indicator bacillus subtilis to form the inhibition zone.

Example 4 heterologous expression of 3, 7-Dihydroxytrophenolone in Streptomyces coelicolor M1152

For ease of description, the cosmid plasmids contained in library clone 11A11 are all designated pCXF 1.

(one), from a cosmid library of S.ochraceus B222, clones 11A11 were picked up into 3ml of fresh LB medium (supplemented with 0.1% adriamycin) and incubated overnight at 37 ℃ and 220 rpm.

(II), extracting cosmid plasmid DNA (namely pCXF1 plasmid DNA) in the clone 11A11, electrically transforming Escherichia coli ET12567 competent cells to obtain Escherichia coli ET12567/pCXF1 strains, and simultaneously electrically transforming Escherichia coli ET12567 competent cells by using an empty vector plasmid pJTU2554 to obtain Escherichia coli ET12567/pJTU2554 strains.

And thirdly, by utilizing a method of conjugation transfer of three parents of escherichia coli-streptomycete, taking escherichia coli ET12567/pCXF1 as a donor bacterium and streptomycete coelicolor M1152 as an acceptor bacterium, and transferring the pCXF1 plasmid into streptomycete coelicolor M1152 with the assistance of escherichia coli ET12567/pUB307 to obtain an expression strain streptomycete coelicolor M1152/pCXF1CGMCC No.13914 of 3, 7-dihydroxy tropolone. Meanwhile, Escherichia coli ET12567/pJTU2554 containing an empty vector plasmid without an inserted exogenous fragment is used as a donor bacterium, Streptomyces coelicolor M1152 is used as a recipient bacterium, and the pJTU2554 plasmid is transferred into Streptomyces coelicolor M1152 under the assistance of the Escherichia coli ET12567/pUB307, so that a blank control strain Streptomyces coelicolor M1152/pJTU2554CGMCC No.13915 is obtained.

And (IV) respectively dipping the spliceosomes M1152/pCXF1 and M1152/pJTU2554 by using a flat-head toothpick, carrying out scribing on an SFM culture medium containing 50 mu g of adriamycin by a three-region scribing method to obtain a pure culture of the spliceosomes, and culturing for 4-6 days at 30 ℃ until the strains produce spores. The streptomyces coelicolor joint M1152/pJTU2554 containing the empty vector has normal growth and sporulation, the M1152/pCXF1 joint has difficult sporulation and can only form white air filaments, and the joint generates 3, 7-dihydroxy tropolone to cause the periphery of the thallus to be light red. As shown in fig. 4.

And (V) respectively selecting joint transferors of three streptomyces coelicolor M1152/pCXF1 and M1152/pJTU2554 strains, inoculating the joint transferors to an R3 solid culture medium, and fermenting for 4-6 days at 30 ℃.

And (VI), after the fermentation is finished, collecting the R3 solid fermentation culture, and extracting for 3 times by using equal volume of ethyl acetate (0.5% acetic acid). The ethyl acetate extract was collected, concentrated under vacuum and spin-dried, and the crude sample was dissolved in 1ml of methanol.

(VII), after centrifugation at 12,000rpm for 10min or filtration of the methanol sample with a 0.22 μm filter, High Performance Liquid Chromatography (HPLC) analysis was carried out with a sample volume of 10 μ l. The liquid phase analysis chromatographic column model is as follows: agilent Zorbax SB-C18(5 μm, 4.6X 250 mm).

The mobile phase is as follows: the phase A is water phase (added with 1 ‰ trifluoroacetic acid), and the phase B is acetonitrile. The HPLC analysis conditions were as follows: 0min, 5% B; after 0-15min, the concentration of the phase B is increased from 5% to 40%; 15-25min, the concentration of the phase B is increased from 40% to 100%; 25-30min, maintaining the 100% concentration of the B phase for 5 min: 30-31min, reducing the concentration of phase B from 100% to 5%; 31-38min, and balancing 5% concentration of phase B for 7 min. The flow rate is 0.6ml/min, the room temperature, and the proportion of the mobile phase is calculated according to the volume ratio. As shown in FIG. 1B, the peak-off time was 14min in HPLC detection. The chemical structure of 3, 7-dihydroxy tropolone is shown in FIG. 1B.

Example 5 heterologous expression of 3, 7-Dihydroxytrophenolone in Streptomyces coelicolor M1154

The strain construction method is as described in example 4 (one) - (four), and the expression strain streptomyces coelicolor M1154/pCXF1CGMCC No.13916 of 3, 7-dihydroxy tropolone and the carrier reference zygospore strain streptomyces coelicolor M1154/pJTU2554CGMCC No.13917 are obtained, and the strain growth is shown in figure 4.

The fermentation and detection methods of streptomyces coelicolor M1154/pCXF1 and M1154/pJTU2554 are shown in examples 4 (five) to (seven), the fermentation products are detected by high performance liquid chromatography, as shown in FIG. 1B, 3, 7-dihydroxy tropolone can be effectively expressed heterologously in streptomyces coelicolor M1152 and M1154 strains, and the peak emergence time is 14 min.

Example 6 determination of biosynthetic Gene Cluster of 3, 7-Dihydroxytripolone

The size of pCXF1 is 46,192bp, the pCXF1 carries an exogenous fragment of 39,142bp, and the sequence of the exogenous fragment of 39,142bp is analyzed by gene function to find that the sequence comprises a cluster of genes related to riboflavin synthesis (orf9-orf18) and a cluster of genes related to aromatic compound metabolism (orf26-orf 35). In order to determine the genes related to the biosynthesis of 3, 7-dihydroxy tropolone on pCXF1, the present invention performs large fragment knockout on pCXF1 plasmid. Two sections of large fragment DNA of orf7-orf25 and orf25-orf35 are knocked out respectively by utilizing a PCR-targeting technology to obtain plasmids pCXF2 and pCXF 3. PCR-Targeting techniques can be found in the references "Bertolt Gust, Greg L. Challis, Kay Fowler, Tobias Kieser, and Keith F. Chater; PCR-targeted Streptomyces gene replacement information a protein domain need for biosynthesis of the second tissue oil odor geosmin, PNAS 2003, vol.100, No.4, 1541-.

orf7-orf25 large fragment knockout primer sequences are as follows:

SEQ ID NO.12(Δrib-F,5′-3′)：

GCCACCGCACCGCCGTACGGGCCGGGCCGCGGCCGTCCGatattccggggatccgtcgac

SEQ ID NO.13(Δrib-R,5′-3′)：

GCGGCCGACGATCTGCTGGTGGACGTCGGCTTCCACGCCgtgtaggctggagctgcttc

orf7-orf25 large fragment knockout verification primer sequences are as follows:

SEQ ID NO.14(ver-Δrib-F,5′-3′)：

ATGTCACCGCTGCGCACCGA

SEQ ID NO.15(ver-Δrib-R,5′-3′)：

ACCTCCGGTACGGACCAGGA

1) the erythromycin resistance gene eryB is amplified from pJTU6722 by using delta rib-F/R primers, and the erythromycin resistance gene eryB is inserted into pCXF1 plasmid by using PCR-targeting technology to replace orf7-orf25 large fragment DNA, so that a knockout plasmid pCXF2 of orf7-orf25 is obtained, as shown in FIG. 2A.

2) The expression strain S.coelicolor M1154/pCXF2 with orf7-orf25 large fragment knockout can be obtained by transferring pCXF2 plasmid Escherichia coli-streptomycete intergeneric triparental conjugal transfer into S.coelicolor M1154.

3) The knockout strain S.coelicolor M1154/pCXF2 is inoculated to an R3 fermentation culture medium, and a fermentation product is extracted for liquid phase detection after fermentation culture is carried out for 4-6 days at 30 ℃. The liquid phase detection pattern is shown in fig. 2B, and the elution peak of 3, 7-dihydroxy tropolone at 14min still exists, which indicates that the gene does not participate in the biosynthesis of 3, 7-dihydroxy tropolone, and s.coelicolor M1154/pCXF2 can still synthesize 3, 7-dihydroxy tropolone.

orf25-orf35 large fragment knockout primer sequences are as follows:

SEQ ID NO.16(Δaro-F,5′-3′)：

GCGACGGGTGCGACGGGTGCGGAACATGGGAGCGGCCCTatattccggggatccgtcgac

SEQ ID NO.17(Δaro-R,5′-3′)：

GTGTGGCTCCGCCACGCCGTCCGCTCCGCGCTGACCCGGgtgtaggctggagctgcttc

orf25-orf35 large fragment knockout verification primer sequences are as follows:

SEQ ID NO.18(ver-Δaro-F,5′-3′)：

TCACGAACAGCTTCACCCACT

SEQ ID NO.19(ver-Δaro-R,5′-3′)：

GGCATCGAACTGTTCGACCTT

a delta aro-F/R primer is used for amplifying an erythromycin resistance gene eryB from pJTU6722, the eryB gene is inserted into pCXF1 to replace orf25-orf35 large fragment DNA by using a PCR-targeting technology, and knockout plasmid pCXF3 of orf25-orf35 is obtained, as shown in FIG. 2A.

The expression strain S.coelicolor M1154/pCXF3 with orf25-orf35 large fragment knockout can be obtained by transferring pCXF3 plasmid Escherichia coli-streptomycete intergeneric triparental conjugal transfer into S.coelicolor M1154.

The knockout strain S.coelicolor M1154/pCXF3 is inoculated to an R3 fermentation culture medium, and a fermentation product is extracted for liquid phase detection after fermentation culture is carried out for 4-6 days at 30 ℃. The liquid phase detection spectrum is shown in FIG. 2B, the elution peak of 3, 7-dihydroxy tropolone at 14min disappears, which indicates that the gene participates in the biosynthesis of 3, 7-dihydroxy tropolone.

Thus, the biosynthetic gene cluster for 3, 7-dihydroxytropolone should contain 10 genes within the orf26-orf35 region, for a total of 9112 bp. The protein coded by each gene and the functional analysis thereof are shown in Table 1, and the arrangement of the gene organization is shown in FIG. 2. The nucleotide sequence is shown in SEQ ID NO.1, and the protein sequence is shown in SEQ ID NO. 2-11.

TABLE 1, 3, 7-Dihydroxytrophenolone biosynthetic Gene Cluster protein functional Annotation

Gene	Location of gene	Protein sequences	Protein function
				trlA	1-480	SEQ ID NO.2	acyl-CoA hydratase
trlB	530-1984	SEQ ID NO.3	3-deoxy-D-arabinoheptulonic acid-7-phosphate synthase
				trlC	2248-3840	SEQ ID NO.4	Monooxygenases
trlD	3837-4394	SEQ ID NO.5	Flavin reductase
				trlE	4439-5641	SEQ ID NO.6	Monooxygenases
trlF	5697-6308	SEQ ID NO.7	Oxidase enzyme
				trlG	6327-6539	SEQ ID NO.8	Unknown function
trlH	6536-7297	SEQ ID NO.9	Thioesterases
				trlI	7299-8507	SEQ ID NO.10	Prephenate dehydratase-chorismate mutase
trlJ	8483-9112	SEQ ID NO.11	TetR transcriptional regulatory protein

Example 7 isolation and purification of 3, 7-Dihydroxytriphenol

Firstly, inoculating a conjugative transfer of a streptomyces coelicolor M1152/pCXF1 strain to an R3 solid culture medium, fermenting for 2L, and fermenting for 4-6 days at 30 ℃.

And (II) after the fermentation is finished, collecting the R3 solid fermentation culture, and extracting for 3 times by using equal volume of ethyl acetate (0.5% acetic acid). Collecting ethyl acetate extract, vacuum concentrating, spin drying, and dissolving with appropriate amount of water.

(III) dissolving the crude extract in 500ml of pure water, filtering to remove insoluble substances, loading the aqueous solution of the crude extract to a CHP20P column (phi 5X 50cm) by a wet method, performing gradient elution with methanol (0%, 20%, 40%, 60%, 80%, 100% methanol/water) and performing tracking detection by a liquid phase. Gradient elution of 3, 7-dihydroxy tropolone in 40% methanol, standing for crystallization in clean and stable place.

Example 8 determination of the yield of 3, 7-Dihydroxytriphenol

Streptomyces coelicolor M1152/pCXF1 and Streptomyces coelicolor M1154/pCXF1 strains were inoculated onto R3 solid medium (using 9cm diameter plates, 35ml of solid medium for each plate, 12 plates of solid medium for each strain were co-fermented), and fermented at 30 ℃.

And (II) extracting three solid fermentation cultures of streptomyces coelicolor M1152/pCXF1 and streptomyces coelicolor M1154/pCXF1 for 3 times by using equal volume of ethyl acetate (0.5% acetic acid) on the fourth day, the fifth day, the sixth day and the seventh day of fermentation respectively. The ethyl acetate extract was collected, concentrated under vacuum and spin-dried, and dissolved in 1.5ml of methanol.

(III) preparing a standard curve: using the purified 3, 7-dihydroxytropolone isolated as described above as a standard, 3, 7-dihydroxytropolone of 100. mu. mol/ml, 200. mu. mol/ml, 400. mu. mol/ml, 600. mu. mol/ml and 1000. mu. mol/ml was prepared and subjected to HPLC analysis, and the amount of the sample was 10. mu.l. The liquid phase analysis chromatographic column model is as follows: AgilentZorbax SB-C18(5 μm, 4.6X 250 mm).

The mobile phase is as follows: the phase A is water phase (added with 1 ‰ trifluoroacetic acid), and the phase B is acetonitrile.

The HPLC analysis conditions were as follows: 0min, 5% B; after 0-15min, the concentration of the phase B is increased from 5% to 40%; 15-25min, the concentration of the phase B is increased from 40% to 100%; 25-30min, maintaining the 100% concentration of the B phase for 5 min: 30-31min, reducing the concentration of phase B from 100% to 5%; 31-38min, and balancing 5% concentration of phase B for 7 min. The flow rate is 0.6ml/min, the room temperature, and the proportion of the mobile phase is calculated according to the volume ratio. 3, 7-dihydroxy tropolone eluted at 14min as shown in FIG. 1B.

HPLC peak areas were measured to prepare a calibration curve.

(IV) fermenting samples treated at the fourth day, the fifth day, the sixth day and the seventh day by streptomyces coelicolor M1152/pCXF1 and streptomyces coelicolor M1154/pCXF1, detecting by using the high performance liquid chromatography analysis method, recording the peak area of 3, 7-dihydroxy tropolone, and calculating the yield of the four bacteria 3, 7-dihydroxy tropolone according to a standard curve; the yield chart is shown in FIG. 3, wherein the yield of Streptomyces coelicolor M1154/pCXF1 reaches the maximum of 498mg/L on the fifth day, the yield of Streptomyces coelicolor M1152/pCXF1 reaches 605.7mg/L, and the yield is the maximum on the fifth day.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention.

SEQUENCE LISTING

<110> Shanghai university of transportation

<120> 3, 7-dihydroxy tropolone high-producing strain and fermentation culture method thereof

<130> DAG29670

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 9112

<212> DNA

<213> Streptomyces ochraceiscleroticus Soc7

<400> 1

tcagcggcgt acggccactt cctcgcgctg ggcgccgccg gcctccgcgc ggccgaacag 60

cagccgcgta cgcatccggt acaacgcctc gccccgctgg ttgtccgcct cgacgacgaa 120

ccggaccgtg cccgtgtccg ggcgccgggg atggggtgcg gcctcctcca cggtggcccg 180

tccgcgcacg tcgtcgccgg ggcgcaccgg gcgcaggaac cggacctcgt ccatgccgta 240

ggagccctgg caggcggagc cggcgagcag ggcgcggacg aactgcccca tgaccaccgc 300

gccggtgtgc cagccgctgg ccaccaggcc gccgaagggg gagcgggccg ccgcctcggg 360

atccaggtgg aagggcatcg ggtcccacac ccgcgcgtag ccgatgatgt cctcgctcgt 420

gagccgggtg gtccccagct cgtaggtgct gccgacgcgg aagtgctcga agtgccgcac 480

gggggtgctc cttcgtctcg ggggtctcgc gggggccggg gcccggcact cagccggggg 540

acgccgcgtg ggccgcgtac accggcgcgc ccaccgggcg gatcagggcg ggctccgggc 600

gggggcggcc caggcggcgc ctctcggcgc tgaaccactc ggcgacccgg aaggccaggt 660

ccatcgactg cccgcggttc aggcgggggt cgcacgccgt ctcgtaccgc agaggcagat 720

cgtcggagag gacctcgtcg ctcccgccca cgcactcggt gacgtcctcc ccggtgagct 780

ccacgtgcac cccgccgggg tgcgtgccca gcgcccggtg gacctcgaag aagcccgtga 840

tctcgtccag gacgtcctcg aagcgccggc tcttgtggcc gctcggcgcg gtgaaggtgt 900

tgccgtgcat cgggtcgcac gcccacacca cccgggcgcc ctccgcgcgc accgcctcca 960

ccagggcggg cagccggtcg cgtaccaggc cccgccccat ccgcgcgatc aacgtgagcc 1020

ggcccggggt gcgcagcgga tccagccggt ccaccagggc ccgtacgtcg tcgacggcgg 1080

cgtcgggacc cagcttgacg ccgagcgggt tgctgacccc ggcggcgaac gcgacgtgcg 1140

cgccgtccag ccggcgggtg cgctcgccga tccagagcag gtgcccgctc agggcgtacc 1200

gccggcccgt gtcggggtcc gttcgcacca gggcggactc gtagtcgagg agcagcgcct 1260

cgtggctggc gaacacctcc gtggtgcgca gcgccgaggt gctcataccg caggcccgga 1320

tgaacgacag cgccgcgtcg atctcgtccg ccagccgctc gtagcggtgt cccgccgcgg 1380

acagcgccac gaagtcacgg ttccactcgt gcacccggcg cagatccgcg tgcccgccgg 1440

cggtgagggc gcgcagcagg ttgagcgtcg ctgcggacgc ctggtagaca cgctccagcc 1500

gggccgggtc aggggtgcgg gcctcggcgg tgaactccag cccgttgacg gcatcgcccc 1560

ggtacgaggg cagcgtcacg ccgccccggg tctcggtggg ctgtgagcgg ggcttggcgt 1620

actggccggc gatacggccg accttgacca ccgggacgcc ggccgcgtac gtcagcacgg 1680

cggccatctg gaggaggacc tccagcttgt tgcggaccga ctccgcgccc accccgtcca 1740

gggtctccgc gcagtcgccg ccctggagca ggaagccccg ccccagggct acttcgccga 1800

gccggtcgag cagggtgtcg cactcctggc cgaacaccag cggcggtgcg gcggacaggg 1860

ccgacaaagt ggtccgcagc gccgtgggat cgggccagtc gggctgctgc gccacgggca 1920

gcgcccgcca cgcttcgaca gagggatcgg caagtgagtt ctcgtccatc tccagggatt 1980

ccacgctgaa aacctcaacg ccttctgttc cgagggcagg gcacggggtt gcggtgcgcg 2040

cagcctgtca cgcgccggcc gggccccggc agtgggacgt tgtggctaga agggcggatc 2100

tactacccgg gtactagcgc cagcggccga ctgtcggggc cggccgcact cctggaccat 2160

ttcggcaggc gccctcgtcg tcggcacccg acggcgggcg cggttcgccg catgtctcca 2220

cgccaccggc tcgaaaggtg atcccgcatg agcagcaccg tcaacccgtc cgggtccgtg 2280

tcccgcccgc agaccgggga cgagtacctg gagagcctcc gggacggccg ggaagtcagg 2340

atctacggcg agaaggtgca ggacgtcacg gctcacccgg ccttccgcaa caactcccgc 2400

atggtggccc ggctcttcga cgcgctccac gaccccgagc gcaacagcaa gctggtcgtc 2460

cccaccgaca ccggcaacgg cggtttcacc cacccgtact tcaaggcccc gtacacctcc 2520

ggcgacctgc ggaccgccgc gcgggccatg gaggagtggg cgcgcatgac gtacggctgg 2580

ctgggccgca cccccgactt caaggccgcc ttcctgtcca ccctgggctc gaacaaggag 2640

cactacgcgc cgttcgagga caacgcgtcc gcgtggtacc gcaaggcaca ggagaacgtg 2700

ctcttcatcg gccacggcat cgtcaacccg ccgatcgacc gcaaccgggg gctgaccgag 2760

ctcaaggacg tgatgctgac ggtggaccgg gagaccgacg ccggcctcgt ggtctccggc 2820

gccaaggtcg tcggcaccgg ggccgcgctc acccagcaca tcttcatcgg cagctacggg 2880

gtcataccga agggcgcgaa ggagttctcc gcgtacttca tcgtgccgac cgacagcccc 2940

ggcctgaaga tcatctcccg gccgtcgtac gagttcgcct cggccaccgt cagcagcccc 3000

ttcgaccagc cgctcagcag ccgcctggac gagaacgacg gcattctcgt cttcgaccag 3060

gtgctgatcc cctgggagaa cgtcttctgc tacgacgtgg acaaggcgaa cgacttcttc 3120

tacgggtcag gcttcttcta ccgggccatg ttccacgcct gcgtccgctt cgccgtgaag 3180

atggacttcc tgaccggcct gctcgccaag tgcctggaga ccacgggcac ctcggagttc 3240

cgcggggtgc agagccggct cggcgaggtc ctcgcctacc gcaacatgtt ctgggccctg 3300

gtcgactcca tggccgagaa ccccaccaag tggcccgacg gcaccgtcac ccccaacggc 3360

gagaccgcgc tggccttccg cgtcctgtcc tcgtcgatct tccccaaggt gcgtgagatc 3420

ttcctgcggg atctcggcag cgcgctgatc tacaacaact cccacgccct cgactggtcc 3480

aaccccgagg tccggcccta cctggacaag tacgtccgcg gcctgggcgt ggaggccatc 3540

gaccgggtga agctgatgaa gctggcatgg gacgcggtcg gcaccgagtt cggggcccgc 3600

tgggagctgt acgagatgaa ctacgcgggc aaccacgagc agatccggtt cgaggcgctg 3660

cacgcccagc aggtctccgg gaagttcgac gactacaagc agctcgtcga ccggtgcctg 3720

tcggagtacg acgagcacgg ctggaaggtc cccgacctcg tcgaccccaa ggacaccacc 3780

gtcatcggcg ccggcgcacc ggacaccggc acgaccgccc cccgcccggc cgcacggtga 3840

gcagccacac ccccgccccg ggcggaccca ccgccccgcc cggagccccc gtcctgccgg 3900

accaggccca actcaggcac gtactcggcc agttcgtgac cggggtgtgc gcggtgtcga 3960

cccgcttcga cacccgctcc ggcgtacgcc acgacgccat cgcggtgaac tcgttcacct 4020

cggtctccct cgacccgccg ctcgtgtcga tgtacctgcg cgacgactcc accttcctgc 4080

ggcgggtccg cacgtccggc cagtgggccg tgtcgttcct cggcaaccgg gcgcgctccc 4140

tggtcggcgt cctcaccgcg cccgcggccc ggcgccctcc ggtggagcag gccgccgact 4200

gggccgtcgg cccgcacacc ggctgtctgg tcctgccgga cggccccgga acgctcgaat 4260

gcgctctgca cctcacgcag gcactcggcg accatgtcct cgtggtcgga cgggtgctgg 4320

gcgcggtggg ccgcgaccac gaacccctgg tcttccaccg cggcgccttc accgaagtcg 4380

caccggcgcc gtgaccacgc tccaccggcc ttcggcagcg aacaggaaag gagaccccat 4440

ggcgaggaaa cgcccgtacg tggcggtggt gggcggcggc atcggcggcc tggccgtcgc 4500

gctgggactg cgcaggcagg gcgtcgaggc ggtcgtccac gagcaggcgc acgcactgtc 4560

ccaccagggg gcggggatcg cgatcggcgc gaacggacac cgggccctgc gggaactggg 4620

cgtcgccaag cggctgaccg cctctgccgc ccggccgtcg cgcgccgact tccggcactg 4680

gcgcaccggc cggtccatgg tgtcgcaccg cctgaccggc ctgtacgagg aacgcttcgg 4740

cgcccccttc tggaccgtgg aacgcgcggc cgtccagcag gctctgctcg ccgaactggg 4800

cccgcgccac gtgcgcctgg gcgcgcgctg caccggggtg gacaggacgg ccgacggcgc 4860

cgtgatccgc ttcgaggacg gcggcgaggc ggaggccgac gcggtcgtcg gggcggacgg 4920

tatccactcc gcggtgcgcc acagcctctt cggcccgcag gaggccgtgt tctccggcac 4980

cagcggatac cgcgccctgg tcccgatgga ccggctgcgg cacgttcccg aactcgccga 5040

accggtgctg tggctgtggc tcggaccggg ccggcacttc atcgcctacc cggtggccga 5100

cggcagcgcg ctgaacttcc tggccgtcgt gcccgaccgc acgtggacgg tggagtcctg 5160

gtccacggag ggcgacgctg ccgagctgcg ggccgccttc gacggctggc acccgttcgt 5220

cacggaggtc ctcggcgcct gcgaacgtcc gggccgctgg gcgctgtacg accgggagcc 5280

gcagcgcgtg tggagttccg gcgcggtgac gctgctggga gatgccgcgc acgcgatgct 5340

gccgcaccac ggacagggcg ccaaccaggc cctggaggac gcggtggtcc tcgcccactt 5400

cctggcacgg acggacaccg gcggtgtgcc gtcggccctg cgcgcctacg agcgtctgcg 5460

tcggccgcgc acccggctgc tccaggcggg ctcccgtaag aacgccggct gcttccagct 5520

ccccgacggg ccgcaggccg aagcccgcaa cgcaaggctg gccaccctgc ccgacgacgt 5580

cgcctggatc cacgggcacg acatcctcgg ctccctgcct gtggccacgt caccggcctg 5640

aaccgcgggc gggggccgcc gaccgcgacg accatcgacg aacggtgagg aacaccatgg 5700

caaggaccta ctccttcgaa ggcaacgtac ccgtcgtgca tcccacggcg ttcgtgcacc 5760

ccgacgccgt gctgatcggg tcggtcgaca tcggtccggg gtgctatgtc ggccccctcg 5820

cgagcctgcg gggcgacttc gggcacatcg aactccgggc gggctccaac gtccaggacg 5880

gctgcgtcct gcactgcttc ccgggggccg acacggtcgt ggaggaggac ggacacgtcg 5940

gccacggcag cgtgctgcac ggctgccggg tgggccggga cagcctcatc ggcatgaagt 6000

ccgtcctcat ggacggtgtc gtggtgggaa cgcgggcgtt cgtcggggcc ggcagcttcg 6060

tcaagtcccg cttccaggta ccggagcggc atctggtggc gggcagcccg gccaaggtgg 6120

tgcgtgaact caccgccgac gagatcgcct ggaagggcaa cgggaccgcc cagtaccaga 6180

agctggccca gcgctgtctc accggtctgc acgcggcgga ggccgccacc gagcgcaccg 6240

ccccggcggc ccccgccgaa cccggcgagc acgaacacgt caccctccac gcctaccggt 6300

cccgctgacg aagcacccga ggcaccttgt cgcggccgat ccgcgcaccg gacaagaccg 6360

tcaggacggg ccccgcgacg gcgccgggct cgcgcgaacg ccaggcccat tcaccggacg 6420

tcacgttcag ggacgtcacg ttcacggacg tcatgttcaa ggacttcacg ctcaaggacc 6480

ttccgcggct ccccagggcc gcgacccttc cccaccccct ccaggaggca tgttcatgaa 6540

cagctcagcc acctcccgac tcgtcgtcgg cgaccggttc cgcgacttcg ccgaggccgt 6600

cggcgccgag acgttctcgc ggctcgcccg ctcgctcgac gcgggcgacc tggacgcggt 6660

cgagggaccg ctgcgcgtgg tcaccggcca gggcgtcggc gagttcgaga tctcctacct 6720

cgaggacgcc gtccgccggc ggcagctgga cgaccggatc gagctggtcc actcggccgg 6780

gcagcccgcc cgtcgccagg aactgcacaa ggcccgcgag gacaacgtgc tgatcgccgg 6840

gctcacacag gtcgacgaca ccgcctacga ggccgccctg aggctgcacg accacaacga 6900

actgctcgtc gacgtccagg accgggtgca cgtgcagggc atggtggccg tcgaggcggc 6960

ccgtcagatg ttcgtcgcgg tggtggagcg ctacttcacg gcccgctggc cgcagcagcg 7020

ctactacatc gtcctcaact ccatcaacac cacgttctcc aacttcctct tccccgtggg 7080

tgccacggtg cggctgacgg tggacgagtc ggaggtgtcg gagcccagcc ggctcacgtt 7140

ccgtacgacg gtggaggtgg agcaggccgg acggcccgcc gctgccgtca ccatcgacgc 7200

ggccgccttc gcccccgggc tgctggagga gaaggagctg cgccgggcca agagcgcggt 7260

ggcgagcacg atggacgccg cactggccat cgcgtgacat gaggacgccg acaccggaca 7320

cccggacgcg ccccgcaccg ggacgactcc cgtacccgga gtggcggttc gcctacctgg 7380

gcccggaagg aaccttcacc gagctggccc tgcggtccct cccggaggcc acgggcgccc 7440

ggctgtcacc ggctgccacg gccaccgagg ccctgacgct ggtgtgccgg ggcgccgcgg 7500

acgccgccat gctgcccgtc cacaacacgg tggccggggt ggtcgcggac acggtgcgcg 7560

cgctcgccga gtcacccgcg ctgaccgtcc tcagggaagt cgtgctcccc gtggaattcg 7620

cccttctggt gcgccccggc acacgacgcg cgcggatccg cacggtgagc ggccatccgc 7680

acgcgggagc gcaggtcggc ggatggctcg acagccgggc gccgcaggcg cgttggacac 7740

cggcgccgtc caacgccgag gccgcgcgca gggtacggga ccgggagtgc gacgccgcgg 7800

tcgccgggga gttcaccgcc gcgcactacg gccttcaggt cctggacgcc gggatacagg 7860

acaccgccgg tgcggtcacc cggttcctgc tgtgcgcgcg tcccggcagg tggagcggcc 7920

cgcgtcccgc cgccgaccgc acctcgctgg tcgggcgtct cgcggcccgg cccgaggagg 7980

ccggcgggct gctcgacggc ctgcggagcc accccttcct gcggtcggtg tccctgcgga 8040

ccgtgtccga cggccgcagc ggctcggtcc tgttcgccga ctgcccggga ggcgccggac 8100

aggccgcgac agcgcgcgcg gtcggcctgc tgcgcctgcg gctgcccgga ctgagagtcc 8160

tggggccgta cccctcggcg acccatgtcc cgtcgtacga acggagcgag accatgcaca 8220

ccgagaccgc cgccgaagcc ggcctctcag cggagaccgg gtcccgggac atcgcccggc 8280

tgcgcgaccg gatcgactcc ctggaccacc tgctcatcgg cacgctcagg gagcggctgg 8340

aggcgtcccg cgagatccag cggatccgta cccgaagcgg cggctcccag gtcgaccccg 8400

ggcgcgaggc cgccgtccgg ggccggtacg ccgaggaact gggggagggc ggaacgggcg 8460

tcgccgaggc gctgctggac atgtgccggg ggcggtcacc acggtgaacc cgcccccgac 8520

gacgacggcg acgtcgtcac cccgcccccg tcgcggccgt gaggacgtcc tcacggccgc 8580

gacggccttg ttccacgagc ggggttacga cgcgacgagc atgagcgaca tcgccgcacg 8640

cctcggcttc accaaggcgg cgctgtaccg gcacgtgacg ggcaaggccg aactgctgcg 8700

ggcgatcacg cggccggtcc gcgcggacgt gcgggccctg ctggccgcga gcaccgccgg 8760

agacgaccgg cccgtcgacc aactctcgga gctgttacga gggttggccg gcgccgcggc 8820

ggccgacccg ggccggtacg tcctcttctg ggggccggac ggcgagcgga gcccgcacgg 8880

gcccgacgcc gtgtgccgtg cggcggtggt ccagcggctg acggaactgc tggagcgcgc 8940

cgccgaccgc ggcgagatac gcgacggcat cgttccccac ctggccgccc ggctgctcgt 9000

cggcgcggtc accggtccgg gccggccggt gtcaccgtcg gccgtggacg tcctgctcga 9060

cgggccggtg cggcgtctga acgacggggc aggccggggg cgggggcgct ga 9112

<210> 2

<211> 159

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 2

Val Arg His Phe Glu His Phe Arg Val Gly Ser Thr Tyr Glu Leu Gly

1 5 10 15

Thr Thr Arg Leu Thr Ser Glu Asp Ile Ile Gly Tyr Ala Arg Val Trp

20 25 30

Asp Pro Met Pro Phe His Leu Asp Pro Glu Ala Ala Ala Arg Ser Pro

35 40 45

Phe Gly Gly Leu Val Ala Ser Gly Trp His Thr Gly Ala Val Val Met

50 55 60

Gly Gln Phe Val Arg Ala Leu Leu Ala Gly Ser Ala Cys Gln Gly Ser

65 70 75 80

Tyr Gly Met Asp Glu Val Arg Phe Leu Arg Pro Val Arg Pro Gly Asp

85 90 95

Asp Val Arg Gly Arg Ala Thr Val Glu Glu Ala Ala Pro His Pro Arg

100 105 110

Arg Pro Asp Thr Gly Thr Val Arg Phe Val Val Glu Ala Asp Asn Gln

115 120 125

Arg Gly Glu Ala Leu Tyr Arg Met Arg Thr Arg Leu Leu Phe Gly Arg

130 135 140

Ala Glu Ala Gly Gly Ala Gln Arg Glu Glu Val Ala Val Arg Arg

145 150 155

<210> 3

<211> 484

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 3

Val Glu Ser Leu Glu Met Asp Glu Asn Ser Leu Ala Asp Pro Ser Val

1 5 10 15

Glu Ala Trp Arg Ala Leu Pro Val Ala Gln Gln Pro Asp Trp Pro Asp

20 25 30

Pro Thr Ala Leu Arg Thr Thr Leu Ser Ala Leu Ser Ala Ala Pro Pro

35 40 45

Leu Val Phe Gly Gln Glu Cys Asp Thr Leu Leu Asp Arg Leu Gly Glu

50 55 60

Val Ala Leu Gly Arg Gly Phe Leu Leu Gln Gly Gly Asp Cys Ala Glu

65 70 75 80

Thr Leu Asp Gly Val Gly Ala Glu Ser Val Arg Asn Lys Leu Glu Val

85 90 95

Leu Leu Gln Met Ala Ala Val Leu Thr Tyr Ala Ala Gly Val Pro Val

100 105 110

Val Lys Val Gly Arg Ile Ala Gly Gln Tyr Ala Lys Pro Arg Ser Gln

115 120 125

Pro Thr Glu Thr Arg Gly Gly Val Thr Leu Pro Ser Tyr Arg Gly Asp

130 135 140

Ala Val Asn Gly Leu Glu Phe Thr Ala Glu Ala Arg Thr Pro Asp Pro

145 150 155 160

Ala Arg Leu Glu Arg Val Tyr Gln Ala Ser Ala Ala Thr Leu Asn Leu

165 170 175

Leu Arg Ala Leu Thr Ala Gly Gly His Ala Asp Leu Arg Arg Val His

180 185 190

Glu Trp Asn Arg Asp Phe Val Ala Leu Ser Ala Ala Gly His Arg Tyr

195 200 205

Glu Arg Leu Ala Asp Glu Ile Asp Ala Ala Leu Ser Phe Ile Arg Ala

210 215 220

Cys Gly Met Ser Thr Ser Ala Leu Arg Thr Thr Glu Val Phe Ala Ser

225 230 235 240

His Glu Ala Leu Leu Leu Asp Tyr Glu Ser Ala Leu Val Arg Thr Asp

245 250 255

Pro Asp Thr Gly Arg Arg Tyr Ala Leu Ser Gly His Leu Leu Trp Ile

260 265 270

Gly Glu Arg Thr Arg Arg Leu Asp Gly Ala His Val Ala Phe Ala Ala

275 280 285

Gly Val Ser Asn Pro Leu Gly Val Lys Leu Gly Pro Asp Ala Ala Val

290 295 300

Asp Asp Val Arg Ala Leu Val Asp Arg Leu Asp Pro Leu Arg Thr Pro

305 310 315 320

Gly Arg Leu Thr Leu Ile Ala Arg Met Gly Arg Gly Leu Val Arg Asp

325 330 335

Arg Leu Pro Ala Leu Val Glu Ala Val Arg Ala Glu Gly Ala Arg Val

340 345 350

Val Trp Ala Cys Asp Pro Met His Gly Asn Thr Phe Thr Ala Pro Ser

355 360 365

Gly His Lys Ser Arg Arg Phe Glu Asp Val Leu Asp Glu Ile Thr Gly

370 375 380

Phe Phe Glu Val His Arg Ala Leu Gly Thr His Pro Gly Gly Val His

385 390 395 400

Val Glu Leu Thr Gly Glu Asp Val Thr Glu Cys Val Gly Gly Ser Asp

405 410 415

Glu Val Leu Ser Asp Asp Leu Pro Leu Arg Tyr Glu Thr Ala Cys Asp

420 425 430

Pro Arg Leu Asn Arg Gly Gln Ser Met Asp Leu Ala Phe Arg Val Ala

435 440 445

Glu Trp Phe Ser Ala Glu Arg Arg Arg Leu Gly Arg Pro Arg Pro Glu

450 455 460

Pro Ala Leu Ile Arg Pro Val Gly Ala Pro Val Tyr Ala Ala His Ala

465 470 475 480

Ala Ser Pro Gly

<210> 4

<211> 530

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 4

Met Ser Ser Thr Val Asn Pro Ser Gly Ser Val Ser Arg Pro Gln Thr

1 5 10 15

Gly Asp Glu Tyr Leu Glu Ser Leu Arg Asp Gly Arg Glu Val Arg Ile

20 25 30

Tyr Gly Glu Lys Val Gln Asp Val Thr Ala His Pro Ala Phe Arg Asn

35 40 45

Asn Ser Arg Met Val Ala Arg Leu Phe Asp Ala Leu His Asp Pro Glu

50 55 60

Arg Asn Ser Lys Leu Val Val Pro Thr Asp Thr Gly Asn Gly Gly Phe

65 70 75 80

Thr His Pro Tyr Phe Lys Ala Pro Tyr Thr Ser Gly Asp Leu Arg Thr

85 90 95

Ala Ala Arg Ala Met Glu Glu Trp Ala Arg Met Thr Tyr Gly Trp Leu

100 105 110

Gly Arg Thr Pro Asp Phe Lys Ala Ala Phe Leu Ser Thr Leu Gly Ser

115 120 125

Asn Lys Glu His Tyr Ala Pro Phe Glu Asp Asn Ala Ser Ala Trp Tyr

130 135 140

Arg Lys Ala Gln Glu Asn Val Leu Phe Ile Gly His Gly Ile Val Asn

145 150 155 160

Pro Pro Ile Asp Arg Asn Arg Gly Leu Thr Glu Leu Lys Asp Val Met

165 170 175

Leu Thr Val Asp Arg Glu Thr Asp Ala Gly Leu Val Val Ser Gly Ala

180 185 190

Lys Val Val Gly Thr Gly Ala Ala Leu Thr Gln His Ile Phe Ile Gly

195 200 205

Ser Tyr Gly Val Ile Pro Lys Gly Ala Lys Glu Phe Ser Ala Tyr Phe

210 215 220

Ile Val Pro Thr Asp Ser Pro Gly Leu Lys Ile Ile Ser Arg Pro Ser

225 230 235 240

Tyr Glu Phe Ala Ser Ala Thr Val Ser Ser Pro Phe Asp Gln Pro Leu

245 250 255

Ser Ser Arg Leu Asp Glu Asn Asp Gly Ile Leu Val Phe Asp Gln Val

260 265 270

Leu Ile Pro Trp Glu Asn Val Phe Cys Tyr Asp Val Asp Lys Ala Asn

275 280 285

Asp Phe Phe Tyr Gly Ser Gly Phe Phe Tyr Arg Ala Met Phe His Ala

290 295 300

Cys Val Arg Phe Ala Val Lys Met Asp Phe Leu Thr Gly Leu Leu Ala

305 310 315 320

Lys Cys Leu Glu Thr Thr Gly Thr Ser Glu Phe Arg Gly Val Gln Ser

325 330 335

Arg Leu Gly Glu Val Leu Ala Tyr Arg Asn Met Phe Trp Ala Leu Val

340 345 350

Asp Ser Met Ala Glu Asn Pro Thr Lys Trp Pro Asp Gly Thr Val Thr

355 360 365

Pro Asn Gly Glu Thr Ala Leu Ala Phe Arg Val Leu Ser Ser Ser Ile

370 375 380

Phe Pro Lys Val Arg Glu Ile Phe Leu Arg Asp Leu Gly Ser Ala Leu

385 390 395 400

Ile Tyr Asn Asn Ser His Ala Leu Asp Trp Ser Asn Pro Glu Val Arg

405 410 415

Pro Tyr Leu Asp Lys Tyr Val Arg Gly Leu Gly Val Glu Ala Ile Asp

420 425 430

Arg Val Lys Leu Met Lys Leu Ala Trp Asp Ala Val Gly Thr Glu Phe

435 440 445

Gly Ala Arg Trp Glu Leu Tyr Glu Met Asn Tyr Ala Gly Asn His Glu

450 455 460

Gln Ile Arg Phe Glu Ala Leu His Ala Gln Gln Val Ser Gly Lys Phe

465 470 475 480

Asp Asp Tyr Lys Gln Leu Val Asp Arg Cys Leu Ser Glu Tyr Asp Glu

485 490 495

His Gly Trp Lys Val Pro Asp Leu Val Asp Pro Lys Asp Thr Thr Val

500 505 510

Ile Gly Ala Gly Ala Pro Asp Thr Gly Thr Thr Ala Pro Arg Pro Ala

515 520 525

Ala Arg

530

<210> 5

<211> 185

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 5

Val Ser Ser His Thr Pro Ala Pro Gly Gly Pro Thr Ala Pro Pro Gly

1 5 10 15

Ala Pro Val Leu Pro Asp Gln Ala Gln Leu Arg His Val Leu Gly Gln

20 25 30

Phe Val Thr Gly Val Cys Ala Val Ser Thr Arg Phe Asp Thr Arg Ser

35 40 45

Gly Val Arg His Asp Ala Ile Ala Val Asn Ser Phe Thr Ser Val Ser

50 55 60

Leu Asp Pro Pro Leu Val Ser Met Tyr Leu Arg Asp Asp Ser Thr Phe

65 70 75 80

Leu Arg Arg Val Arg Thr Ser Gly Gln Trp Ala Val Ser Phe Leu Gly

85 90 95

Asn Arg Ala Arg Ser Leu Val Gly Val Leu Thr Ala Pro Ala Ala Arg

100 105 110

Arg Pro Pro Val Glu Gln Ala Ala Asp Trp Ala Val Gly Pro His Thr

115 120 125

Gly Cys Leu Val Leu Pro Asp Gly Pro Gly Thr Leu Glu Cys Ala Leu

130 135 140

His Leu Thr Gln Ala Leu Gly Asp His Val Leu Val Val Gly Arg Val

145 150 155 160

Leu Gly Ala Val Gly Arg Asp His Glu Pro Leu Val Phe His Arg Gly

165 170 175

Ala Phe Thr Glu Val Ala Pro Ala Pro

180 185

<210> 6

<211> 400

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 6

Met Ala Arg Lys Arg Pro Tyr Val Ala Val Val Gly Gly Gly Ile Gly

1 5 10 15

Gly Leu Ala Val Ala Leu Gly Leu Arg Arg Gln Gly Val Glu Ala Val

20 25 30

Val His Glu Gln Ala His Ala Leu Ser His Gln Gly Ala Gly Ile Ala

35 40 45

Ile Gly Ala Asn Gly His Arg Ala Leu Arg Glu Leu Gly Val Ala Lys

50 55 60

Arg Leu Thr Ala Ser Ala Ala Arg Pro Ser Arg Ala Asp Phe Arg His

65 70 75 80

Trp Arg Thr Gly Arg Ser Met Val Ser His Arg Leu Thr Gly Leu Tyr

85 90 95

Glu Glu Arg Phe Gly Ala Pro Phe Trp Thr Val Glu Arg Ala Ala Val

100 105 110

Gln Gln Ala Leu Leu Ala Glu Leu Gly Pro Arg His Val Arg Leu Gly

115 120 125

Ala Arg Cys Thr Gly Val Asp Arg Thr Ala Asp Gly Ala Val Ile Arg

130 135 140

Phe Glu Asp Gly Gly Glu Ala Glu Ala Asp Ala Val Val Gly Ala Asp

145 150 155 160

Gly Ile His Ser Ala Val Arg His Ser Leu Phe Gly Pro Gln Glu Ala

165 170 175

Val Phe Ser Gly Thr Ser Gly Tyr Arg Ala Leu Val Pro Met Asp Arg

180 185 190

Leu Arg His Val Pro Glu Leu Ala Glu Pro Val Leu Trp Leu Trp Leu

195 200 205

Gly Pro Gly Arg His Phe Ile Ala Tyr Pro Val Ala Asp Gly Ser Ala

210 215 220

Leu Asn Phe Leu Ala Val Val Pro Asp Arg Thr Trp Thr Val Glu Ser

225 230 235 240

Trp Ser Thr Glu Gly Asp Ala Ala Glu Leu Arg Ala Ala Phe Asp Gly

245 250 255

Trp His Pro Phe Val Thr Glu Val Leu Gly Ala Cys Glu Arg Pro Gly

260 265 270

Arg Trp Ala Leu Tyr Asp Arg Glu Pro Gln Arg Val Trp Ser Ser Gly

275 280 285

Ala Val Thr Leu Leu Gly Asp Ala Ala His Ala Met Leu Pro His His

290 295 300

Gly Gln Gly Ala Asn Gln Ala Leu Glu Asp Ala Val Val Leu Ala His

305 310 315 320

Phe Leu Ala Arg Thr Asp Thr Gly Gly Val Pro Ser Ala Leu Arg Ala

325 330 335

Tyr Glu Arg Leu Arg Arg Pro Arg Thr Arg Leu Leu Gln Ala Gly Ser

340 345 350

Arg Lys Asn Ala Gly Cys Phe Gln Leu Pro Asp Gly Pro Gln Ala Glu

355 360 365

Ala Arg Asn Ala Arg Leu Ala Thr Leu Pro Asp Asp Val Ala Trp Ile

370 375 380

His Gly His Asp Ile Leu Gly Ser Leu Pro Val Ala Thr Ser Pro Ala

385 390 395 400

<210> 7

<211> 203

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 7

Met Ala Arg Thr Tyr Ser Phe Glu Gly Asn Val Pro Val Val His Pro

1 5 10 15

Thr Ala Phe Val His Pro Asp Ala Val Leu Ile Gly Ser Val Asp Ile

20 25 30

Gly Pro Gly Cys Tyr Val Gly Pro Leu Ala Ser Leu Arg Gly Asp Phe

35 40 45

Gly His Ile Glu Leu Arg Ala Gly Ser Asn Val Gln Asp Gly Cys Val

50 55 60

Leu His Cys Phe Pro Gly Ala Asp Thr Val Val Glu Glu Asp Gly His

65 70 75 80

Val Gly His Gly Ser Val Leu His Gly Cys Arg Val Gly Arg Asp Ser

85 90 95

Leu Ile Gly Met Lys Ser Val Leu Met Asp Gly Val Val Val Gly Thr

100 105 110

Arg Ala Phe Val Gly Ala Gly Ser Phe Val Lys Ser Arg Phe Gln Val

115 120 125

Pro Glu Arg His Leu Val Ala Gly Ser Pro Ala Lys Val Val Arg Glu

130 135 140

Leu Thr Ala Asp Glu Ile Ala Trp Lys Gly Asn Gly Thr Ala Gln Tyr

145 150 155 160

Gln Lys Leu Ala Gln Arg Cys Leu Thr Gly Leu His Ala Ala Glu Ala

165 170 175

Ala Thr Glu Arg Thr Ala Pro Ala Ala Pro Ala Glu Pro Gly Glu His

180 185 190

Glu His Val Thr Leu His Ala Tyr Arg Ser Arg

195 200

<210> 8

<211> 70

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 8

Leu Ser Arg Pro Ile Arg Ala Pro Asp Lys Thr Val Arg Thr Gly Pro

1 5 10 15

Ala Thr Ala Pro Gly Ser Arg Glu Arg Gln Ala His Ser Pro Asp Val

20 25 30

Thr Phe Arg Asp Val Thr Phe Thr Asp Val Met Phe Lys Asp Phe Thr

35 40 45

Leu Lys Asp Leu Pro Arg Leu Pro Arg Ala Ala Thr Leu Pro His Pro

50 55 60

Leu Gln Glu Ala Cys Ser

65 70

<210> 9

<211> 253

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 9

Met Asn Ser Ser Ala Thr Ser Arg Leu Val Val Gly Asp Arg Phe Arg

1 5 10 15

Asp Phe Ala Glu Ala Val Gly Ala Glu Thr Phe Ser Arg Leu Ala Arg

20 25 30

Ser Leu Asp Ala Gly Asp Leu Asp Ala Val Glu Gly Pro Leu Arg Val

35 40 45

Val Thr Gly Gln Gly Val Gly Glu Phe Glu Ile Ser Tyr Leu Glu Asp

50 55 60

Ala Val Arg Arg Arg Gln Leu Asp Asp Arg Ile Glu Leu Val His Ser

65 70 75 80

Ala Gly Gln Pro Ala Arg Arg Gln Glu Leu His Lys Ala Arg Glu Asp

85 90 95

Asn Val Leu Ile Ala Gly Leu Thr Gln Val Asp Asp Thr Ala Tyr Glu

100 105 110

Ala Ala Leu Arg Leu His Asp His Asn Glu Leu Leu Val Asp Val Gln

115 120 125

Asp Arg Val His Val Gln Gly Met Val Ala Val Glu Ala Ala Arg Gln

130 135 140

Met Phe Val Ala Val Val Glu Arg Tyr Phe Thr Ala Arg Trp Pro Gln

145 150 155 160

Gln Arg Tyr Tyr Ile Val Leu Asn Ser Ile Asn Thr Thr Phe Ser Asn

165 170 175

Phe Leu Phe Pro Val Gly Ala Thr Val Arg Leu Thr Val Asp Glu Ser

180 185 190

Glu Val Ser Glu Pro Ser Arg Leu Thr Phe Arg Thr Thr Val Glu Val

195 200 205

Glu Gln Ala Gly Arg Pro Ala Ala Ala Val Thr Ile Asp Ala Ala Ala

210 215 220

Phe Ala Pro Gly Leu Leu Glu Glu Lys Glu Leu Arg Arg Ala Lys Ser

225 230 235 240

Ala Val Ala Ser Thr Met Asp Ala Ala Leu Ala Ile Ala

245 250

<210> 10

<211> 402

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 10

Met Arg Thr Pro Thr Pro Asp Thr Arg Thr Arg Pro Ala Pro Gly Arg

1 5 10 15

Leu Pro Tyr Pro Glu Trp Arg Phe Ala Tyr Leu Gly Pro Glu Gly Thr

20 25 30

Phe Thr Glu Leu Ala Leu Arg Ser Leu Pro Glu Ala Thr Gly Ala Arg

35 40 45

Leu Ser Pro Ala Ala Thr Ala Thr Glu Ala Leu Thr Leu Val Cys Arg

50 55 60

Gly Ala Ala Asp Ala Ala Met Leu Pro Val His Asn Thr Val Ala Gly

65 70 75 80

Val Val Ala Asp Thr Val Arg Ala Leu Ala Glu Ser Pro Ala Leu Thr

85 90 95

Val Leu Arg Glu Val Val Leu Pro Val Glu Phe Ala Leu Leu Val Arg

100 105 110

Pro Gly Thr Arg Arg Ala Arg Ile Arg Thr Val Ser Gly His Pro His

115 120 125

Ala Gly Ala Gln Val Gly Gly Trp Leu Asp Ser Arg Ala Pro Gln Ala

130 135 140

Arg Trp Thr Pro Ala Pro Ser Asn Ala Glu Ala Ala Arg Arg Val Arg

145 150 155 160

Asp Arg Glu Cys Asp Ala Ala Val Ala Gly Glu Phe Thr Ala Ala His

165 170 175

Tyr Gly Leu Gln Val Leu Asp Ala Gly Ile Gln Asp Thr Ala Gly Ala

180 185 190

Val Thr Arg Phe Leu Leu Cys Ala Arg Pro Gly Arg Trp Ser Gly Pro

195 200 205

Arg Pro Ala Ala Asp Arg Thr Ser Leu Val Gly Arg Leu Ala Ala Arg

210 215 220

Pro Glu Glu Ala Gly Gly Leu Leu Asp Gly Leu Arg Ser His Pro Phe

225 230 235 240

Leu Arg Ser Val Ser Leu Arg Thr Val Ser Asp Gly Arg Ser Gly Ser

245 250 255

Val Leu Phe Ala Asp Cys Pro Gly Gly Ala Gly Gln Ala Ala Thr Ala

260 265 270

Arg Ala Val Gly Leu Leu Arg Leu Arg Leu Pro Gly Leu Arg Val Leu

275 280 285

Gly Pro Tyr Pro Ser Ala Thr His Val Pro Ser Tyr Glu Arg Ser Glu

290 295 300

Thr Met His Thr Glu Thr Ala Ala Glu Ala Gly Leu Ser Ala Glu Thr

305 310 315 320

Gly Ser Arg Asp Ile Ala Arg Leu Arg Asp Arg Ile Asp Ser Leu Asp

325 330 335

His Leu Leu Ile Gly Thr Leu Arg Glu Arg Leu Glu Ala Ser Arg Glu

340 345 350

Ile Gln Arg Ile Arg Thr Arg Ser Gly Gly Ser Gln Val Asp Pro Gly

355 360 365

Arg Glu Ala Ala Val Arg Gly Arg Tyr Ala Glu Glu Leu Gly Glu Gly

370 375 380

Gly Thr Gly Val Ala Glu Ala Leu Leu Asp Met Cys Arg Gly Arg Ser

385 390 395 400

Pro Arg

<210> 11

<211> 209

<212> PRT

<213> Streptomyces ochraceiscleroticus Soc7

<400> 11

Val Pro Gly Ala Val Thr Thr Val Asn Pro Pro Pro Thr Thr Thr Ala

1 5 10 15

Thr Ser Ser Pro Arg Pro Arg Arg Gly Arg Glu Asp Val Leu Thr Ala

20 25 30

Ala Thr Ala Leu Phe His Glu Arg Gly Tyr Asp Ala Thr Ser Met Ser

35 40 45

Asp Ile Ala Ala Arg Leu Gly Phe Thr Lys Ala Ala Leu Tyr Arg His

50 55 60

Val Thr Gly Lys Ala Glu Leu Leu Arg Ala Ile Thr Arg Pro Val Arg

65 70 75 80

Ala Asp Val Arg Ala Leu Leu Ala Ala Ser Thr Ala Gly Asp Asp Arg

85 90 95

Pro Val Asp Gln Leu Ser Glu Leu Leu Arg Gly Leu Ala Gly Ala Ala

100 105 110

Ala Ala Asp Pro Gly Arg Tyr Val Leu Phe Trp Gly Pro Asp Gly Glu

115 120 125

Arg Ser Pro His Gly Pro Asp Ala Val Cys Arg Ala Ala Val Val Gln

130 135 140

Arg Leu Thr Glu Leu Leu Glu Arg Ala Ala Asp Arg Gly Glu Ile Arg

145 150 155 160

Asp Gly Ile Val Pro His Leu Ala Ala Arg Leu Leu Val Gly Ala Val

165 170 175

Thr Gly Pro Gly Arg Pro Val Ser Pro Ser Ala Val Asp Val Leu Leu

180 185 190

Asp Gly Pro Val Arg Arg Leu Asn Asp Gly Ala Gly Arg Gly Arg Gly

195 200 205

Arg

<210> 12

<211> 60

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward direction

<400> 12

gccaccgcac cgccgtacgg gccgggccgc ggccgtccga tattccgggg atccgtcgac 60

<210> 13

<211> 59

<212> DNA

<213> Artificial Sequence

<220>

<223> reverse direction

<400> 13

gcggccgacg atctgctggt ggacgtcggc ttccacgccg tgtaggctgg agctgcttc 59

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward direction

<400> 14

atgtcaccgc tgcgcaccga 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> reverse direction

<400> 15

acctccggta cggaccagga 20

<210> 16

<211> 60

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward direction

<400> 16

gcgacgggtg cgacgggtgc ggaacatggg agcggcccta tattccgggg atccgtcgac 60

<210> 17

<211> 59

<212> DNA

<213> Artificial Sequence

<220>

<223> reverse direction

<400> 17

gtgtggctcc gccacgccgt ccgctccgcg ctgacccggg tgtaggctgg agctgcttc 59

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Forward direction

<400> 18

tcacgaacag cttcacccac t 21

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> reverse direction

<400> 19

ggcatcgaac tgttcgacct t 21

Claims

1. A3, 7-dihydroxy tropolone high-yield genetic engineering strain streptomyces coelicolor (S. coelicolor)Streptomyces coelicolor) M1152/pCXF1, the preservation number is CGMCC number 13914; the strain contains a biosynthetic gene cluster of 3, 7-dihydroxy tropolone with a base sequence shown in SEQ ID NO. 1.

2. A3, 7-dihydroxy tropolone high-yield genetic engineering strain streptomyces coelicolor (S. coelicolor)Streptomyces coelicolor) M1154/pCXF1 with preservation number of CGMCCNo. 13916; the strain contains a biosynthetic gene cluster of 3, 7-dihydroxy tropolone with a base sequence shown in SEQ ID NO. 1.

3. Use of a strain according to claim 1 or 2 for the production of 3, 7-dihydroxytropolone.

4. A process for the fermentative culture of the strain according to claim 1 or 2, comprising the following steps:

s2, coating the collected spores with an R3 medium, and culturing at 28-30 ℃ for 5-6 days to ferment and accumulate 3, 7-dihydroxy tropolone;

the formula of the R3 culture medium is as follows:

10g of glucose, 5g of yeast extract, 0.1g of casamino acid, 3g of L-proline and MgCl₂•6H₂O 10 g，CaCl₂•2H₂O 4 g，K₂SO₄ 0.25 g，KH₂PO₄0.05g, 5.6g TES, 2ml of trace element solution and deionized water to constant volume of 1,000ml, wherein the pH value is 7.2;

the trace element solution (/ L) includes:

ZnCl₂ 40 mg

FeCl₃•6H₂O 200 mg

CuCl₂•2H₂O 10 mg

MnCl₂•4H₂O 10 mg

Na₂B₄O₇•10H₂O 10 mg

(NH₄)₆Mo₇O₂₄•4H₂O 10 mg。

5. the method for fermentation culture of a strain according to claim 4, further comprising a step of purifying 3, 7-dihydroxytropolone, as follows:

s3, leaching the R3 fermentation culture in the step S2 by using ethyl acetate;

6. The method for the fermentative culture of the strain according to claim 5, further comprising the step of performing liquid phase detection after purification; the analytical liquid chromatographic column was Agilent Zorbax SB-C18, the detection instrument was Agilent 1260Infinity system, and the mobile phase was: the phase A is a water phase added with 1 per mill of trifluoroacetic acid, and the phase B is acetonitrile; the elution conditions were: 0min, 5% B; 15min, 40% B; 25-30min, 100% B; 31-38min, 5% B; the mobile phase proportion is calculated according to the volume ratio.