CN101434931B - Streptomyces clavuligerus, as well as preparation method and application thereof - Google Patents

Abstract

The invention belongs to the field of microbial engineering, provides a superior streptomyces clavuligerus strain that is used for clavulanic acid production, a strain preparation method and application of the strain, and concretely relates to a method, which obtains high expression of key enzyme in the arginine synthesizing process by increasing the copy number of clavulanic acid synthesizing precursor of the streptomyces clavuligerus strain that is key enzyme gene argG in the arginine synthesizing process, and then obtains the streptomyces clavuligerus strain LNSC-2 with high yield of clavulanic acid. Compared with the original strains, the superior streptomyces clavuligerus strain that is provided by the invention can improve the yield of the zymolytic clavulanic acid production by over 20 percent.

Description

A kind of clavuligerus, its preparation method and application thereof

Technical field

The invention belongs to field of biological pharmacy, relate to a kind of clavuligerus, particularly a kind of clavuligerus that makes up by gene engineering method.The invention still further relates to preparation method and the application of described clavuligerus.

Background technology

β-Nei Xiananleikangshengsu as penicillin, cynnematin, cephamycin, is most widely used microbiotic kind clinically.But because the chemical sproof appearance of pathogenic bacteria, this type of antibiotic use is greatly affected.The β-Nei Xiananmei that chemical sproof major cause is its generation appears in pathogenic bacteria, and β-Nei Xiananmei makes its inactivation by the beta-lactam nucleus that destroys β-Nei Xiananleikangshengsu.Clavulanic acid is the natural beta-lactamase inhibitor that clavuligerus produces, can the irreversible activity of protecting β-Nei Xiananleikangshengsu in conjunction with the Serine avtive spot of β-Nei Xiananmei.Normal and the composite use of β-Nei Xiananleikangshengsu of clavulanic acid clinically can strengthen the anti-microbial activity of β-Nei Xiananleikangshengsu effectively and enlarge antimicrobial spectrum.Wherein with the amoxicillin/clavulanate potassium compound preparation use the most extensive, ranked world's best-selling drugs ranking list in once continuous 13 years.

The production bacterium of clavulanic acid is clavuligerus (Streptomyces clavuligerus), and at present domestic bacterial classification throughput is very low, mainly uses conventional methods when strain improvement.Traditional strain breeding method mainly is to adopt ultraviolet mutagenesis and chemomorphosis, these methods length consuming time, randomness is big, workload is big, and much have genetic dominance and metabolic advantage biology sudden change population since the randomness of sudden change be difficult to evaluation and separate.Another approach of domestic raising clavulanic acid output mainly is optimization of fermentation conditions, but its output that can improve is limited.Because the clavulanic acid fermentation yield is low, complex manufacturing, the chemical synthesis industrialization of still being unrealized, the clavulanic acid preparation of China be main dependence on import all the time, therefore increases substantially it and produces bacterial strain to produce the acid amount be a vital task in the current clavulanic acid formulation development.

Along with the development of recombination engineering, increasing research is applied to biological pathways metabolism, and particularly those industrial production with important commercial value are used microorganism.Microorganism cells is in the growth metabolism process, and self can utilize rationally, economically and synthesize various energy and material, makes it be in the balanced growth state.Yet with respect to production application, the original metabolic regulation network of cell is inappropriate.In order to accumulate certain meta-bolites, better application just must change original metabolic regulation network in production, just need modify pathways metabolism.Utilize molecular biology principle systems analysis cellular metabolism network, and by recombinant DNA technology appropriate design cellular metabolism approach and genetic modification, and then finish the transformation of cell characteristics, Here it is metabolic engineering.

Metabolic engineering is regarded as third generation genetic engineering technique, is a brand-new scientific domain after traditional protein and peptide multi-gene expression (first-generation genetically engineered) and gene orthomutation (s-generation genetically engineered).It is multi-disciplinary development and interpenetrative results such as molecular biology, microbiology, genetics and molecular reaction dynamics, is the focus of studying both at home and abroad.Be reflected at expression and regulation and control on the gene level under it is individual at the cellular metabolism approach, utilize recombinant DNA technology amplification, deletion, implant and the relevant gene of regulation and control pathways metabolism, thus the engineering bacteria that obtains having good hereditary property.For example, can increase the output of purpose meta-bolites by the gene copy number that increases the rate-limiting enzyme in those coding route of synthesis.Utilize this method with strong points, time saving and energy saving when the breeding high-yield bacterial strain.

(clavulanic acid CA) belongs to secondary metabolite to clavulanic acid, Elson C in 1978 ¹³The route of synthesis of marker research CA, acid ester salt can form a part five carbon skeletons ( carbon 2,3 and 8,9,10) of CA molecule, and glycerine can provide the carbon skeleton of beta-lactam nucleus (carbon 5,6,7).Discover that subsequently ornithine and arginine all can effectively mix CA ( carbon 2,3,8,9,10).ArgF, argG mutant strain that utilizations such as Valentin can not change arginine into ornithine are the research bacterial strain, find that arginine is the direct precursor of CA.The glycerine of mark, R-Glyceric acid, propionic salt and ethylene lactic acid salt all can be incorporated into CA (carbon 5,6,7), but the hydrogen on two carbon of lactic acid or R-Glyceric acid can not mix, and illustrate that these two kinds of materials all need be transformed into pyruvate salt before mixing.Along with the separated purifying of CEA synthetic enzyme (the catalysis arginine is connected with three carbon units), the investigator finds that this enzyme is substrate with D-3-phosphoglyceraldehyde.Therefore, although other three carbon species may finally have different utilising efficiencys, obviously D-3-phosphoglyceraldehyde is the direct precursor of three carbon units in the CA molecule.In sum, in the clavulanic acid biosynthesizing precursor, C ₃Unit derives from glycerine or its meta-bolites, or the phosphoenolpyruvate in other approach source, but D-3-phosphoglyceraldehyde should be the most direct precursor of three carbon units in the clavulanic acid molecule; C ₅Unit derives from converted product---L-glutamic acid, ornithine and the arginine of the intermediate α-ketoglutaric acid of TCA circulation, and its optimal precursor is with arginine more direct (seeing accompanying drawing 1).

Utilize gene engineering method that clavuligerus is transformed at present and mainly concentrate on the following aspects: competition pathways metabolism---the lat gene in the cephamycin C pathways metabolism that utilizes the method interruption clavulanic acid of gene knockout; Utilize competition pathways metabolism---the gene in the cvm gene cluster in the excellent alkanes pathways metabolism of the method interruption clavulanic acid of gene knockout; The method of utilizing gene to insert increases regulatory gene ccaR in the clavulanic acid pathways metabolism and the copy number of claR; The method of utilizing gene to insert increases the copy number of the rate-limiting step enzyme gene cas2 in the clavulanic acid pathways metabolism.But, to the synthetic precursor of clavulanic acid---arginic pathways metabolism is unmanned the concern, and the present invention utilizes gene engineering method that the arginine pathways metabolism is transformed exactly.

The present invention is applied to the improvement that clavulanic acid is produced bacterial strain with genetic engineering technique, has very important industrial application value.At present, the modern technique that relates to clavulanic acid production and separation and purification is mainly grasped by external big drug firm, domestic theory and the research of application facet about clavulanic acid is all relatively backward, shows as gordian techniquies such as strain selection level, zymotechnique, clavulanic acid extraction and lags far behind abroad.Therefore, how effectively to utilize technological innovation to improve clavulanic acid output and become a difficult problem that is always perplexing domestic production enterprise.Carry the bright gene engineering method improved production bacterial strain that passes through, improve clavulanic acid output, provide new approach for producing strain improvement, have very important significance.

Summary of the invention

In order to solve the problem that the clavuligerus fermentation production of clavulanic acid yields poorly, one of purpose of the present invention provides a kind of clavuligerus superior strain of producing clavulanic acid.

Second purpose of the present invention provides a kind of method for preparing above-mentioned clavuligerus.

The 3rd purpose of the present invention provides the application of above-mentioned clavuligerus bacterial strain in improving clavulanic acid output.

Clavuligerus LNSC-2 of the present invention in September 22 in 2008 in the preservation of Chinese common micro-organisms culture presevation administrative center, and receive preservation registration number CGMCC No.2670.

In order to prepare above-mentioned clavuligerus bacterial strain, the contriver is by increasing synthetic precursor---the copy number of the key gene argG in the arginine route of synthesis of clavulanic acid in the clavuligerus strain gene group, make the key enzyme in the arginic route of synthesis can great expression, thereby obtain the clavulanic acid superior strain.

(argininosuccinate synthetases, ASS), ASS catalysis citrulline and aspartic acid condensation generate argininosuccinic acid to argG genes encoding argininosuccinate synthetase.After changing the argG gene over to, can impel the host to generate more arginine, the availability of prerequisite thing when the raising clavulanic acid is synthetic, thereby the output of raising clavulanic acid.

Raising clavuligerus LNSC-2 provided by the invention produce clavulanic acid output method schema as shown in Figure 3, its concrete steps are:

A. the clone of the method by PCR contains the segment of argG gene from total DNA of clavuligerus, then the argG gene is inserted in the carrier that has attP site, phage juncture, thereby obtains containing the recombinant vectors of argG gene segment;

B. the recombinant vectors that a is gone on foot gained is transformed in the clavuligerus protoplasma for preparing, and resistance screening obtains transforming bacterial strain;

C. detect the ability of the product clavulanic acid of the clavuligerus bacterial strain that the b step obtains, obtain the clavuligerus LNSC-2 of clavulanic acid high yield.

Have following Microbiological Characteristics according to clavuligerus bacterial strain LNSC-2 of the present invention (CGMCC No.2670):

Clavuligerus LNSC-2 (Streptomyces clavuligerus LNSC-2) belongs to actinomycetes, and streptomyces is the most high actinomycetes.Gram-positive has well-developed branch mycelia, the very thin no tabula of mycelia, and width is bordering on rod-shaped bacterium, about 0.5～1 micron.Mycelia is divided into vegetative hyphae, aerial hyphae, fibrillae of spores.Fibrillae of spores forms conidium again.The form of fibrillae of spores and spore, color are different because of kind, are one of main identification proterties of branch kind.

Clavuligerus LNSC-2 goes up white at YD (yeast extract malt extract agar glucose powder substratum), and little have a protuberance, is the chrysanthemum shape, and flap is even, and circular concave surface is arranged in the middle of the bacterium colony, and 25 ℃ reach 1cm at YD last 12 day of left and right sides diameter; The median rise part has depression slightly, and neat fold is uniformly arranged all around, begins to be white, and the later stage gradually becomes greyish white, grey because producing spore; Back side non-pigment produces.Mycelia does not have tabula, and width is less than 1 micron, and mode of reproduction is with the conidium of fibrillae of spores cross cut division formation bunchiness, and it is spherical that spore is.

As long as the clavuligerus LNSC-2 of the present invention that obtains, and according to the characteristic of clavuligerus LNSC-2 provided by the invention, cultivating clavuligerus LNSC-2 in a large number and making its method that produces a large amount of spores is that those skilled in the art of the present technique are familiar with.

Be applicable to that the substratum of cultivating clavuligerus LNSC-2 is diversified, as long as should be understood that the substratum that can growth is provided and breed necessary nutritive ingredient for clavuligerus all is available.The substratum that is used for other various clavuligerus of cultivation in the prior art all is applicable to the cultivation of clavuligerus LNSC-2 of the present invention, such as the substratum that can adopt glucose, extractum carnis, yeast extract paste, agar to make.

The present invention adopts engineered method to prepare genetic engineering bacterium, compares with traditional mutagenesis to have the advantage that purpose is strong, working strength is little, the cycle is short, efficient is high.In addition, the method for construction recombination plasmid of the present invention is simple, and biomaterial obtains easily.The most important thing is that utilize strain fermentation provided by the invention to produce clavulanic acid, its rate ratio original strain is high more than 20%.

Description of drawings

Accompanying drawing 1 is the clavulanic acid biosynthetic pathway

Accompanying drawing 2 is the restriction figure of plasmid pSET152 of the present invention

Accompanying drawing 3 is the building process figure of recombinant plasmid pLN01 of the present invention

Accompanying drawing 4 is pcr amplification argG gene fragment electrophorogram of the present invention

Accompanying drawing 5 detects clavulanic acid content in the original strain fermented liquid for HPLC

Accompanying drawing 6 detects clavulanic acid content in the clavuligerus LNSC-2 fermented liquid for HPLC

Embodiment

By being described in more detail the present invention by following examples.Following examples only are illustrative, are construed as, and the present invention is not subjected to the restriction of these embodiment.

The structure of embodiment 1 argG gene insertion vector

Dna sequence dna design primer according to clavuligerus (Streptomyces clavuligerus) argG gene (Z49111), and be template PCR amplification in vitro argG gene segment with the total DNA of clavuligerus, and the PCR product carried out purifying, electrophoresis detection (accompanying drawing 4) then.

According to two primers of clavuligerus coding argG analysis of gene sequences design pcr amplification argG gene, as follows respectively:

argG-up：CGCGGATCCCGTAAGCGTCCGATCACTTCG

argG-down：CCGGAATTCGCTGCTCACTGCGGGAACT

With BamHI and EcoRI double digestion PCR product, be inserted into then in the pSET152 plasmid (accompanying drawing 2) of same double digestion, obtain positive colony by blue hickie screening, extract plasmid, carry out the checking of BamHI and EcoRI double digestion, its double digestion product clip size of electrophoresis detection is about desired 1.4kb, the insertion carrier pLN01 that obtains building.

The preparation of embodiment 2 streptomycete protoplastiss

The protoplastis screening transforms bacterial strain

Add 100mlYEME+TSBY (1:1) in the 250ml triangular flask that Bu Rust steel spring is housed, and add 0.2% glycine, the spore suspension body of inoculation 100ul is cultivated 36h-40h in 30 ℃ of shaking table 200rpm.Collect mycelium then, and with the mycelium that 10.3% sucrose solution washing is collected, wash altogether three times, and collect mycelium in the centrifugal 10min of 3000rpm.Get mycelium, add the P buffer of N,O-Diacetylmuramidase, at 30 ℃ of water-bath 30-60min, be emulsus to supernatant.Filter with the test tube that absorbent cotton is housed, filtrate changes among the aseptic universal, and in the centrifugal 7min of 3000rpm, collects the protoplastis precipitation, and this is yellow.Softly break up protoplastis, remove N,O-Diacetylmuramidase with P buffer washing again, centrifugal under the similarity condition, collect protoplastis, remove supernatant, break up protoplastis with rifle, packing is in-70 ℃ of preservations.

The conversion of streptomycete protoplastis

Get the DNA of 5ul, join in the protoplastis pipe of 50ul, draw 25% the PEG4000 of 200ul, DNA is poured in the protoplastis, careful suction mixes several times.Then mixture is coated R5 flat board (not containing microbiotic), behind 30 ℃ of cultivation 14-20h, added the microbiotic (Apr) of 20ul/ml, continue again to cultivate, can see less transformant.This transformant is the clavuligerus LNSC-2 that changes plasmid over to.

The bottle that shakes of embodiment 3 genetic engineering bacteriums detects

Carry out shake flat experiment to screening engineering bacteria, detect the ability that it produces clavulanic acid.Be control strain with the original strain, selecting soya broth for use is fermention medium, and shaking bottled liquid measure is 1:10, and inoculum size is 5%, and in 28 ℃, 250rpm cultivates, and respectively at different time samplings, detects clavulanic acid content.Every group of test has two repetitions respectively.The HPLC detected result shows that clavuligerus LNSC-02 compares with original strain, and output has had and increases substantially, and has improved 20% (accompanying drawing 5, accompanying drawing 6) when 72h.

Table 1HPLC detects the content of clavulanic acid in the fermented liquid

Claims (3)

1. clavuligerus LNSC-2 (Streptomyces clavuligerus LNSC-02), preserving number is CGMCC No.2670.

2. the preparation method of clavuligerus LNSC-2 as claimed in claim 1 is characterized in that comprising the steps:

A. the clone of the method by PCR contains the segment of argG gene from total DNA of clavuligerus, then the argG gene is inserted in the carrier that has attP site, phage juncture, thereby obtains containing the recombinant vectors of argG gene segment;

B. the recombinant vectors that a is gone on foot gained is transformed in the clavuligerus protoplasma for preparing, and resistance screening obtains transforming bacterial strain;

C. detect the ability of the product clavulanic acid of the clavuligerus bacterial strain that the b step obtains, obtain clavuligerus LNSC-2.

3. the application of clavuligerus LNSC-2 as claimed in claim 1 in improving clavulanic acid output.

Images