CN103013865A - Engineered strain of streptomyces clavuligerus, and preparation method and application thereof - Google Patents

Abstract

The invention discloses an engineered strain of streptomyces clavuligerus, and a preparation method and application thereof. Through treating streptomyces clavuligerus by using an ultraviolet mutagenesis technology firstly, a mutant strain B372 is obtained, wherein the clavulanic acid yield of the mutant strain B372 is 1.9 times as large as that of an original strain; and then, through taking the mutant strain as a starting strain, a mutant strain S.clavuligeruslat:: Delta subjected to lat gene knockout is built by using PCR-TARGETING. Studies show that after ultraviolet mutagenesis and lat gene knockout, the clavulanic acid yield of the streptomyces clavuligerus is significantly increased and is 2.3 times as large as that of the original strain. The clavulanic acid yield of the engineered strain disclosed by the invention is significantly increased, and the engineered strain does not contain any resistance makers, therefore, the engineered strain is extremely conveniently used for further genetic engineering reconstruction; and through continuous passage, the clavulanic acid yield is relatively stable and good in repeatability.

Description

Engineering strain of a kind of clavuligerus and preparation method thereof and application

The application obtains the subsidy of the doctor of Tianjin Normal University fund (52x09010).

Technical field

The invention belongs to biological technical field, particularly a kind of ultraviolet mutagenesis of clavuligerus and gene disruption mutant bacteria and preparation method thereof.

Background technology

In decades, due to antibiotic a large amount of uses, caused the resistance of bacterium to a lot of medicines, the resistance of pathogenic bacteria to β-lactam antibitics, oneself becomes one of important factor of intractable infection clinically.

Clavulanic acid (clavulanic acid) be clavuligerus ( streptomyces clavuligerus) meta-bolites, have another name called clavulanic acid, be that first is found and is applied to clinical beta-lactamase inhibitor.The anti-microbial activity of clavulanic acid itself is very weak, but it has brute force, wide spectrum and irreversible activity of inhibiting beta-lactamase.Clavulanic acid is combined respectively as amoxycilline Trihydrate bp (Amoxicillin), ticarcillin (Ticarcillin) with β-lactam antibitics; make the enzyme inhibitors combined preparation; can protect in varying degrees β-lactam antibitics not by the beta-lactam enzyme-deactivating; thereby improve this microbiotic to producing the anti-microbial activity of enzyme resistant organism, improve clinical efficacy.

In clavuligerus, the metabolic pathway of synthesizing of cephamycin C be take 1B, Cys and α-amino-isovaleric acid as precursor substance.Clavuligerus latgenes encoding Methionin ε-transaminase (this enzyme is the key enzyme in the cephamycin C route of synthesis), be to involve first synthetic gene of cephamycin C, is also the preferred genes regulated and controled.Research shows, in clavuligerus, a kind of blocking-up of meta-bolites may cause the raising of other meta-bolites output.The clavulanic acid gene cluster is adjacent with the cephamycin C gene cluster, and be subject to the regulation and control of identical adjusting PROTEIN C caR, Paradkar etc. (Paradkar AS, Mosher RH, Anders C (2001). Application of gene replacement technology to streptomyces clavuligerusstrain development for clavulanic acid production. Appl. Environ. Microbiol., 67 (5): 2292-2297.) research shows, reduce during the fermentation or eliminate the synthetic output that can improve clavulanic acid of cephamycin C in clavuligerus, and can effectively reduce the interfering substance in fermented liquid, simplify extraction process.

Summary of the invention

Therefore, the technical problem to be solved in the present invention is exactly the deficiency yielded poorly for existing clavuligerus clavulanic acid, adopt the method for ultraviolet mutagenesis binding molecule transformation to carry out the many-side transformation to clavuligerus, high-yielding engineering bacterial strain of a kind of clavuligerus and preparation method thereof is provided, and the clavulanic acid output of the mutant strain of this clavuligerus obtains larger raising.

One object of the present invention is to overcome above-mentioned technical problem, thereby a kind of Slreptomyces clavuligerus mutant Slreptomyces clavuligerus mutant lat: is provided: Δ ( streptomyces clavuligeruslat:: Δ) bacterial strain (preservation be the bacterial strain that ultimate capacity is the highest).

Clavuligerus of the present invention ( streptomyces clavuligerus) preferably clavuligerus ( streptomyces clavuligerus) NRRL3585.

Another object of the present invention is to provide a kind of method of ultraviolet mutagenesis mutant bacteria of clavuligerus.

An also purpose of the present invention is to provide a kind of Slreptomyces clavuligerus mutant lat:: Δ ( streptomyces clavuligeruslat:: Δ) bacterial strain is in the application of producing for the production of antibiotics bacterium.Described production of antibiotics bacterium object is for producing the enzyme resistant organism.

Slreptomyces clavuligerus mutant lat:: Δ ( streptomyces clavuligeruslat:: Δ) bacterial strain.This bacterial classification is on a kind of basis that is starting strain at the ultraviolet mutagenesis high productive mutant of acquisition, first by it latnucleotide fragments between 191st～1600 of gene displaces with one section general resistant gene of peace, then removes the general resistant gene of peace by gene Knockout, and acquisition does not contain any resistance marker latthe mutant strain of gene knockout.

Colony characteristics: ripe single colony growth is plentiful, and closely, bacterium colony is straw hat shape.Cultivate bacterium colony Surface Creation dull gray green spores after 3～5 days, be easy to scrape after the spore maturation for 28 ℃.

The mycelia feature: aerial hyphae is netted, white, and substrate mycelium to sallow, does not produce soluble pigment by pale yellow.

According to the present invention, described An Pu resistant gene is integrated in clavuligerus of the present invention latin gene. latintegration position in gene is in genomic any position, and only otherwise affect the biosynthesizing of bacterial strain itself, situation that can the high yield clavulanic acid, all within protection scope of the present invention.

The present invention is more detailed to be described as follows:

One, concrete technical support

(i) microbial name and preservation situation

Clavuligerus lat:: Δ bacterial strain.This bacterial classification at the preserving number at China Committee for Culture Collection of Microorganisms's common micro-organisms center is:, the preservation time.

(ii) the biological characteristics of bacterial strain and evaluation

1. clavuligerus lat:: the morphological feature of Δ bacterial strain

Colony characteristics: ripe single colony growth is plentiful, and closely, bacterium colony is straw hat shape.Cultivate bacterium colony Surface Creation dull gray green spores after 3～5 days, be easy to scrape after the spore maturation for 28 ℃.

The mycelia feature: aerial hyphae is netted, white, and substrate mycelium to sallow, does not produce soluble pigment by pale yellow.

According to " bacteriology complete works " (Qiu Weifan, bacteriology complete works of [M]. Beijing: Science Press, 1998:890) and " common and commonly used fungi " (Institute of Microorganism, Academia Sinica [M]. Beijing: Science Press, 1973), this bacterium feature conforms to the mould feature of branch top spore, and the utmost point is like the cephalosporium acremonium (Cephalosporium acremonium.) described in " common and commonly used fungi ".

2. clavuligerus lat:: Δ sequential analysis and qualification result

Sequencing result: connect product order-checking after transforming, by Beijing Hua Da Gene science sequencing fragment length, be about 500bp, sequencing result is as follows:

Sequence is submitted to the Gen-Bank database, carries out the BLAST comparison, and result shows that this bacterial strain 16S rDNA sequence and clavuligerus homology are 100%(-).Combining form is learned qualification result, and this bacterium is defined as to clavuligerus.

The present invention further discloses a kind of method for preparing the gene disruption mutant bacteria of arbitrary clavuligerus as above (Streptomyces clavuligerus), comprise the following steps:

(1) build latbe integrated with the recombinant plasmid pELA of the general resistance frame of peace in gene;

(2) will latbe integrated with the recombinant plasmid pELA transformed host cell of the general resistance frame of peace in gene, obtain transformant;

(3) build latthe recombinant plasmid pSCAR that gene inside is knocked;

(4) using clavuligerus B372 as acceptor, carry out conjugal transfer with the described transformant of step (2), obtain zygote, i.e. clavuligerus latthe gene disruption mutant bacteria s.clavuligeruslat::aac.

(5) by clavuligerus s.clavuligeruslat::aac, as acceptor, proceeds to recipient bacterium by the described recombinant plasmid pSCAR of step (3), obtains and not to contain any resistance marker latthe mutant strain of gene knockout s.clavuligeruslat:: Δ.

The described structure of step in the present invention (1) latbe integrated with the recombinant plasmid pELA of the general resistance frame of peace in gene for the lat gene generation homology double exchange with clavuligerus, thereby obtain latbe integrated with the genetic engineering bacterium of the clavuligerus of the general resistant gene of peace in gene.Wherein, in this recombinant shuttle vector, the carrier framework of described recombinant vectors is plasmid intestinal bacteria-streptomycete shuttle plasmid pGH112, clones to have in this carrier framework and has integrated the lat gene be blocked of pacifying general resistant gene.

The described mutagenic condition of step in the present invention (2) preferably adopts 15W or 30W ultraviolet ray, preheating in advance is after 20-30 minutes, spore suspension is placed in to distance ultraviolet ray 20-30cm place and carries out uv irradiating 30-45 seconds, the spore that preferably the mutagenesis object is clavuligerus.

The described structure of step in the present invention (3) latthe recombinant plasmid pSCAR that gene inside is knocked is pacified the mutant strain generation homology double exchange of general resistant gene displacement for the lat gene with clavuligerus, thereby obtains the genetic engineering bacterium of the clavuligerus of the non-resistant mark that the lat gene is knocked.Wherein, in this recombinant shuttle vector, the carrier framework of described recombinant vectors is plasmid intestinal bacteria-streptomycete shuttle plasmid pGH112, in this carrier framework, the clone has the lat gene that is knocked centre portion, only contains the lat constant gene segment C of upstream 230bp and downstream 170bp latconstant gene segment C.

Step in the present invention (1) and the described carrier of step (3) be intestinal bacteria-streptomycete shuttle plasmid pGH112 preferably.The described host cell of step (2) is intestinal bacteria, more preferably intestinal bacteria ET12567 preferably.The described acceptor of step (4) is clavuligerus preferably, more preferably clavuligerus ultraviolet mutagenesis clavulanic acid high productive mutant.The described acceptor of step (5) preferably latgene integration has the protoplastis of the clavuligerus mutant strain of the general resistant gene of peace.The better preparation condition of the protoplastis of the described clavuligerus of step (5) is for adopting the lysozyme concentration of 1mg/mL, enzymolysis 45min.The better conversion condition of the protoplastis of the described clavuligerus of step (5) is for adopting 25% PEG1000 mediated transformation, before transforming by the clavuligerus protoplastis in 45 ℃ of incubation 10min, with the activity of the Restriction Enzyme that reduces streptomycete.

Than prior art, the beneficial effect that the present invention has is as follows:

The present invention improves the output of the clavulanic acid of clavuligerus by ultraviolet mutagenesis and engineered means, at first obtained by ultraviolet mutagenesis the mutant strain that output is 1.9 times of original strains, take this mutant strain as starting strain, by homologous recombination, exchange to block it latgene, the product acid amount of the final engineering strain built is 2.3 times of original strain.The scheme that improves the clavulanic acid output of clavuligerus by genetic engineering means has occurred a lot, the means that the present invention adopts ultraviolet mutagenesis and genetically engineered to combine first, and adopt PCR-targeting to clavuligerus latgene suddenlys change, the engineering bacteria built through the present invention, and clavulanic acid output obviously improves, and product acid amount is more stable, and does not contain any resistance marker, easily for further genetic engineering modified.

The accompanying drawing explanation

Fig. 1 is that starting strain inhibition zone and mutant strain inhibition zone compare; In figure, 372,373,374 is the ultraviolet mutagenesis mutant strain, and B71 is starting strain;

Fig. 2 is fermented liquid HPLC color atlas; The retention time of clavulanic acid is 3.972 minutes;

Fig. 3 is s.clavuligeruslatthe PCR product of gene; M. 10kb Marker; 1. the PCR product of clavuligerus Methionin ε-aminotransferase gene;

Fig. 4 is the design of primers of the general resistance frame of peace;

Fig. 5 is the PCR product of the general resistance frame of peace; 1. A Bo draws the PCR product of resistance frame; M. 100bp Marker.

Fig. 6 is recombinant plasmid pGH112 – latchecking; M.1Kb .Marker; 1. ecoRi, bamHi double digestion pGH112 – latplasmid; 2. plasmid pGH112- latthe PCR product;

Fig. 7 is the building process schematic diagram of recombinant plasmid pELA;

Fig. 8 is the PCR checking of recombinant plasmid pELA; M.100bp Marker; 1,2,3, the 4. PCR product of plasmid pELA;

Fig. 9 is the estriction map of recombinant plasmid pSCAR;

Figure 10 is that the enzyme of recombinant plasmid pSCAR is cut checking; 1. hindthe III enzyme is cut pELA; 2. ecoRthe I enzyme is cut pELA; M.1kb Marker; 3. hindthe III enzyme is cut pSCAR; 4. ecoRthe I enzyme is cut pSCAR; 5. bamthe HI enzyme is cut pSCAR;

Figure 11 is pELA and chromosomal double exchange schematic diagram;

Figure 12 is the PCR checking of mutant strain; 1. mutant strain s.clavuligerus lat::aac pCR product 2. mutant strains s.clavuligerus lat:: Δthe PCR product; M1. 100bp Marker; M2. 10kb Marker; 3. starting strain s.clavuligerusthe PCR product of B372;

Figure 13 is the inhibition zone of mutant strain and original strain cephamycin C; 1 inhibition zone that is control strain, 2,3,4 are respectively the inhibition zone of three plant mutant bacterial strains;

Figure 14 is latnucleotide sequence after the gene PCR amplification;

Figure 15 is the nucleotide sequence after the general resistance frame pcr amplification of peace.

Embodiment

Below with embodiment, further illustrate the present invention, but the present invention is not limited.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer." room temperature " described in embodiment refers to the temperature of the operation room of being tested, and is generally 25 ℃.The raw material that the present invention is used or reagent except special instruction, equal commercially available obtaining.

embodiment 1

the ultraviolet mutagenesis of clavuligerus NRRL3585

Bacterial classification: clavuligerus NRRL3585( s.clavuligerusnRRL3585), culture presevation CPCC 600044; Klebsiella pneumonia ( klebsiella pneumoniae) ATCC 29665, culture presevation numbers 29665.

Main medium and solution: ISP substratum: ISP 8g, agar powder 20g, adjust pH to 7.3; TSB liquid nutrient medium (L ^-1): TSB 30g, starch 10g, pH6.8～7.0; SS liquid nutrient medium (L ^-1): analysis for soybean powder 15g, starch 4.7g, KH ₂pO ₄0.1g, FeSO ₄7H ₂o 0.2g, pH6.8.

Other conventional mediums and solution is all with reference to Pehanorm Brooker J, Ritchie EF not, Manny A Disi T. molecular cloning experiment guide [M], the third edition, Beijing: Science Press, 2002.

Method:

The preparation of spore suspension

(1) picking is cultured on the ISP solid medium s. clavuligerussingle bacterium colony transfer in the YMGA inclined-plane, cultivate 2～3d for 28 ℃, with large transfering loop, spore is scraped to the YMGA inclined-plane of transferring in the eggplant bottle, 28 ℃ of cultivation 5～7d.

(2) add the 40mL sterilized water in cultured eggplant bottle inclined-plane.

(3) with aseptic large transfering loop, firmly from light to heavy spore is scraped.

(4) thalline scraped is all proceeded to (containing granulated glass sphere) in aseptic triangular flask, thermal agitation 1min.

(5), by the syringe filtering that aseptic raw cotton is housed for above-mentioned spore suspension, gained filtrate is in the centrifugal 10min precipitation of 1000g spore.

(6) abandon supernatant, flick tube wall precipitation is scattered in the liquid remained on tube wall.

(7) add the aseptic glycerine of 2mL 20%, mix rapidly, be stored in-20 ℃.

(8) use front observation by light microscope, the blood counting chamber counting, suitably dilution makes spore concentration reach 10 ⁸individual/mL.As temporarily do not used, add 20% glycerine to mix rapidly rear-70 ℃ of Refrigerator stores.

Ultraviolet mutagenesis is processed

(1) by cultured s.clavuligerusthe spore inclined-plane prepares spore suspension.

(2) draw spore suspension 5mL in the aseptic flat board of 60mm, uv irradiating mutagenesis adopts 15W or 30W ultraviolet ray, and preheating in advance, after 20-30 minutes, is placed in distance ultraviolet ray 20-30cm place by spore suspension and carries out uv irradiating 30-45 seconds.

(3) get postradiation spore suspension 0.1mL and coat containing on the YMGA flat board of 12% glycerine, 28 ℃ of lucifuges are cultivated 7 days.Above operation is all carried out in darkroom.

The screening of mutant strain

1. agar block method primary dcreening operation

(1) picking is containing the single bacterium colony grown on 12% glycerine flat board, and point is connected on not glycerinated YMGA flat board, cultivates 2～4d for 28 ℃.

(2) forming plentiful aerial hyphae, but, before also not growing conidium, with the aseptic punch tool of 6～8mm, each bacterium colony is together being taken out together with certain thickness agar block, moving in empty aseptic plate.

(3) keep humidity to continue to cultivate, its microbiotic synthetic in growth and development process is limited in agar block.

(4) move to after the spore growth and maturity on the bioassay flat board again, rationally place the contrast bacterium colony simultaneously, the quantity of contrast bacterium colony accounts for 25% of total agar block.

(5) measure the antibacterial circle diameter of each agar block, the picking inhibition zone obviously is greater than the bacterium colony of contrast bacterium, is forwarded to inclined-plane, in order to further sieving again.

2. shaking flask is sieved again

(1) take a collarium with transfering loop from the inclined-plane of activation s.clavuligerusmycelium is connected to together with substratum in the 50mL triangular flask that 5mL ISP substratum is housed, and in 180r/min, cultivates 48h for 28 ℃.

(2) above-mentioned culture is transferred in the 250mL baffle flask that 50mL TSB substratum is housed, in 180r/min, cultivate 36h for 28 ℃.

(3) by cultured seed liquor by 5% inoculum size access fermentation flask, 500mL baffle flask liquid amount is 50mL, 180r/min, 28 ℃, incubation time is 72～120h.

(4) get different fermentations liquid in the EP pipe, the centrifugal 10min of 13200r/min, supernatant liquor, through 0.45 μ m membrane filtration, is measured its clavulanic acid content.

The mensuration of clavulanic acid

(1) chromatographic condition

Japan's Shimadzu high performance liquid chromatograph: LC-10AT pump, SCL-10A Controlling System;

Chromatographic column: Shim-pack VP-ODS (150 * 4.6), Shim-pack GVP (4.6mm) guard column;

Moving phase: potassium primary phosphate (0.1M)-6% methanol solution, phosphoric acid adjust pH to 3.2, filter through millipore filtration (0.45 μ m) before using;

Volumetric flow rate: 1.5mL/min;

Detect wavelength: 312nm;

Sample size: 10 μ L;

Column temperature: room temperature;

Detector: SPD-M10AE diode array;

The Class-VP chromatographic working station.

(2) measuring method

the drafting of working curve: the different dilution clavulanic acid standard specimens of accurate absorption and imidazoles solution mix in the ratio of 1:5, and 30 ℃ of reaction 12min, be cooled to rapidly 20 ℃, makes derivative standard specimen.Precision measures each derivative standard specimen 10 μ L sample introductions, take peak area as ordinate zou, and concentration is X-coordinate drawing standard curve.

2. the mensuration of fermented liquid: will process the secondary fermentation sample and be derived by the method in the drafting of typical curve, precision measures 10 μ L sample introductions, measures clavulanic acid content.

The fermentation culture of clavuligerus

Clavuligerus is rule on ISP solid plate separation, after 28 ℃ of cultivation 3-5d, picking list colony inoculation is in 5mL liquid ISP substratum, 200r/min, cultivate 24h for 28 ℃, by 1%(v/v) inoculum size is forwarded in liquid TSB seed culture, adopt the 250mL baffle flask, liquid amount 25mL/ bottle, 28 ℃, 150r/min cultivates 24h, by 10%(v/v) inoculum size is forwarded to the SS fermention medium and cultivated, adopt the 500mL baffle flask, liquid amount is the 50mL/ bottle, fermentation condition is: 28 ℃, 150r/min, ferment to 72h, when 96h and 120h, sample, sample is through the centrifugal 10min of 13200r/min, supernatant liquor is as detecting sample.

The genetic stability of Slreptomyces clavuligerus mutant B372 is investigated:

Slreptomyces clavuligerus mutant B372 is carried out to continuous four switchings and go down to posterity, after shake flask fermentation, the HPLC method is measured tiring of clavulanic acid.Result: the primary dcreening operation of ultraviolet mutagenesis mutant strain the results are shown in Table 1 and Fig. 1.

Table 1 primary dcreening operation statistics

As can be seen from Table 1, in the mutant strain containing growing in the YMGA flat board of 12% glycerine, the output of most mutant strains, all in varying degrees higher than starting strain, only has 11% for negative sudden change.There is the output of 20% mutant strain to improve more than 50% than starting strain, wherein have the output of 10 strains to improve 1 times than starting strain, account for 1.7%.Explanation is usingd glycerine and can effectively be improved the screening rate of positive mutating strain as selective pressure.From than the glycerine tolerance mutant strain of starting strain raising more than 50%, choosing 37 strains, carrying out slant culture, prepare shaking flask and sieve again.

Shaking flask is sieved result again: the glycerine tolerance mutant strain of primary dcreening operation gained is transferred respectively in 5mL ISP, and 180r/min, cultivate 48h for 28 ℃, and the HPLC method is measured its clavulanic acid content, the results are shown in Figure 2.The potency ratio starting strain that finds that there is clavulanic acid in its fermented liquid of strain glycerine tolerance mutant strain has improved more than 80%.

The genetic stability of Slreptomyces clavuligerus mutant B372 is investigated and be the results are shown in Table 2, as shown in Table 2, mutant strain B732 go down to posterity within 4 times produce the acid amount and the glycerine dosis tolerata more stable, continue to go down to posterity, the product of bacterial classification acid amount and glycerine dosis tolerata thereof all obviously descend, so should control passage number within 4 generations as far as possible.

Table 2 s.clavuligerusthe genetic stability of B732

embodiment 2

the pcr amplification of clavuligerus lat gene

Bacterial classification: clavuligerus ultraviolet mutagenesis mutant strain B372, (in embodiment 1, build and obtain bacterial classification) preserved in this laboratory.

Main medium and solution: ISP, YMGA substratum reference example 1.

Other conventional mediums and solution is all with reference to Pehanorm Brooker J, Ritchie EF not, Manny A Disi T. molecular cloning experiment guide [M], the third edition, Beijing: Science Press, 2002.

Method:

The extraction of clavuligerus genomic dna:

(1) on picking solid YMGA flat board s.clavuligerusthe mono-colony inoculation of B372 is in liquid ISP substratum, and 28 ℃, 200r/min cultivates 2d, the centrifugal 5min results of 2000r/min thalline.

(2) wash once with the EDTA of 10mM pH8.0, or wash twice with water, the gained thalline is stored in-20 ℃.

(3) add SET solution to 1mL, and add 50mg/mL N,O-Diacetylmuramidase 20 μ L, 37 ℃ of water-bath 30-60min.

(4) add the Proteinase K 28 μ L of 20mg/mL to mix.

(5) add 120 μ L 10%SDS, upset mixes, and 55 ℃ of temperature are bathed 2h, are sub-packed in two centrifuge tubes.

(6) add respectively 500 μ L phenol/chloroforms, fierce concussion 20min fully mixes.

(7) the centrifugal 15min of 6500r/min, carefully draw supernatant liquor in another centrifuge tube.

(8), if albumen precipitation is incomplete, can repeat (6), (7) two steps.

(9) add the dehydrated alcohol of 0.6 μ L ice, upset fully mixes, standing 3min.

(10) if the more available sample loading gun of centrifugation DNA(karyomit(e) choose in another centrifuge tube).

(11) with the ice dehydrated alcohol of 0.5mL, wash once.

(12) gained DNA places 10min in room temperature, makes it dry.

(13) dried DNA is dissolved in 20 μ L TE damping fluids (or soluble in water, solution usage depending on the dyeing scale of construction the number), be stored in-20 ℃.

latthe pcr amplification of gene

With reference to clavuligerus coding Methionin ε-transaminase latthe corresponding nucleotide sequence of gene, following primer (primer entrusts Shanghai biotechnology company limited to synthesize) is synthesized in design, will amplify in theory the fragment (nucleotide sequence is as shown in SEQ ID NO:1) of 1771bp.

Primer 1:5 '-GAATTCCCATAATTCAGCCTGATCCCCCAGGAGTTCTCA-3 '

Primer 2: 5 '-GGATCCAGCGCGTCCTTCACAGCGGTGTACTCCCGCCCGTCGACG-3 '

Wherein in primer 1 and primer 2, the line part is respectively ecorI and bamthe HI restriction enzyme site, the genomic dna of clavuligerus of said extracted of take is template, latthe upstream and downstream primer of gene (primer 1 and primer 2) carries out pcr amplification, annealing temperature n=61 ℃.Result has obtained the fragment (Fig. 3) of 1.8kb, with theoretical value, conforms to.

embodiment 3

pacify the pcr amplification of general resistance frame

Bacterial classification: clavuligerus ultraviolet mutagenesis mutant strain B372 builds in embodiment 1.

Plasmid: containing the plasmid pIJ773 of the general resistant gene of peace, purchased from Chinese plasmid vector strain cell pnca gene preservation center.

Method:

According in clavuligerus latin the sequence of gene and plasmid pIJ773, the sequence of the general resistant gene of peace (also comprises the transfer replication starting point in this sequence oriTand the recognition site FRT sequence of FLP recombinase, oriTbe convenient to the conjugal transfer of back recombinant plasmid) design the primer of a pair of long 59nt and 58nt, two primers contain respectively 20nt and 19nt the general resistant gene of peace both sides the FRT sequence complementary sequence and latthe complementary sequence (Fig. 4) of two sections 39nt of gene upstream and downstream;

Two primer sequences are as follows:

Primer:

3：5’CCATAATTCAGCCTGATCCCCCAGGAGTT

CTCACCCATGATTCCGGGGATCCGTCGACC-3’ ；

Primer:

4：5’TGTAGGCTGGAGCTGCTTCGACCGCTCGT

CACAGTGCGGCCAGCGGCTCTCGCAGACT-3’；

By comprising a general resistant gene of peace in this primer PCR products therefrom, and contain each at its two ends with 39bp's latthe homologous sequence of gene upstream and downstream, theoretical size is 1.45kb, and this PCR product is called to the general resistance frame of peace.

Using contain pacify general resistant gene plasmid pIJ773 as template, primer 3 and primer 4 carry out pcr amplification, annealing temperature n=50 ℃ has obtained the general resistance frame of the peace fragment (Fig. 5) of 1.45kb, (nucleotide sequence is as shown in SEQ ID NO:2) conforms to theoretical value.

embodiment 4

latinsert the structure of the recombinant plasmid pELA of the general resistance frame of peace in gene

Bacterial classification: bacillus coli DH 5 alpha, purchased from Shanghai Sheng Gong Bioisystech Co., Ltd; Intestinal bacteria BW25113/pIJ790(pIJ790 plasmid be one contain λ RED ( gam, bet, exo) the temperature sensitive type plasmid of function on, λ RED function on can greatly improve the recombination fraction of linear DNA), reference Gust B, Kieser T, Chater KF (2002). PCR targeting system in Streptomyces coelicolor A3 (2). (John Innes Centre, Norwich Research Park).

Plasmid: pGH112, intestinal bacteria-streptomycete shuttle plasmid, have ampicillin resistance gene ( amp) and the thiostrepton resistant gene ( tsr), wherein the thiostrepton resistant gene all can be expressed in intestinal bacteria and streptomycete.

The conventional mediums such as main medium and solution: LB, SOB, SOC and solution is all with reference to Pehanorm Brooker J, Ritchie EF not, Manny A Disi T. molecular cloning experiment guide [M], the third edition, Beijing: Science Press, 2002.

Method:

Recombinant plasmid pGH112- latstructure

Above-mentioned PCR is obtained latgene fragment is through UNIQ-10 pillar PCR product purification test kit (work is given birth in Shanghai) purifying, and purified product is used ecoRi and bamHthe I double digestion, is connected with intestinal bacteria through same double digestion-streptomycete shuttle vector pGH112, adopts the T4DNA ligase enzyme to connect 12h in 16 ℃ of constant temperature, and the connection product of gained is for conversion e.colidH5 α competent cell.

The preparation of intestinal bacteria electricity conversion competent cell

(1) connect the single bacterium colony of intestinal bacteria in the LB substratum, 37 ℃, the 180r/min overnight incubation.

(2) by culture with 1%(v/v) inoculum size is inoculated in another and is equipped with in 100mL LB substratum, 37 ℃, 180r/min cultivates 2h～3h, makes cell reach logarithmic phase (A ₆₀₀=0.6).

(3) triangular flask is transferred to and placed 20min on ice, 4 ℃ of centrifugal 15min of 3000r/min are with collecting cell.

(4) abandon supernatant, with 10% aqueous glycerin solution washed cell 3 times, 4 ℃ of centrifugal 15min collecting cells of 3000r/min.

(5) by cell suspension in the glycerine of about 300L 10%, by the aseptic centrifuge tube that installs to precooling in every part of 40L minute and rapid quick freezing in liquid nitrogen, then be placed in-80 ℃ of preservations.

Colibacillary electric shock transforms

(1) while using, competent cell is placed on ice and melts, simultaneously by electric revolving cup precooling.

(2) add the above-mentioned connection product of 2L, be added in cold revolving cup after mixing, touch liquid and be positioned at electric revolving cup bottom to guarantee bacterium and DNA suspension.

(3) start the electricimpulse to cell, add 1mL SOC nutrient solution under room temperature.Proceed to after mixing in the 1.5mL centrifuge tube, in 37 ℃, cultivate 1h.

(4) by the 100L flat board, be applied to containing appropriate corresponding antibiotic LB solid flat. on plate, be inverted overnight incubation (16h-20h) for 37 ℃, extract the plasmid identification transformant.

The a small amount of of plasmid preparation in intestinal bacteria:

(1) get the single bacterium colony line of intestinal bacteria and be located away from LB solid medium (containing corresponding microbiotic) flat board, be inverted overnight incubation for 37 ℃.

(2) picking list bacterium colony is in 2mL LB liquid nutrient medium, and 37 ℃, the 180r/min overnight incubation.

(3) 1.5mL bacterium liquid is proceeded in Eppendorf tube, the centrifugal 30s of 12000r/min collects thalline, abandons supernatant.

(4) precipitation is resuspended in the solution I of 100 μ L precoolings, mixes.

(5) solution II that adds 200 μ L newly to join, cover tightly the mouth of pipe, shakes up gently, guarantees that the whole internal surface bacterium of centrifuge tube contacts with solution II, centrifuge tube placed to 1min-2min is limpid to liquid on ice.

(6) add the solution III of 150 μ L precoolings, gentle rotation centrifuge tube mixes solution III, ice bath 3min-5min in the bacterial lysate of thickness.

(7) the centrifugal 5min of 12000r/min, transfer to supernatant in another pipe, and add the saturated phenol/chloroform of isopyknic Tris/primary isoamyl alcohol (25: 24: 1) and mix, the centrifugal 5min of 12000r/min, then supernatant is transferred in another centrifuge tube.

(8) add the dehydrated alcohol of 2-2.5 times of volume, mix, ice bath (or-20 ℃) is placed 30min.The centrifugal 5min collecting precipitation of 12000r/min.

(9) precipitate 2-3 time by 70% washing with alcohol, discard raffinate, air drying 10min-20min, with the aseptic ddH of 20L ₂the O dissolution precipitation.

Result: the plasmid that extraction is obtained carries out the restriction enzyme digestion and electrophoresis evaluation, and result is as Fig. 6.With bamhI+ ecothe RI double digestion has obtained Insert Fragment band approximately l.8kb and the carrier ribbon of about 6.5kb.Enzyme is cut result and is conformed to theory, proves that plasmid is correct, called after pGH112.

PCR-targeting construction recombination plasmid pELA

The correct recombinant plasmid pGH112 – by above-mentioned checking latelectricity goes to ecoliin the BW25113/pIJ790 competence, containing paraxin (Cml ²⁵) and penbritin (Amp ¹⁰⁰) the LB solid medium in 30 ℃ cultivate 20h and screened.Picking e.colibW25113/pIJ790/pGH112- lattransformant, containing penbritin (Amp ¹⁰⁰), apramycin (Apr ²⁵) and the LB liquid nutrient medium of L-arabinose (final concentration is 10mmol/L) in 30 ℃ of cultivations e.colibW25113/pIJ790/pGH112- lattransformant is to OD ₆₀₀≈ 0.6, is made into competent cell.By pGH112- latproceed to e.coliafter in the BW25113/pIJ790 bacterial strain.

By in embodiment 3, obtain with latthe PCR product of DNA homolog sequence is pacified general resistance frame electricity and is converted into e.colibW25113/pIJ790/pGH112- latin competent cell, the culture temperature that electricity is turned to rear bacterial strain is brought up to 37 ℃ by 30 ℃, is containing Apr ²⁵resistant panel on overnight incubation. e.colibW25113/ pIJ790/pGH112- latsubstratum in add the expression that L-arabinose can be induced λ RED in pIJ790, under the effect of λ RED function on, pacify general resistance frame promptly with recombinant plasmid pGH112- lathomologous recombination occurs, and pacifies general resistance frame two ends lathomologous sequence and pGH112- latentrained latgene generation homology double exchange (Fig. 7), thus make latinserted and contained in gene aac (3) ivthe general resistance frame of the peace of gene, obtained one latgene is inserted into the recombinant plasmid of sudden change.Due to replication initiation and the chloramphenicol resistance gene that contain a temperature sensitive type in the pIJ790 plasmid, when the culture temperature of bacterial strain after electricity turns is brought up to 37 ℃ and no longer to after adding the Cml microbiotic in substratum by 30 ℃, the replicon of pIJ790 plasmid is no longer transcribed and is not being had under antibiotic selective pressure, and it has just lost the ability of self-replacation gradually.So in recon, only contain a kind of with latthe recombinant plasmid of mutator gene, picking clone also extracts plasmid and carries out the PCR checking.

Result: take the above-mentioned plasmid that extracted as template, with the primer 3 in embodiment 3, primer 4, carry out the PCR checking, the results are shown in Figure 8, as seen from the figure, PCR product size is (arrow indication in figure) at the 1.45kb place, with the general resistance frame size of peace, conforms to.Show to pacify general resistance frame and successfully be incorporated into pGH112- lat's latin gene, by this latinsert the recombinant plasmid called after pELA of the general resistant gene of peace in gene.

embodiment 5

latthe structure of the recombinant plasmid pSCAR that gene inside is knocked

Bacterial classification: bacillus coli DH 5 alpha/BT340, BT340 is the temperature sensitive type plasmid, with chlorampenicol resistant (Cml ²⁵), under 42 ℃ of high temperature inductions, plasmid BT340 can express the FLP recombinase, and the FLP recombinase can specific identification FRT sequence and is cut.

Main medium and solution: reference example 5.

Method:

The FRT sequence is contained, the recognition site that this sequence is the FLP recombinase in the two ends that will contain the recombinant plasmid pELA(resistance frame of pacifying general resistance frame) electricity goes to e.coliin DH5 α/BT340, BT340 is the temperature sensitive type plasmid, with chlorampenicol resistant (Cml ²⁵), therefore e.colithe preparation of the competent cell of DH5 α/BT340 and culturing process temperature all are controlled at lower 30 ℃.

Under 42 ℃ of high temperature inductions, plasmid BT340 can express the FLP recombinase, and the FLP recombinase can be identified the FRT sequence (Fig. 3) of peace general resistance frame both sides in plasmid pELA, and the resistant gene between FRT is knocked out, and in this process, plasmid BT340 disappears automatically, former afterwards latthe part of gene insertion resistant gene is the scar sequence of remaining 81bp (the FRT sequence is remaining partial sequence after the excision of FLP enzyme) only, and gained is latrecombinant plasmid pSCAR(Fig. 9 that gene inside is knocked), the general resistance frame of peace that the pELA that its size should be 8.27kb removes 1.29kb(1449bp deducts two 39nt's latthe scar sequence of DNA homolog sequence and 81bp) the general resistant gene sequence of peace, i.e. 6.98kb.The transformant grown is successively put and be connected to the LB flat board that contains respectively appropriate amounts of ammonia penicillin G and apramycin, the transformant of not growing to growing, i.e. Amp on ammonia benzyl resistant panel on the apramycin resistant panel with aseptic toothpick ^rand Apr ^stransformant, carry out upgrading grain and enzyme and cut checking,

Result: by Amp ^rand Apr ^stransformant carry out the upgrading grain and enzyme is cut checking, the results are shown in Figure 10, electrophoresis result and its theoretical value size match as seen from the figure, gained latthe recombinant plasmid called after pSCAR that gene inside is knocked.

embodiment 6

clavuligerus and colibacillary conjugal transfer

Bacterial classification: intestinal bacteria ET12567/pUZ8002; Clavuligerus B372, build in embodiment 1.

Plasmid: pELA, build in embodiment 4.

Main medium and solution: 2 * YT (L ^-1): peptone 16g, yeast extract 10g, NaCl ₂5g.AS-1 (L ^-1): yeast extract 1g, ALANINE 0.2g, L-arginine 0.2g, L-asparagine 0.5g, Zulkovsky starch 5g, NaCl ₂2.5g, Na ₂sO4 10g, agar powder 20g; Adjust pH to 7.5.

Other conventional mediums and solution is all with reference to Pehanorm Brooker J, Ritchie EF not, Manny A Disi T. molecular cloning experiment guide [M], the third edition, Beijing: Science Press, 2002.

Method:

(1) get the mono-bacterium colony of intestinal bacteria ET12567/PUZ8002 and be linked into LB liquid nutrient medium (containing 50g/mL Kan and 25g/mL Chl), in 37 ℃, the 180r/min overnight incubation.

(2) recombinant plasmid pELA is converted in intestinal bacteria ET12567/PUZ8002, makes and there is Kan ⁵⁰/ Chl ²⁵/ Apr ²⁵the sub-intestinal bacteria ET12567/PUZ8002/ of the clone of three kinds of resistances pELA.

(3) above-mentioned clone's of picking is respectively in 10mL LB liquid nutrient medium (containing 50g/mL Kan, 25g/mL Chl and 25g/mLApr), overnight incubation under 37 ℃ of 180r/min conditions.

(4) by the 0.1mL inoculum size, the thalline of above-mentioned overnight incubation is transferred and contained in above-mentioned three kinds of antibiotic LB in 10mL, cultivate about 4h and make its A600 reach 0.4～0.6 under 37 ℃ of 180r/min conditions.

(5) wash above-mentioned thalline with 10mL LB substratum, centrifugal condition 4000r/min * 5min, and be resuspended in 1mL LB liquid nutrient medium.

(6) getting 10L concentration is 10 ⁸the clavuligerus spore suspension of individual/mL is in 500L 2 * YT substratum, and 50 ℃ of thermal shock 10min make its sprouting, cooling.

(7) get 0.5mL e. coliwith the spore suspension after the 0.5mL thermal shock, mix fast, the centrifugal supernatant that goes, be resuspended in precipitation in remaining approximately 50 μ L liquid.

(8) above-mentioned precipitation is diluted to 10 successively with sterilized water ^-1～10 ^-4doubly, and by the 100L glue spread coat not containing antibiotic AS-1+10mMMgCl ₂flat board, 30 ℃ of constant temperature culture 30h.

(9) aqueous solution that contains 0.5mg nalidixic acid and 1.25mgApr with 1mL covers above-mentioned flat board, and available spreader covers evenly it, continues at 30 ℃ of constant temperature culture.

(10) by single bacterium colony of growing respectively photocopy in containing and not containing the DNA of 50g/mL Kan dull and stereotyped (containing 25g/mL nalidixic acid and 50g/mLApr), screening Kan ^sand Apr ^rthe double cross conjugant.

(11) the above-mentioned double cross conjugant filtered out is detected and lines YMGA(containing 25g/mL nalidixic acid and 50g/mL Apr) flat board.

Because the two ends of the general resistance frame of peace in recombinant plasmid pELA are contained latthe homologous sequence of gene, thus by recombinant plasmid pELA conjugal transfer to after in clavuligerus, in plasmid latwild-type in the homologous sequence of gene and clavuligerus latdouble exchange will occur in gene, make the wild-type in the clavuligerus genome latgene is replaced (Figure 11) by the general resistance frame of peace, has realized in clavuligerus latthe double exchange sudden change of gene.

The above-mentioned transformant filtered out is seeded on the YMGA flat board containing nalidixic acid and apramycin with transfering loop, cultivate 3-5 days for 28 ℃, until spore occurs, collect spore, spore is not being contained on antibiotic YMGA substratum to the cultivation that relaxes, and on this substratum, go down to posterity three times, the bacterial strain that still has resistance tentatively is defined as having occurred the bacterial strain of double exchange.Respectively with genome and the starting strain of streptomycete mutant strain to be verified s.clavuligerusthe genome of B372 is masterplate, latthe upstream and downstream primer of gene carries out the PCR checking, checks in bar-shaped streptomyces gene group DNA latwhether be inserted into and contained in gene aac (3) ivthe general resistance frame of the peace of gene. s.clavuligerus lat::aacthe lat gene in 191～1600bp by the general resistant gene of peace of 1.45kb, replaced, so the theoretical size of PCR product should be 1.85kb,

Result: the PCR the result is shown in Figure 12, as shown in Figure 12, the genome of mutant strain of take can obtain the specific fragment that a size is about 1.85kb by PCR as masterplate, with theoretical value, match, be 1.8kb and take the PCR product of the control strain that the genomic dna of starting strain is template, show that recombinant plasmid pELA is inserted into clavuligerus by the homology double exchange latin gene, by this mutant strain called after s.clavuligeruslat::aac.

embodiment 7

s.clavuligerusin lat::aac, resistant gene knocks out

Bacterial classification: clavuligerus lat::aac, build in embodiment 6.

Plasmid: pSCAR, build in embodiment 6.

Main medium and solution: R2YE substratum, P-buffer, T-buffer be all with reference to Kieser T, Chater K, Bibb MJ, Buttner MJ, Hopwood DA. Practical streptomycesgenetics[M]. (John Innes Foundation, Norwich, U.K.) (2000).; Other solution commonly used are with reference to Pehanorm Brooker J, Ritchie EF not, Manny A Disi T. molecular cloning experiment guide [M], the third edition, Beijing: Science Press, 2002.

Method:

The preparation of clavuligerus protoplastis

Due to recombinant plasmid pGH112- latin pacified the process that general resistance frame knocks out, pacify and there is the conjugal transfer function in general resistance frame orithe T gene also is knocked simultaneously, so the plasmid of the recombinant plasmid pSCAR obtained for not having the conjugal transfer function must proceed in clavuligerus by the method for protoplast transformation.Therefore, the protoplastis for preparing at first as follows clavuligerus.

(1) press 0.1mL inoculum size access clavuligerus spore suspension in the YEME substratum, 30 ℃ of 150r/min cultivate 34h.

(2) centrifugal in 4 ℃ of 1000g * 10min, abandon supernatant.

(3) precipitation is resuspended in the sucrose solution of 15mL 10.3%, 4 ℃, 1000g * 10min is centrifugal, carefully abandons supernatant liquor, repeats this step once.

(4) thalline is dissolved in the P-buffer solution of 4mL 1mg/mL N,O-Diacetylmuramidase to 30 ℃ of incubation 15min.

(5) with transfer pipet pressure-vaccum 3 times, and incubation 15min again.

(6) add 5mL P-buffer in above-mentioned system, and repeating step (5).

(7) with the spore filtration unit, aforesaid liquid is filtered, and by filtrate collection in centrifuge tube.

(8) 1000g * 7min centrifugation protoplastis.

(9) P-buffer washing 2 times for the gained protoplastis all adopts 4 ℃ at every turn, 1000g * 7min precipitation.

(10) abandon supernatant, precipitation is resuspended in 1mL P-buffer.

Plasmid Transformation clavuligerus protoplastis:

(1) by protoplastis suspension (10 ¹⁰individual/mL) be sub-packed in aseptic little EP pipe, 50 μ L/ pipes, by the clavuligerus protoplastis before conversion in 45 ℃ of incubation 10min, reduce the activity of the Restriction Enzyme of streptomycete, make foreign DNA exempt from the restriction enzyme degraded and be easier to proceed in streptomycete.

(2) add 5 μ L plasmid DNA solutions, pat tube wall and mix rapidly.

(3) add the T-buffer of 200 μ L containing 25%PEG1000, pressure-vaccum mixes for four times repeatedly, draws 100～200 μ L conversion fluids and coats on the R2YE flat board of two dryings, if need dilution to be diluted with P-buffer.

After (4) 30 ℃ of cultivation 36h grow small clone's, with containing 8 μ g/mL thiostreptons, (pacifying general resistance frame and be knocked the entrained thiostrepton resistant gene of rear employing recombinant plasmid pSCAR tsrscreened) nutrient agar medium cover each and transform dull and stereotypedly, continue at 30 ℃ and cultivate 3 days.With aseptic toothpick picking transformant, in not containing antibiotic YMGA flat board, cultivate after 3～4 days for 30 ℃, by the bacterium colony that grows respectively at containing thiostrepton (Thio ⁸) nutrient agar plate and contain apramycin (Apr ²⁵) nutrient agar plate on photocopy appropriate, to two kinds of microbiotic all responsive bacterium colony can tentatively predicate latthe mutant strain that in gene, resistant gene is knocked.

The checking of transformant:

To gained Apr ^sand Thio ^sthe method that mutant strain is pressed in above-described embodiment 2 is extracted genomic dna as template, and with starting strain s.clavuligerusthe genomic dna of B372 is template in contrast, described in embodiment 1 latgene upstream and downstream primer carries out the PCR checking, s.clavuligerusb372's latgene is not undergone mutation, so PCR product theoretical value should be 1.8kb, s.clavuligerus lat::aac's lat191～1600bp in gene is replaced by the general resistant gene of peace of 1.45kb, so the theoretical size of PCR product should be 1.85kb, and the theoretical size of the PCR product of the mutant strain that resistance marker is knocked should be the 39bp distance that 481bp(pacifies general resistance frame both sides latthe upstream and downstream of gene is respectively 230bp and 170bp, and the scar sequence of 81bp).

Result: the result of transformant is shown in Figure 12.

The PCR product size that the mutant strain genome that the resistance marker of take as shown in Figure 12 is knocked is template is between 400bp-500bp, and with theoretical value, 481bp is consistent, and the genomic PCR product of control strain is 1.8kb, with latthe genomic dna of Gene Double exchange mutant strain is 1.85kb as the PCR product of template, proves latresistant gene in gene is knocked, and the resistance marker of gained is knocked latthe transgenation bacterial strain, called after s.clavuligeruslat:: Δ.

embodiment 8

the mensuration of clavuligerus cephamycin C and clavulanic acid output

Bacterial classification: intestinal bacteria ESS, cephamycin C biological activity indicator, University of Alberta: Alberta, Canada S.E. professor Jensen provides.Clavuligerus B372, build in embodiment 1; Clavuligerus lat:: Δ, culture presevation number.

Main medium and solution: ISP substratum, TSB liquid nutrient medium, SS liquid nutrient medium are with reference to above-described embodiment 1.

Method:

The assay of cephamycin C and clavulanic acid in the clavuligerus fermented liquid

To mutant strain lat:: Δ and starting strain control strain carry out fermentation culture, fermentation culture method reference example 1.The fermented liquid of getting the different fermentations time carries out the mensuration of cephamycin C and clavulanic acid content.

Wherein in fermented liquid, the mensuration of cephamycin C adopts biological process, with e.colieSS is indicator, measures the relative height of cephamycin C output.Add the TSB substratum 15mL containing appropriate bacteria suspension in the culture dish of diameter 90mm, after solidifying, the aseptic filter paper sheet is attached in the flat board prepared, every plate is put four.With accurate each fermented liquid 3 μ L that draw of sample loading gun, on filter paper, treat that the scraps of paper are slightly dry to be placed on the diameter that 37 ℃ of incubator overnight incubation are measured each dosage inhibition zone.

In fermented liquid, the mensuration of clavulanic acid content adopts HPLC method, concrete grammar reference example 1.

Result: see Figure 13 and table 2.Under same culture condition, the cephamycin C output of mutant strain obviously descends than original strain, shows as shown in Figure 13 latthe biosynthesizing of the inhibition from mutation cephamycin C of gene.

As shown in Table 3, same fermented liquid is measured to the output of its clavulanic acid, the clavulanic acid output of mutant strain reaches as high as 650.15 mg/L as a result, improved 22% than control strain, show the blocking-up of clavuligerus mutant strain cephamycin C metabolism branch road, effectively improved the output of clavuligerus clavulanic acid.

The HPLC measurement result of clavulanic acid output in table 3 mutant strain and original strain fermented liquid

Bacterial strain	Fermentation 96h (mg/L)	The multiple that mutant strain is original strain
			W	532.91	1.00
M-1	635.87	1.19
			M-2	650.15	1.22
M-3	618.71	1.16
			M-4	598.99	1.12

Annotate: W represents original control strain, and M represents mutant strain.

The resistance problem of the bacterium caused due to antibiotic a large amount of uses to a lot of medicines, oneself becomes a thorny problem for the treatment of clinically bacteriosis.According to China bacterial resistance monitoring center, not only some old microbiotic are planted penicillin as some and have been approached inefficacy, be used in the new antibiotic that clinical time is not long, as xacin-series and cephalosporin, for the resistance of some common bacteria, also reached astonishing degree.The resistance of pathogenic bacteria to β-lactam antibitics, become one of important factor of intractable infection clinically.The beta-lactamase inhibitors such as clavulanic acid combine to use for killing the resistant organism that produces β-lactamase with β-lactam antibitics good effect: both suppressed the activity of β-lactamase, strengthened again the antibiotic broad-spectrum antibacterial action of this class.

Yet, the raw material major part of the clavulanic acid that China is used at present is all to derive from import, major cause is because the level of domestic transformation and bacterium is more backward, the superior strain do not had can be applied to produce, therefore research and develop clavulanic acid and produce bacterium, improve clavulanic acid output, reduce production costs, boundless market outlook are arranged.

Bacterial strain is selected in this research streptomyces clavuligerusnRRL3585 is the research starting strain, by technology such as traditional selection by mutation, molecular biology, bacterial strain is transformed, thereby the pathways metabolism of bacterial strain is changed, clavulanic acid output obviously improves, for the different levels transformation of this class production of antibiotics bacterium of streptomycete provides theoretical foundation, there is certain scientific value and actual application value.

SEQUENCE LISTING

<110 > Tianjin Normal University

<120 > engineering strain of a kind of clavuligerus and preparation method thereof and application

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1771

<212> DNA

<213 > lat gene

<400> 1

ccataattca gcctgatccc ccaggagttc tcacccatgg gcgaagcagc acgccacccc 60

gacggcgatt tctcggacgt gggaaacctc cacgctcagg acgtgcacca ggcacttgag 120

cagcatatgc tcgtcgacgg gtacgacctc gttctcgacc tcgacgccag ctccggcgtc 180

tggctcgtcg acgccgtcac ccagaagcgg tatctcgacc tcttttcctt ctttgcctcg 240

gcgccgctcg gaatcaaccc gcccagcatt gtcgaggacc cggcattcat gcgggagctg 300

gccgtggccg cggtcaacaa gccgtcgaac cccgatcttt attcggtgcc gtacgcccgt 360

ttcgtcaaga ccttcgcccg ggtcctcggc gacccccggc tgcggcggct gttcttcgtg 420

gacggcgggg cgctggccgt ggagaacgcg ctcaaggcgg ccctcgactg gaaggcccag 480

aagctgggcc tcgccgagcc ggacaccgac cggctccagg tgctgcatct ggagcgctcg 540

ttccacggcc gcagcggcta caccatgtcg ctgacgaaca ccgagccgtc caagaccgcc 600

cgcttcccca agttcggctg gccacggatc tcgtcccccg ccctccagca cccgccggcc 660

gagcacaccg gcgccaacca ggaggccgag cgacgggcgc tggaggccgc ccgggaggcg 720

ttcgcagcgg cggacggcat gatcgcctgc ttcatcgcgg agcccatcca gggcgagggc 780

ggcgacaacc acctcagcgc ggagttcctc caggccatgc agcggctctg ccacgagaac 840

gacgccctgt tcgtcctgga cgaggtgcag agcggctgcg gcatcaccgg taccgcctgg 900

gcctaccagc agctcggcct ccagcccgac ctggtggcct tcggcaagaa gacccaggtc 960

tgcggggtga tgggcggcgg ccggatcgac gaggtccccg agaacgtctt cgccgtctcc 1020

tcccggatca gctccacctg gggcggcaac ctcgccgaca tggtccgcgc cacccggctg 1080

ctggagacga tcgagcgcac ccaggtcttc gacaccgtcg tccagcgcgg caagtacttc 1140

cgggacggcc tggaggacct ggccgcccgc cacccctccg tcgtgaccaa cgcccgcggc 1200

cggggcctga tgtgcgcggt cgacctgccg gacacccgga cccgcaatga ggtgctgcgg 1260

ctcatgtaca cggagcacca ggtcatcgcc ctgccctgcg gcgggcgcag cctccggttc 1320

cgccccgcgc tgacgatcgc ggagcacgag atcgaccagg cccttcaggc gctggcgagc 1380

agtgtcacgc cggtcgccga gagcgtctga cgcccggccg gccgggtgcc ccagcggggc 1440

ccggccggcc gcaccgcgga acggaacacc cctggcgcgt cgcccggtga cacgctctcc 1500

gggcggctca accgcgccac ccccacggca cgttcgcctt cacccgcacg gagagcccac 1560

gaatgatgtc agcacggtac ccgaggaccg cagcggagtg gaccactcgc attcaaggag 1620

tgtcgagcga gcgttgcgat cttgaaatgc tgctgaagga cgagtggcgc aacaggatcg 1680

cggtacggga cgacgacccc ggtgtccgtg cgacgaggca gcgggacatc gtcgtcgacg 1740

ggcgggagta caccgctctg aaggacgcgc t 1771

<210> 2

<211> 1457

<212> DNA

<213 > pacify general resistance frame gene

<400> 2

ccataattca gcctgatccc ccaggagttc tcacccatgt gtaggctgga gctgcttcga 60

agttcctata ctttctagag aataggaact tcggaatagg aacttatgag ctcagccaat 120

cgactggcga gcggcatcgc attcttcgca tcccgcctct ggcggatgca ggaagatcaa 180

cggatctcgg cccagttgac ccagggctgt cgccacaatg tcgcgggagc ggatcaaccg 240

agcaaaggca tgaccgactg gaccttcctt ctgaaggctc ttctccttga gccacctgtc 300

cgccaaggca aagcgctcac agcagtggtc attctcgaga taatcgacgc gtaccaactt 360

gccatcctga agaatggtgc agtgtctcgg caccccatag ggaacctttg ccatcaactc 420

ggcaagatgc agcgtcgtgt tggcatcgtg tcccacgccg aggagaagta cctgcccatc 480

gagttcatgg acacgggcga ccgggcttgc aggcgagtga ggtggcaggg gcaatggatc 540

agagatgatc tgctctgcct gtggccccgc tgccgcaaag gcaaatggat gggcgctgcg 600

ctttacattt ggcaggcgcc agaatgtgtc agagacaact ccaaggtccg gtgtaacggg 660

cgacgtggca ggatcgaacg gctcgtcgtc cagacctgac cacgagggca tgacgagcgt 720

ccctcccgga cccagcgcag cacgcagggc ctcgatcagt ccaagtggcc catcttcgag 780

gggccggacg ctacggaagg agctgtggac cagcagcaca ccgccggggg taaccccaag 840

gttgagaagc tgaccgatga gctcggcttt tcgccattcg tattgcacga cattgcactc 900

caccgctgat gacatcagtc gatcatagca cgatcaacgg cactgttgca aatagtcggt 960

ggtgataaac ttatcatccc cttttgctga tggagctgca catgaaccca ttcaaaggcc 1020

ggcattttca gcgtgacatc attctgtggg ccgtacgctg gtactgcaaa tacggcatca 1080

gttaccgtga gctgcatttt ccgctgcata accctgcttc ggggtcatta tagcgatttt 1140

ttcggtatat ccatcctttt tcgcacgata tacaggattt tgccaaaggg ttcgtgtaga 1200

ctttccttgg tgtatccaac ggcgtcagcc gggcaggata ggtgaagtag gcccacccgc 1260

gagcgggtgt tccttcttca ctgtccctta ttcgcacctg gcggtgctca acgggaatcc 1320

tgctctgcga ggctggcggg aacttcgaag ttcctatact ttctagagaa taggaacttc 1380

gaactgcagg tcgacggatc cccggaatat caagcttatg acgcccggcc ggccgggtgc 1440

cccagcgggg cccggcc 1457

Claims (10)

1. Slreptomyces clavuligerus mutant lat:: Δ ( streptomyces clavuligeruslat:: Δ) bacterial strain, its preserving number at China Committee for Culture Collection of Microorganisms's common micro-organisms center is: CGMCC No.

2. bacterial strain claimed in claim 1, wherein Slreptomyces clavuligerus mutant lat:: Δ ( streptomyces clavuligeruslat:: be Δ) by wild strain streptomyces clavuligerusnRRL3585 sudden change, it is the mutant strain of the clavulanic acid high yield that obtained through ultraviolet mutagenesis and genetic engineering modified screening by described wild strain.

3. the described Slreptomyces clavuligerus mutant lat: of claim 1 or 2: Δ ( streptomyces clavuligeruslat:: Δ) bacterial strain is in the application for the preparation of in improving the increased activity microbiotic extensive pedigree antibiotic that suppresses drug-resistant bacteria generation β-lactamase.

4. application claimed in claim 3, the activity that wherein said raising suppresses drug-resistant bacteria generation β-lactamase refers to raising clavulanic acid output inhibition beta-lactam enzymic activity.

5. a ultraviolet mutation breeding high yield Slreptomyces clavuligerus mutant B372 (S treptomyces clavuligerusb372) method of bacterial strain, is characterized in that comprising the steps:

(1) preparation of clavuligerus spore suspension;

(2) ultraviolet mutagenesis;

(3) primary dcreening operation: the clavuligerus of high yield clavulanic acid is carried out to primary dcreening operation by agar block method;

(4) multiple sieve: use shake flask fermentation, HPLC method detection fermented liquid clavulanic acid amount the number carry out multiple sieve;

(5) checking superior strain: the superior strain obtained after sieving again goes down to posterity and cultivates 6 times, all uses the method the same with multiple sieve to produce acid acceptance to bacterial strain at every turn and is verified.

6. method for mutation breeding according to claim 5 is characterized in that: uv irradiating mutagenesis adopts 15W or 30W ultraviolet ray, and preheating in advance, after 20-30 minutes, is placed in distance ultraviolet ray 20-30cm place by spore suspension and carries out uv irradiating 30-45 seconds.

7. method for mutation breeding according to claim 5 is characterized in that being undertaken by following step:

(1) build latinsert the recombinant plasmid pELA of the general resistance frame of peace in gene;

(2) will contain the recombinant plasmid pELA transformed host cell of lat gene, obtain transformant;

(3) build latthe recombinant plasmid pSCAR that gene inside is knocked;

(4) using clavuligerus B372 as acceptor, with step 2) described transformant carries out conjugal transfer, obtain zygote, i.e. clavuligerus latthe gene disruption mutant bacteria s.clavuligeruslat::aac;

(5) by clavuligerus s.clavuligeruslat::aac, as acceptor, proceeds to recipient bacterium by the described recombinant plasmid pSCAR of step 3), obtains and not to contain any resistance marker latthe mutant strain of gene knockout s.clavuligeruslat:: Δ.

8. method for mutation breeding according to claim 7, is characterized in that, described Slreptomyces clavuligerus mutant B372's latnucleotide fragments between 191st～1600 of gene is displaced by one section general resistant gene of peace, does not contain the mutant strain of the lat gene knockout of any resistance marker.

9. method according to claim 7, the carrier framework that it is characterized in that step (1) and (3) described recombinant vectors is plasmid intestinal bacteria-streptomycete shuttle plasmid pGH112; The described host cell of step (2) is intestinal bacteria ET12567.

10. method according to claim 7, is characterized in that the described acceptor of step (5) is clavuligerus lat::aacprotoplastis, the preparation condition of protoplastis is the lysozyme concentration of employing 1mg/mL, enzymolysis 45min, and the conversion condition of protoplastis is the PEG1000 mediated transformation of employing 25%, before transforming by the clavuligerus protoplastis in 45 ℃ of incubation 10min, with the activity of the Restriction Enzyme that reduces streptomycete .

Images