CN105296453B - The clavuligerus of the one plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide and application thereof - Google Patents
The clavuligerus of the one plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide and application thereof Download PDFInfo
- Publication number
- CN105296453B CN105296453B CN201510776880.6A CN201510776880A CN105296453B CN 105296453 B CN105296453 B CN 105296453B CN 201510776880 A CN201510776880 A CN 201510776880A CN 105296453 B CN105296453 B CN 105296453B
- Authority
- CN
- China
- Prior art keywords
- clavuligerus
- carat
- retinamide
- carboxyphenyl
- acetylated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
- C12P17/188—Heterocyclic compound containing in the condensed system at least one hetero ring having nitrogen atoms and oxygen atoms as the only ring heteroatoms
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the clavuligerus of a plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide; for clavuligerus (Streptomyces clavuligerus) B02 246; being preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on October 13rd, 2015, deposit number is CGMCC NO.11484.The present invention uses the gene of the continuous error-prone PCR method external sudden change acetylated enzyme of carat N-(4-carboxyphenyl)retinamide; with carat N-(4-carboxyphenyl)retinamide acetylated enzyme deletion mycopremna for the bacterium that sets out; the mutant library containing carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene is set up by engaging transfer techniques; screening obtains positive mutating strain, is obtained clavuligerus B02 246 of stabilization characteristics of genetics by fermentation checking, Secondary Culture.The clavulanic acid synthesis level of bacterial strain of the present invention is higher 1.3 times than original strain B02, can be applicable to industrial fermentation and produces.
Description
Technical field
The invention belongs to Microbial Breeding and biological technical field, be specifically related to a plant height activity carat N-(4-carboxyphenyl)retinamide amino second
The clavuligerus of acylase and application thereof.
Background technology
Clavulanic acid (clavulanic acid) is the beta-lactamase inhibitor commonly used clinically, can be with amoxicillin
Or ticarcillin drug combination, thus strengthen this antibiotic antibacterial activity to Resistant strain, improve clinical efficacy, have important
Clinical value.
Clavulanic acid is that a kind of cometabolism synthesized by clavuligerus (Streptomyces clavuligerus) produces
Thing, industrial mode of production is fermentable and Hydrolysis kinetics.Fermentation level is the weight determining clavulanic acid production cost at present
Wanting factor, therefore research and development Clavulanic Acid High-Producing Strains strain has very important industrial value.The carat of wild type clavuligerus
Dimension acid yield is the lowest, can not meet far away the needs of industrial fermentation, so existing clavuligerus industrial strain all passes through
The mutant that many wheel mutagenesis screenings obtain, but routine mutagenesis breeding technique has randomness and blindness, causes breeding work
Inefficient, the cycle is the longest, becomes the bottleneck that restriction fermentation industry production technology improves.A kind of efficient bar-shaped chain of exploitation
Mycete breeding method also obtains superior strain and has very important actual application value.
The carat acetylated enzyme of N-(4-carboxyphenyl)retinamide is the key turning to clavulanic acid route of synthesis from intermediate carat N-(4-carboxyphenyl)retinamide
Enzyme, this enzymatic activity can improve carat N-(4-carboxyphenyl)retinamide and turn to the catalytic efficiency of synthesis clavulanic acid when improving, and when enzymatic activity reduces
Carat N-(4-carboxyphenyl)retinamide can flow to by-product.Carry out genetic modification by enzyme acetylated to carat N-(4-carboxyphenyl)retinamide and can be expected to acquisition gram
Clavulanic acid Producing Strain, but owing to the site of genetic modification is difficult to select, therefore, be the most not yet related to carat N-(4-carboxyphenyl)retinamide amino
Acetylase carries out genetic modification and obtains the report of Clavulanic Acid High-Producing Strains.
Summary of the invention
For above-mentioned prior art, it is an object of the invention to provide a plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide
Clavuligerus and application thereof.Using the strategy of orthogenesis, enzyme acetylated to carat N-(4-carboxyphenyl)retinamide is oriented transformation, and
Coordinate High Throughput Screening Assay to obtain the high activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide, and then obtain Clavulanic Acid High-Producing Strains strain.
For achieving the above object, the present invention adopts the following technical scheme that
One aspect of the present invention relates to a kind of acetylated enzyme of high activity clavulanic acid, and it has such as SEQ ID
Aminoacid sequence shown in NO.1, or this sequence through replace, lack or add one or several amino acids formed have equal
The aminoacid sequence of function.
Another aspect of the present invention relates to the gene encoding the above-mentioned acetylated enzyme of high activity clavulanic acid；Concrete,
The nucleotide sequence of this gene is as shown in SEQ ID NO.2.
Another aspect of the invention relates to a kind of clavuligerus, and it contains above-mentioned coding high activity clavulanic acid amino second
The gene of acylase.
Another aspect of the invention relates to the clavuligerus of a plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide, this bacterium
Strain is specially clavuligerus (Streptomyces clavuligerus) B02-246.It is preserved on October 13rd, 2015
(being called for short CGMCC, address is North Star west, Chaoyang District, Beijing City at China Committee for Culture Collection of Microorganisms's common micro-organisms center
Road 1 institute 3, Institute of Microorganism, Academia Sinica), deposit number is CGMCC NO.11484.
Clavuligerus (Streptomyces clavuligerus) B02-246 of the present invention and the bar-shaped chain of industrial strain
Mycete B02 compares, and the gene of the acetylated enzyme of carat N-(4-carboxyphenyl)retinamide has 4 bases to change, and is the 1222nd respectively and is become by A
For G, the 1229th is become T from A, and the 1239th is become A from C, and the 1240th is become G from C.Wherein the 1222nd bit base sudden change is drawn
Playing codon and become GAG from AAG, aminoacid is become glutamic acid from lysine；1229th bit base sudden change causes codon by GAC
Becoming GTC, aminoacid is become valine from aspartic acid；1239th bit base sudden change causes codon to be become CTA from CTC, is
Samesense mutation, aminoacid is not changed in, and is all leucine；1240th bit base sudden change causes codon to be become GAG from CAG, ammonia
Base acid is become glutamic acid from glutamine.
It is a further object of the present invention to provide a kind of microbial inoculum, the active component of this microbial inoculum is clavuligerus
(Streptomyces clavuligerus)B02-246。
Described clavuligerus (Streptomyces clavuligerus) B02-246 and/or described microbial inoculum are in preparation gram
Application in clavulanic acid falls within protection scope of the present invention.
Further, described clavuligerus (Streptomyces clavuligerus) B02-246 and/or described bacterium
Agent application in preparing beta-lactamase inhibitor is also protection scope of the present invention.
It is also another object of the present invention to provide this clavuligerus (Streptomyces clavuligerus) B02-
The preparation method of 246, uses the gene of the continuous error-prone PCR method external sudden change acetylated enzyme of carat N-(4-carboxyphenyl)retinamide, with existing
Carat N-(4-carboxyphenyl)retinamide acetylated enzyme deletion mycopremna be the bacterium that sets out, set up containing carat N-(4-carboxyphenyl)retinamide ammonia by engaging transfer techniques
The mutant library of base acetylase gene, screening obtains positive mutating strain, obtains heritability finally by fermentation checking, Secondary Culture
Clavuligerus (Streptomyces clavuligerus) B02-246 that shape is stable.
It is a still further object of the present invention to provide a pair for external sudden change carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene
The primer of fallibility PCR, its primer sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.4 in sequence table.
Forward primer GcasForward sequence: GCTCTAGAGCCCGCAGTGTGATGAAG (SEQ ID NO.3)；
Downstream primer GcasReverse sequence: GCGAATTCGGGTGGCGTCTCCGCTCACG (SEQ ID NO.4).
The gene of the described continuous error-prone PCR method external sudden change acetylated enzyme of carat N-(4-carboxyphenyl)retinamide method particularly includes:
(1) PCR reaction system: template DNA 2ul, PCR buffer 5ul, Taq archaeal dna polymerase 1ul, dATP 1～3ul,
DTTP 1～3ul, dGTP 1～3ul, dCTP 1～3ul, forward primer 2ul, downstream primer 2ul, 25mM MgCl21～8ul,
5mM MnCl20～1ul, add ultra-pure water to 50ul.
(2) PCR condition: denaturation 97 DEG C 10 minutes, degeneration 97 DEG C 30 seconds, anneal 52～62 DEG C 30 seconds, extend 72 DEG C 2 points
Clock, circulates 35 times, extends 10 minutes eventually.
The template DNA of the 1st PCR derives from industrial strain clavuligerus B02, the 2nd PCR and the template of follow-up PCR
DNA uses PCR primer last time.
The construction method of the described mutant library containing carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene, specifically comprises the following steps that
(1) continuous error-prone PCR product XbaI and BamHI is carried out double digestion, reclaim after Agar Gel sugar electrophoretic separation
Digestion products, and with as the shuttle vector pSET152 of double digestion be attached, convert escherichia coli DH5a, picking transformant
Extracting plasmid and carry out double digestion qualification, must recombinate pSET152；
(2) use joint transfer techniques that restructuring pSET152 is proceeded to the carat N-(4-carboxyphenyl)retinamide of industrial strain clavuligerus B02
Acetylated enzyme gene deletion bacterial strain, obtains a series of conjugon, i.e. builds and obtain carat N-(4-carboxyphenyl)retinamide acetylated enzyme base
The mutant library of cause.
The method that screening positive mutating strain is used is: uses flat board transparent circle method, carries out the conjugon in mutant library
High flux screening.
Beneficial effects of the present invention:
(1) present invention uses the mode of orthomutation to screen to obtain the prominent of carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene first
Variant, is suddenlyd change by continuous error-prone PCR enzyme gene acetylated to carat N-(4-carboxyphenyl)retinamide in vitro, passes through high flux simultaneously
Screening technique obtains Clavulanic Acid High-Producing Strains strain B02-246, and clavulanic acid synthesis level is higher than industrial strain clavuligerus B02
1.3 times, can be applicable to industrial fermentation and produce, there is important economic worth.
(2) preparation method of the clavuligerus engineering bacteria of the present invention, the efficiency of sudden change work is high, and specific aim is very strong,
Reduce randomness and the blindness of mutagenic breeding, meet the breeding needs of industrial producing strain.
Accompanying drawing explanation
Fig. 1 is that flat board transparent circle method screens clavuligerus conjugon；
Fig. 2 is that the clavulanic acid fermentation level of B02-246 with B02 compares.
Detailed description of the invention
The present invention is further illustrated in conjunction with the embodiments, it should explanation, and the description below is merely to explain this
Invention, is not defined its content.
Embodiment 1: continuous error-prone PCR obtains the genes of interest containing mutating alkali yl
Continuous error-prone PCR enzyme gene acetylated to carat N-(4-carboxyphenyl)retinamide in vitro is used to suddenly change.Particularly as follows:
1. the primer of fallibility PCR is:
Forward primer GcasForward sequence: GCTCTAGAGCCCGCAGTGTGATGAAG；
Downstream primer GcasReverse sequence: GCGAATTCGGGTGGCGTCTCCGCTCACG.
2.PCR system: template DNA 2ul, PCR buffer 5ul, Taq archaeal dna polymerase 1ul, dATP 1～3ul, dTTP
1～3ul, dGTP 1～3ul, dCTP 1～3ul, forward primer 2ul, downstream primer 2ul, 25mM MgCl21～8ul, 5mM
MnCl20～1ul, add ultra-pure water to 50ul.
3.PCR condition: denaturation 97 DEG C 10 minutes, degeneration 97 DEG C 30 seconds, anneal 52～62 DEG C 30 seconds, extend 72 DEG C 2 points
Clock, circulates 35 times, extends 10 minutes eventually.
1st time pcr template DNA derives from industrial strain clavuligerus B02, the 2nd PCR and the template DNA of follow-up PCR
Use PCR primer last time.
PCR primer directly send order-checking, and result shows: as dATP 1ul, dTTP 1ul, dGTP 2ul, dCTP in PCR system
2ul, forward primer 2ul, downstream primer 2ul, 25mM MgCl26ul、5mM MnCl20.5ul, PCR annealing temperature is 58 DEG C, 2 times
During consecutive PCR, base mismatch number is 4～8, and mutation frequency compares and is appropriate to directional transformation.
Embodiment 2: the structure in clavuligerus carat N-(4-carboxyphenyl)retinamide acetylated enzyme mutant storehouse
Continuous error-prone PCR product XbaI and BamHI in embodiment 1 is carried out double digestion, and Agar Gel sugar electrophoresis divides
From rear recovery digestion products, and with as the shuttle vector pSET152 of double digestion (pSET152 is conventional matter of the prior art
Grain) it is attached, convert escherichia coli DH5a, picking transformant is extracted plasmid and is carried out double digestion qualification.
Use joint transfer techniques that restructuring pSET152 is proceeded to the carat N-(4-carboxyphenyl)retinamide amino second of clavuligerus bacterial strain B02
(this gene deletion strains obtains acylase gene deletion mycopremna for knocking out technology for starting strain by conventional gene with bacterial strain B02
Arrive), obtain a series of conjugon, build the mutant library of carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene.
Embodiment 3: zygosporic plate screening
Utilize the escherichia coli of band beta-lactamase as indicator bacteria, make screening flat board with the LA containing ampicillin,
Use flat board transparent circle method that clavuligerus conjugon (prepared by embodiment 2) is screened.First 6897 conjugons are divided
It is not transferred on BSCA solid plate 25 DEG C cultivate 6 days, then takes 6mm diameter conjugon agar block, be placed on screening flat board
On, cultivate 16 hours for 37 DEG C, measure transparent circle diameter (see Fig. 1).Using bacterial strain B02 as comparison, transparent circle diameter is more simultaneously
The ability of big expression synthesis clavulanic acid is the biggest, selects positive mutating strain 564 strain, continuation cultivation to product spore respectively numbering B02-altogether
1～B02-564.
The spore of 564 positive mutating strains is diluted to 10 respectively5Individual/ml, takes on 100ul coating BSCA solid plate, and 25
DEG C cultivate 6 days, carry out flat board and sieve again, finally select clavulanic acid high productive mutant 120 strain, continue to cultivate to producing spore.
Wherein, the culture medium being used for preparing BSCA solid plate consists of: Fructus Hordei Germinatus extract 8g/L, yeast extract 4g/
L, glucose 4g/L, agar powder 15g/L, pH 8.5,0.15MPa sterilizing 30min.
Fructus Hordei Germinatus extract and yeast extract are the commercially available prod of routine.
Embodiment 4: the shake flask fermentation screening of mutant
The spore of 120 plant mutant strains embodiment 3 selected is diluted to 10 respectively7Individual/ml, is inoculated in liquid by 2% (V/V)
In body culture medium, fermentation shake flask, 25 DEG C, 200rpm shaken cultivation 6 days, 3000rpm is centrifuged 10min Aspirate supernatant, uses HPLC
The fermentation level of method detection clavulanic acid.Result shows that in 92 plant mutant strain fermentation liquids, clavulanic acid content is significantly higher than the bacterium that sets out
Strain, the positive mutation rate of multiple sieve reaches 76.7%, and wherein the fermentation level increase rate of 8 plant mutant bacterium is more than 15%, result such as table
1.Final screening obtains the mutant strain (result is shown in Fig. 2) of a strain clavulanic acid fermentation level high 1.3 times than industrial strain B02,
By named for this mutant B02-246.
Consisting of of fluid medium: soybean protein extract 20g/L, yeast extract 8g/L, maltodextrin 15g/L,
Dipotassium hydrogen phosphate 0.5g/L, pH 7.5,0.15MPa sterilizing 30min.
Wherein, soybean protein extract and yeast extract are the commercially available prod of routine.
During shake flask fermentation, every 250ml triangle bottled 30ml fluid medium.
The clavulanic acid yield result (g/L fermentation liquid) of table 1 mutant shake flask fermentation
| Bacterial strain | Repeat 1 | Repeat 2 | Repeat 3 | Meansigma methods |
| B02 | 3.46 | 3.67 | 3.6 | 3.58 |
| B02-078 | 4.05 | 4.26 | 4.18 | 4.16 |
| B02-109 | 4.35 | 4.31 | 4.28 | 4.31 |
| B02-246 | 4.62 | 4.50 | 4.73 | 4.62 |
| B02-252 | 4.18 | 4.29 | 4.27 | 4.25 |
| B02-267 | 4.57 | 4.62 | 4.49 | 4.56 |
| B02-323 | 4.39 | 4.45 | 4.42 | 4.42 |
| B02-403 | 4.13 | 4.28 | 4.37 | 4.26 |
| B02-465 | 4.61 | 4.47 | 4.52 | 4.53 |
Embodiment 5: the hereditary stability of superior strain B02-246 is investigated
By the spore suspension dilution spread of superior strain B02-246 on BSCA solid medium 25 DEG C cultivate 6 days, separate
The monospore bacterium colony of strain B02-246 also carries out amplification culture, is continuously separated monospore six times, each amplification culture, and carries out shaking flask and send out
Ferment checking clavulanic acid fermentation level, the results are shown in Table 2, and result shows that superior strain B02-246 has preferable hereditary stability,
Meet industrial demand.
The clavulanic acid fermentation level (g/L fermentation liquid) of table 2 B02-246 difference passage number
| Passage number | Repeat 1 | Repeat 2 | Repeat 3 | Meansigma methods |
| Initial | 4.62 | 4.50 | 4.73 | 4.62 |
| The first generation | 4.71 | 4.56 | 4.61 | 4.63 |
| The second filial generation | 4.65 | 4.53 | 4.57 | 4.58 |
| The third generation | 4.78 | 4.51 | 4.56 | 4.62 |
| Forth generation | 4.53 | 4.67 | 4.69 | 4.63 |
| 5th generation | 4.67 | 4.53 | 4.58 | 4.59 |
| 6th generation | 4.64 | 4.71 | 4.62 | 4.66 |
Embodiment 6: the determined dna sequence of the acetylated enzyme mutant of carat N-(4-carboxyphenyl)retinamide
The genomic DNA of extraction engineering bacteria B02-246 is as template, with Gcas Forward and Gcas Reverse for drawing
Thing carries out high-fidelity PCR amplification, and PCR primer is separated and recovered from through agarose gel electrophoresis, is connected conversion with pCR-Blunt carrier
Escherichia coli DH5a, the several positive colony of picking carries out DNA sequencing.Carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene in B02-246
Sequence is as shown in SEQ ID NO.2 in sequence table, and in B02, carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene order is as in sequence table
Shown in SEQ ID NO.5.Result shows, in B02-246, carat N-(4-carboxyphenyl)retinamide acetylated enzyme gene is compared with wild type gene
Having 4 bases to change, be the 1222nd respectively and become G from A, the 1229th is become T from A, and the 1239th is become A from C, the
1240 are become G from C, cause 3 aminoacid changes, are K408E, D410V and Q414E respectively.Carat N-(4-carboxyphenyl)retinamide in B02-246
The aminoacid sequence of acetylated enzyme as shown in SEQ ID NO.1 in sequence table, the acetylated enzyme of carat N-(4-carboxyphenyl)retinamide in B02
Aminoacid sequence as shown in SEQ ID NO.6 in sequence table.
Bacterial strain B02-246 is preserved in China Committee for Culture Collection of Microorganisms on October 13rd, 2015 the most micro-
(being called for short CGMCC, address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 to Bio-Centers, Chinese Academy of Sciences's microbe research
Institute), deposit number is CGMCC NO.11484.
Embodiment 7: fermentation culture superior strain B02-246 produces clavulanic acid
1. seed liquor is cultivated:
By the spore inoculating of bacterial strain B02-246 to liquid seeds shaking flask, 25 DEG C of 200rpm shaken cultivation 2 days, then inoculate
To 200L seed tank, cultivate 2 days for 25 DEG C and obtain seed liquor；Simultaneously using starting strain B02 as comparison.
2. fermentation culture:
Seed liquor is inoculated into 5m by 5% (volume fraction) inoculum concentration3Fermentation tank, ventilation 1.5VVM, speed of agitator
120rpm, 25 DEG C of fermentation culture 6 days, put the fermentation level of tank detection clavulanic acid.
Consisting of of the fluid medium of seed culture and fermentation culture: soybean protein extract 20g/L, yeast extract
8g/L, maltodextrin 15g/L, dipotassium hydrogen phosphate 0.5g/L, pH 7.5,0.15MPa sterilizing 30min.
Wherein, soybean protein extract and yeast extract are the commercially available prod of routine.
3. clavulanic acid assay:
Using HPLC method to measure the content of clavulanic acid in fermentation liquid, result is: carat dimension in bacterial strain B02-246 fermentation liquid
Acid content is 4.53g/L, and in bacterial strain B02 fermentation liquid, clavulanic acid content is 3.62g/L.
Claims (8)
1. the high activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide, it is characterised in that its aminoacid sequence such as SEQ ID NO.1 institute
Show.
2. the gene of coding high activity carat N-(4-carboxyphenyl)retinamide acetylated enzyme described in claim 1, it is characterised in that its nucleoside
Acid sequence is as shown in SEQ ID NO.2.
3. a clavuligerus, it contains the coding high activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide described in claim 2
Gene.
4. the clavuligerus of a plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide, this bacterial strain is clavuligerus
(Streptomyces clavuligerus) B02-246, is preserved in Chinese microorganism strain preservation on October 13rd, 2015
Administration committee's common micro-organisms center, deposit number is CGMCC NO.11484.
5. a microbial inoculum, it is characterised in that the active component of this microbial inoculum is the clavuligerus described in claim 4
(Streptomyces clavuligerus)B02-246。
6. (Streptomyces clavuligerus) B02-246 of clavuligerus described in claim 4 and/or claim 5
The application in preparing clavulanic acid of the described microbial inoculum.
7. (Streptomyces clavuligerus) B02-246 of clavuligerus described in claim 4 and/or claim 5
The application in preparing beta-lactamase inhibitor of the described microbial inoculum.
8. it is used for the primer of the fallibility PCR of the gene of the external sudden change acetylated enzyme of carat N-(4-carboxyphenyl)retinamide, it is characterised in that it draws
Thing sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.4 in sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510776880.6A CN105296453B (en) | 2015-11-12 | 2015-11-12 | The clavuligerus of the one plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510776880.6A CN105296453B (en) | 2015-11-12 | 2015-11-12 | The clavuligerus of the one plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105296453A CN105296453A (en) | 2016-02-03 |
| CN105296453B true CN105296453B (en) | 2016-08-31 |
Family
ID=55194285
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510776880.6A Expired - Fee Related CN105296453B (en) | 2015-11-12 | 2015-11-12 | The clavuligerus of the one plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105296453B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106367431B (en) * | 2016-09-30 | 2019-12-10 | 山东建筑大学 | Construction method of bacterial strain for over-expression of endogenous lysozyme, constructed bacterial strain and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007030772A2 (en) * | 2005-09-09 | 2007-03-15 | The Johns Hopkins University | Improved production of clavulanic acid by genetic engineering of streptomyces clavuligerus |
| CN101434931A (en) * | 2008-11-05 | 2009-05-20 | 鲁南制药集团股份有限公司 | Streptomyces clavuligerus, as well as preparation method and application thereof |
| CN103013865A (en) * | 2012-12-04 | 2013-04-03 | 天津师范大学 | Engineered strain of streptomyces clavuligerus, and preparation method and application thereof |
-
2015
- 2015-11-12 CN CN201510776880.6A patent/CN105296453B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007030772A2 (en) * | 2005-09-09 | 2007-03-15 | The Johns Hopkins University | Improved production of clavulanic acid by genetic engineering of streptomyces clavuligerus |
| CN101434931A (en) * | 2008-11-05 | 2009-05-20 | 鲁南制药集团股份有限公司 | Streptomyces clavuligerus, as well as preparation method and application thereof |
| CN103013865A (en) * | 2012-12-04 | 2013-04-03 | 天津师范大学 | Engineered strain of streptomyces clavuligerus, and preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| AY258009.2;Jensen，S.E.等;《GenBank核酸数据库》;20031229;全文 * |
| EDY47137.1;Fischbach,M等;《GenBank蛋白数据库》;20080902;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105296453A (en) | 2016-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105886431A (en) | Corynebacterium glutamicum and method for producing high-yield isoleucine with same | |
| Singh et al. | Inulinase production from a new inulinase producer, Penicillium oxalicum BGPUP-4 | |
| CN105368838B (en) | The product phosphorus solar month of 30 days bacterium engineering bacteria of one plant of efficient accumulation polyphosphate and its application | |
| CN106190921A (en) | A kind of corynebacterium glutamicum and application | |
| CN108753669B (en) | Adenine production strain and construction method and application thereof | |
| CN109943546B (en) | Glutamine transaminase mutant and preparation method and application thereof | |
| US10612007B2 (en) | Method for increasing citric acid production by Aspergillus niger fermentation | |
| CN103249832B (en) | Utilize new the producing succinic acid mutant microorganism and utilize its method producing succinic acid of sucrose and glycerol simultaneously | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| KR20090072689A (en) | A highly productive saccaromyces cerevisiae and method of preparing ethanol using by the same | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN107227283A (en) | A kind of Corynebacterium glutamicum and its construction method and application | |
| CN101215533B (en) | Hydantoinase and carbamoyl hydrolase producing strain, bienzyme gene and application thereof for preparing L-amino acid | |
| CN105296453B (en) | The clavuligerus of the one plant height activity acetylated enzyme of carat N-(4-carboxyphenyl)retinamide and application thereof | |
| CN109706131A (en) | A kind of genetic engineering bacterium that expressing high specific beta cyclodextrin glycosyl transferase and its construction method and application | |
| CN104212739B (en) | Bacillus cereus and application thereof to preparation of nitrite reductase | |
| CN106399218A (en) | Bacillus subtilis engineering bacteria and application thereof | |
| CN106701649A (en) | Strain for producing L-glutamine and method for producing L-glutamine | |
| CN108330113B (en) | The Actinosynnema bacterium of one plant height Substratspezifitaet acyltransferase and its application | |
| CN104611284A (en) | Strain for production of cyclodextrin glucosyltransferase and application of strain | |
| CN111549050B (en) | Vitreoscilla hemoglobin expression frame suitable for bacillus and application | |
| CN107058264A (en) | Than the alpha amylase JcAmy mutant living improved and its encoding gene and application | |
| CN106190854B (en) | A kind of preparation method of desert pseudocyst bacterium and oritavancin intermediate | |
| CN106929495A (en) | Improve than alpha amylase BasAmy mutant living and its encoding gene and application | |
| CN101434931B (en) | Streptomyces clavuligerus, as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160831 Termination date: 20171112 |