CN102373171B - Nucleoside antibiotic A201A superior strain and construction method thereof - Google Patents
Nucleoside antibiotic A201A superior strain and construction method thereof Download PDFInfo
- Publication number
- CN102373171B CN102373171B CN201110340905.XA CN201110340905A CN102373171B CN 102373171 B CN102373171 B CN 102373171B CN 201110340905 A CN201110340905 A CN 201110340905A CN 102373171 B CN102373171 B CN 102373171B
- Authority
- CN
- China
- Prior art keywords
- scsio
- thermotolerans
- mtda
- gene
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nucleoside antibiotic A201A superior strain and a construction method thereof. The nucleoside antibiotic A201A superior strain M. thermotolerans SCSIO 00652 mutant strain Ju3001 is mtdA gene-inactivated M.thermotolerans SCSIO 00652, and the sequence of an mtdA gene is shown as SEQ ID NO.1. In the invention, the mtdA gene-inactivated M.thermotolerans SCSIO 00652 mutant strain Ju3001 is obtained by inactivating the mtdA gene serving as a negative regulon upstream of a nucleoside antibiotic A201A biosynthetic gene cluster of the M.thermotolerans SCSIO 00652, and the nucleoside antibiotic A201A yield of the M.thermotolerans SCSIO 00652 mutant strain Ju3001 is 25 times the yield of a wild M.thermotolerans SCSIO 00652 strain. Due to the successful construction of the antibiotic A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001, industrial production of the antibiotic A201A becomes possible.
Description
Technical field:
The invention belongs to marine microorganism genetically engineered and metabolic engineering field, be specifically related to a kind ofly by genetically engineered the biological synthesis gene cluster of nucleoside antibiotics A201A in the Streptomycin sulphate of M.thermotolerans SCSIO 00652 be carried out genetic modification, make the gene inactivation of mtdA and obtain the M.thermotolerans SCSIO 00652 mutant strain Ju3001 of nucleoside antibiotics A201A high yield.
Background technology:
In the past during the decade, marine actinomycete has become the new source that novel biologically active native product is found.For example, Salinispora belongs to actinomycetes, can produce multiple novel structure and biological activity compound widely, can produce compound salinosporamide A as marine actinomycete Salinispora tropica, enter the clinical trial of cancer therapy as this compound of proteasome inhibitor efficiently.This research unit (Chinese Academy of Science Nanhai Ocean Research Institute) separates in the warp of the northern deep-sea of South China Sea trench and obtains actinomycetes and newly belong to bacterial classification M.thermotolerans SCSIO 00652, and the fermented liquid of this bacterial strain is all inhibited to gram-positive microorganism and negative bacterium.
The gene relevant with the microbiotic biosynthesizing often cluster arranged, and comprises ego resistance gene, transporter gene and regulatory gene.After the microbiotic biological synthesis gene cluster is successfully cloned, can utilize combination biosynthesizing (combinatorialbiosynthesis) and metabolic engineering (metabolic engineering) technology on the molecular biology basis to come directed creation new texture, new active compound or improve antibiotic output, this will greatly enrich existing resource undoubtedly, thereby for solving or partly solve the serious day by day problem of resistance of pathogenic micro-organism clinically.
The PCR-Targeting technology that development in recent years is got up and conjugal transfer technology be successful Application in multiple streptomycete.The PCR-Targeting technology is based on the RED recombinant technology, RED homologous recombination system is by the exo that comes from lambda particles phage, bet, gam genomic constitution, under the effect of these 3 gene products, this system can mediate the above homologous fragment of 36bp and produce homologous recombination.The conjugal transfer technology is to occur between intestinal bacteria and the streptomycete, can avoid the influence of born of the same parents' exonuclease, make DNA exempt from the degraded of nuclease, thereby can overcome the host to a certain extent to the restricted modification raising transformation efficiency of foreign DNA, and schedule of operation is simple, therefore uses comparatively extensive.PCR-Targeting technology and conjugal transfer technology provide a kind of convenience valid approach for by genetically engineered microbiotic biological synthesis gene cluster in the Streptomycin sulphate being carried out genetic modification.
Nucleoside antibiotics A201A, its structure has broad-spectrum antibacterial suc as formula shown in (I), and gram-positive microorganism and negative bacterium are had restraining effect, and Staphylococcus aureus is had anti-microbial activity, and (Artemia salina) has lethality to the halogen worm.
Formula (I)
Summary of the invention:
The purpose of this invention is to provide a kind of nucleoside antibiotics A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001 and construction process thereof.
M.thermotolerans SCSIO 00652 of the present invention can produce nucleoside antibiotics A201A, extract the genomic dna of M.Thermotolerans SCSIO 00652, it is carried out full genome scanning, note and dna sequencing (being finished by the big gene of Shenzhen China).Pass through Illumina ' s Solexa sequencing technologies, the complete genome DNA sequence of M.thermotolerans SCSIO 00652 bacterial strain is determined, and the result of gene annotation shows that a size is that the continuous fragment of 73Kb may contain the necessary gene information of microbiotic A201A biosynthesizing.Bioinformatic analysis discloses the dna sequence dna of 37 about 40Kb sizes of open reading frame and has formed regulation and control in the microbiotic A201A biosynthesizing, structure, ego resistance, the isogenic information of transhipment (Fig. 1 is seen in structural analysis).The dna sequence dna of whole gene cluster has been stored among the GenBank, and its number of registration is JN651966.Upstream at microbiotic A201A biological synthesis gene cluster, the gene that individual called after mtdA is arranged, its nucleotide sequence is shown in SEQ ID NO.1, its one of coding has 244 amino acid whose polypeptide chains, its aminoacid sequence identifies that by bioinformatic analysis this peptide chain belongs to GntR family transcriptional control (Fig. 3) shown in SEQ ID N02.For the concrete effect of protein MtdA in the biosynthesizing of microbiotic A201A of verifying the mtdA genes encoding, PCR-Targeting technology by λ-RED mediation, read in the frame with a dna fragmentation with A Baila resistance and to replace, make the mtdA gene inactivation, obtain the M.thermotolerans SCSIO 00652 mutant strain Ju3001 of mtdA gene inactivation thus.3 mtdA inactivation mutant strains are cloned sub-M.thermotolerans SCSIO 00652 mutant strain Ju3001 and wild-type M.thermotolerans SCSIO 00652 bacterial strain simultaneously with the condition fermentation, and wild type strain is as positive control.Analyze the fermented liquid butanone extraction thing of mutant strain M.thermotoleransSCSIO 00652 mutant strain Ju3001 by HPLC, the result shows three consistent high yield A201A of mutant strain clone, and the output of this natural product is compared with wild type strain and exceeded 25 times more than.The output that wild type strain and M.thermotolerans SCSIO 00652 mutant strain Ju3001 produce microbiotic A201A is respectively 12.5mg/L and 312.5mg/L.These digital proofs MtdA albumen in the biosynthesizing of A201A, play a role as a negativity regulator.
So nucleoside antibiotics A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001 of the present invention, it is characterized in that, this nucleoside antibiotics A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001 is the M.thermotolerans SCSIO 00652 of mtdA gene inactivation, and the sequence of described mtdA gene is shown in SEQID NO.1.
Nucleoside antibiotics A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001 of the present invention makes up by the following method, it is characterized in that, it is the mtdA gene inactivation with M.thermotolerans SCSIO 00652, obtain nucleoside antibiotics A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001 thus, the sequence of described mtdA gene is shown in SEQ ID NO.1.
Described mtdA gene inactivation with M.thermotolerans SCSIO 00652 is preferably with MtdAdelF:5 '-gccgacctgctggagaccttctccgtcctggccgaggtgattccggggatccgtcg acc-3
MtdAdelR:5 '-gcacagccagttctcgacctccaggacgtgcatggtggctgtaggctggagctgct tc-3 ' is as mtdA gene knockout primer, carry out homologous recombination with PCR-Targeting, the M.thermotolerans SCSIO 00652 of the cosmid of homologous recombination and wild-type is carried out conjugal transfer the mtdA gene is read frame replace, and make up the M.thermotolerans SCSIO 00652 mutant strain Ju3001 that obtains the mtdA gene inactivation.
Another object of the present invention provides a kind of mtdA gene that plays a role as the negativity regulator in the biosynthesizing of microbiotic A201A, it is characterized in that, its nucleotide sequence is shown in SEQ ID NO.1.
The protein of above-mentioned mtdA genes encoding is characterized in that, its aminoacid sequence is shown in SEQ ID NO2.
Be used for M.thermotolerans SCSIO 00652 of the present invention, openly record in the literature (reference: " and Yao Yueliang, three kinds of actinomycetes secondary metabolites and bioactivity research .[D thereof] Chongqing: biotechnology institute of University Of Chongqing; 2010 "), mentioned microorganism the applicant also hold, and guarantee to provide to the public in 20 years the present patent application days.
The negativity regulator mtdA gene of the nucleoside antibiotics A201A biological synthesis gene cluster upstream by inactivation M.thermotolerans SCSIO 00652 of the present invention obtains the M.thermotolerans SCSIO 00652 mutant strain Ju3001 of mtdA gene inactivation, and the nucleoside antibiotics A201A output of this M.thermotolerans SCSIO 00652 mutant strain Ju3001 is 25 times of M.thermotolerans SCSIO 00652 bacterial strain of wild-type.Therefore, the successful structure of this microbiotic A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001 makes the industrialization of microbiotic A201A become possibility.
Description of drawings:
Fig. 1 is the organization chart of microbiotic A201A biological synthesis gene cluster.
Fig. 2 A is the structure synoptic diagram of mtdA genetically deficient mutant strain M.thermotolerans SCSIO 00652 mutant strain Ju3001, Fig. 2 B carries out the PCR product of PCR checking through agarose gel electrophoresis analysis chart with mtdACF, mtdACR as primer in conjunction with shifting son, Marker:DL2000 wherein, W: wild-type M.thermotolerans SCSIO 00652 bacterial strain, three clone's of M1-M3:M.thermotolerans SCSIO 00652 mutant strain Ju3001.
Fig. 3 is the multiple sequence comparison chart of the protein MtdA aminoacid sequence of mtdA genes encoding, and this comparison is to adopt Cluster V method, and secondary structure such as alpha-helix mark with gray bar, and beta sheet marks with black arrow; Black line partly represents not have secondary structure, and shown in the gray bar part, this sequence is at the helix turn helix DNA combining unit of an anticipation of N end coding; Wherein
The protein MtdA of mtdA genes encoding in MtdA:M.thermotolerans SCSIO 00652 bacterial strain;
GlnR
Sv: the number of registration among the GenBank is CCA53361.1, comes from the GlnR albumen of Streptomyces venezuelae;
Agl3R
Sc: the number of registration among the GenBank is NP 631227.1, comes from the Agl3R albumen of Streptomyces coelicolor;
GntR
Bl: the number of registration among the GenBank is AAU43099.1, comes from the GntR albumen of Bacillus.licheniformis;
GntR
Bs: the number of registration among the GenBank is BAA21579.1, comes from the GntR albumen of Bacillus subtilis.
Fig. 4 is that the HPLC of wild-type M.thermotolerans SCSIO 00652 bacterial strain and M.thermotolerans SCSIO 00652 mutant strain Ju3001 fermentation crude extract analyzes and activity experiment figure, wherein A figure is that (HPLC analyzes the composed as follows of used moving phase: A phase, 15% acetonitrile+85% water+0.1% Glacial acetic acid for the HPLC analysis chart of fermented product crude extract; The B phase, 20% water+80% acetonitrile+0.1% Glacial acetic acid.The HPLC program is: 0~20min, and B is 0%~80% gradient elution mutually; 20~25min, B is 80%~100% gradient elution mutually; 25~30min, 100%B phase wash-out.UV detects wavelength 275nm, and flow velocity is 1min/mL.), B figure has shown the biological activity of fermentation crude extract to Staphylococcus aureus; I is wild-type M.thermotolerans SCSIO 00652 bacterial strain; II-IV is three clone's of M.thermotolerans SCSIO 00652 mutant strain Ju3001; V is 5 times of dilutions of the fermentation broth coarse extract of M.thermotolerans SCSIO 00652 mutant strain Ju3001; VI is 30 times of dilutions of the fermentation broth coarse extract of M.thermotolerans SCSIO 00652 mutant strain Ju3001, the indication microbiotic A201A among the HPLC figure.
Fig. 5 and Fig. 6 are the nuclear magnetic spectrums of active compound among the embodiment 1.
Embodiment:
Following examples are to further specify of the present invention, rather than limitation of the present invention.
Microbiotic A201A separation and purification in embodiment 1:M.thermotolerans SCSIO 00652 fermented product and structure are identified.
M-ISP4 substratum (the ISP4 liquid nutrient medium of improvement): be to add peptone, yeast extract and sea salt on the basis of ISP4 substratum, whole massfraction is respectively: 0.1%, 0.05%, 3%.The prescription that is the M-ISP4 substratum is: every liter of M-ISP4 substratum contains: Zulkovsky starch 10g, K
2HPO
41g, MgSO
4.7H
2O 1g, NaCl 1g, (NH
4)
2SO
42g, CaCO
32g, FeSO
4.7H
2O 0.001g, MnCl
2.4H
2O 0.001g, ZnSO
4.7H
2O 0.001g, peptone 1g, yeast extract 0.5g, thick sea salt 30g, surplus is water, pH7.0~7.4.Solid medium is to add 1.5% agar on the basis of liquid medium within.
At first, M.thermotolerans SCSIO 00652 bacterial strain was fermented 8 days 28~30 ℃ of temperature, rotating speed 200rpm in the 250mL triangular flask that the ISP4 liquid nutrient medium of improvement (M-ISP4 substratum) is housed; Then, fermented liquid extracts with isopyknic butanone, and 50 ℃ of reduction vaporizations of upper organic phase with 500 μ L dissolve with methanol, obtain crude extract; Moreover, crude extract is carried out active testing, find that crude extract has restraining effect to streptococcus aureus (Staphylococcus aureus) and halogen worm (Artemiasalina).At last, M.thermotolerans SCSIO 00652 is fermented greatly (substratum is the M-ISP4 substratum), the fermentation cumulative volume is 6L.From the crude extract of big fermentation, separate all cpds, all cpds is carried out active testing, thereby track active compound.Active compound is carried out HPLC analyze, find that this compound has ultraviolet absorption peak at 210nm and 273nm place.HPLC analyzes the composed as follows of used moving phase: A phase, 15% acetonitrile+85% water+0.1% Glacial acetic acid; The B phase, 20% water+80% acetonitrile+0.1% Glacial acetic acid.The HPLC program is: 0~20min, and B is 0%~80% gradient elution mutually; 20~25min, B is 80%~100% gradient elution mutually; 25~30min, 100%B phase wash-out.UV detects wavelength 275nm, and flow velocity is 1min/mL.In this program, the about 10min of the retention time of active compound.Active compound is carried out HR-ESI-MS, 1D (
1H,
13C), 2D (COSY, HMQC, and HMBC) NMR test, data as shown in Figure 5 and Figure 6, the analysis-by-synthesis spectral data draws the active compound structure suc as formula shown in (I).This structure is consistent with the structure of separating the called after A201A compound that obtains in 1985 from Streptomyces capreolus NRRL 3817.
Embodiment 2: the structure of nucleoside antibiotics A201A superior strain M.thermotolerans SCSIO 00652 mutant strain Ju3001:
According to the genomic dna of ordinary method extraction M.thermotolerans SCSIO 00652, M.thermotoleransSCSIO 00652 is carried out full genome scanning, note and dna sequencing (being finished by the big gene of Shenzhen China).The result of gene annotation shows that a size is that the continuous fragment of 73Kb may contain the necessary gene information of microbiotic A201A biosynthesizing.Bioinformatic analysis discloses the dna sequence dna of 37 about 40Kb sizes of open reading frame and has formed regulation and control in the microbiotic A201A biosynthesizing, structure, ego resistance, the isogenic information of transhipment (Fig. 1 is seen in structural analysis).The dna sequence dna of whole gene cluster has been stored among the GenBank, and its number of registration is JN651966.Upstream at microbiotic A201A biological synthesis gene cluster, the gene that individual called after mtdA is arranged, its nucleotide sequence is shown in SEQ ID NO.1, its one of coding has 244 amino acid whose polypeptide chains, its aminoacid sequence identifies that by bioinformatic analysis this peptide chain belongs to GntR family transcriptional control (Fig. 3) shown in SEQ ID NO.2.
Inactivation is PCR-Targeting technology and the conjugal transfer technology that has adopted λ-RED mediation in the reading frame of mtdA gene, and the synoptic diagram of its construction process is shown in Fig. 2 A, and concrete steps are as follows:
1. the structure that includes the Cosmid 49C of mtdA gene: the structure of M.thermotolerans SCSIO 00652 genomic library is carrier with SuperCos I, and flow process is with reference to the operational manual of SuperCos 1 Cosmid Vector Kit (available from Stratagene company).Flow process is as follows substantially: extract genomic dna from M.thermotolerans SCSIO 00652 mycelium, through Sau3AI part enzymolysis, by calf intestinal Phosphoric acid esterase dephosphorylation, be connected to then by on SuperCos 1 carrier of XbaI and BamHI enzymolysis processing, carry out external the packing with Packagene Lambda DNA packaging system, infect intestinal bacteria LE392, screening on LB+kanamycin (Kan, final concentration 50 μ g/mL) flat board.Choose about 7500 clone's and select in 20 96 orifice plates, behind the cultivation 12h, add the glycerine of equal-volume 50% in the aperture.-80 ℃ of preservations.The gene order-checking of M.thermotolerans SCSIO 00652 is transferred to the big genome company of Shenzhen China and is finished.According to the sequence that the big genome company of Shenzhen China provides, in conjunction with information biology software and A201A structure, inferred the weave construction (as shown in Figure 1) of A201A biological synthesis gene cluster.Wherein, the mtdA gene in the gene cluster (dna sequence dna is shown in SEQ ID NO.1) coding GntR family transcriptional regulator is estimated relevant with expression or the output of itself and A201A.In order to study the function of mtdA gene, we knock out it at desire.For this reason, we have designed two pairs of primers near the mtdA sequence, SGF (5 '-CTGTTCGCCGCCTATTTCG-3 '), SGR (5 '-CGAACCCGCTCACCCAGTAG-3 ') and SMF (5 '-GGTGCTCGGTGCCGATGTTG-3 '), SMR (5 '-TTCATCTCCGCCAACCACG-3 ').Two pairs of primer PCR gained purpose bands approximately are slightly larger than 500bp.Utilize this two pairs of primers respectively, from the genomic library that makes up, utilize the round pcr screening positive clone.The PCR program is as follows: 94 ℃ of 4min; 94 ℃ of 50s, 58 ℃ of 50s, 72 ℃ of 50s, 30 circulations; 72 ℃ of 10min.Wherein screen a plurality of positive colonies (utilizing above-mentioned two pairs of primers can both obtain being slightly larger than the PCR product of 500bp).Our selected the 4th 96 orifice plate correspondences (9, the C) positive colony of position, this positive colony includes the mtdA gene, and called after Cosmid 49C is used for carrying out next step the knocking out of mtdA gene.
2. the Cosmid 49C electricity that will include the mtdA gene is transformed among the E.coli BW25113/pIJ790, the cell called after that obtains thus: E.coli BW25113/pIJ790/49C.
3. be template with the pIJ733 plasmid of being cut by EcoRI and HindIII enzyme, with mtdA gene knockout primer:
(MtdAdelF:5 '-
GccgacctgctggagaccttctccgtcctggccgaggtgAttccggggatccgtcgacc-3 ', underscore partly represent the dna homolog with mtdA;
MtdAdelR:5 '-
GcacagccagttctcgacctccaggacgtgcatggtggcTgtaggctggagctgcttc-3 ', underscore partly represent the dna homolog with mtdA);
Pcr amplification reaction with aac (3) IV-oriT resistance fragment of Apr resistance.PCR product aac (3) the IV-oriT resistance fragment electricity that amplification is obtained is transformed in the E.coli BW25113/pIJ790/49C cell, and the homologous recombination that mediates by λ-RED obtains improved reorganization cosmid, called after pJu3001.With the PCR of mtdA gene checking primer (mtdACF:5 '-gaccggaaggtgtcaagatgg; MtdACR:3 '-gacgacttccacctgtacgc) carry out the verity that pcr amplification reaction is determined reorganization cosmid, that can amplify PCR product (1984bp) is real reorganization cosmid pJu3001.Subsequently, the cosmid pJu3001 electricity of will recombinating changes among the E.coli ET12567/pUZ8002, obtains E.coli ET12567/pUZ8002/pJu3001, carries out conjugal transfer with its donor bacterium and wild type strain as conjugal transfer.
4. the process of conjugal transfer is as follows: in the TSB nutrient solution, 28 ℃ of concussions were cultivated 6~12 hours, made its spore germination with the spore of wild-type M.thermotolerans SCSIO 00652; E.coli ET12567/pUZ8002/pJu3001 is being added with kantlex (Kan, final concentration is 50 μ g/mL), penbritin (Amp, final concentration is 100 μ g/mL), paraxin (Cml, final concentration is 25 μ g/mL) and A Baila mycin (Apr, final concentration is 50 μ g/mL) the LB nutrient solution in be cultured to optical density value OD=0.6, centrifugal collecting cell, with LB substratum washed twice, mix with sprouting wild-type M.thermotolerans SCSIO 00652 spore well then, mixed solution is tiled in is added with 10mM MgSO
4M-ISP
4On the solid medium (being to be added with 0.1% peptone, 0.05% yeast extract and 3% sea salt at the ISP4 substratum); After 23 hours, coating 800 μ L are added with the sterilized water of antibiotic medicine on each solid medium flat board, wherein contain antibiotic medicine: trimethoprim (Tmp, 50mg/mL) 30 μ L, A Baila mycin (Apm, 50mg/mL) 30 μ L 28 ℃ of growths; Be allowed to condition under 28 ℃ of incubators and grew 4-5 days, occur up to conjugal transfer; Conjugal transfer is at M-ISP
4On the solid medium flat board after 4 generations of continuous passage, again through mtdA gene PCR checking primer (mtdACF, mtdACR) conjugal transfer that amplified reaction checking can obtain the amplified production (Fig. 2 B) of 1984bp is double exchange mutant strain Δ mtdA (Ju3001), called after M.thermotolerans SCSIO 00652 mutant strain Ju3001.This double exchange mutant strain Δ mtdA (Ju3001) is by antibiotic surperficial resistance (Kan
S﹠amp; Apm
R) and mtdA gene PCR checking primer (mtdACF, amplified reaction mtdACR) and screened and identify.Obtain the sub-M1 of clone, M2, the M3 of three M.thermotolerans SCSIO 00652 mutant strain Ju3001 thus.
Embodiment 3: fermentation and the product analysis thereof of wild type strain M.thermotolerans SCSIO 00652 and M.thermotolerans SCSIO 00652 mutant strain Ju3001
The ISP that wild type strain M.thermotolerans SCSIO 00652 and M.thermotolerans SCSIO 00652 mutant strain Ju3001 (comprising clone sub-M1, M2, M3) are improveing
4(M-ISP
4) solid medium cultivated 5-7 days for dull and stereotyped last 30 ℃, the equal an amount of mycelium of picking and spore are put into 50ml M-ISP are housed
4In the triangular flask of liquid nutrient medium, cultivated 9 days at 28 ℃ of shaking tables with the 200rpm rotating speed.Fermented liquid is dissolved in the 500 μ l methyl alcohol after revolving steaming instrument evaporate to dryness with the butanone extraction of 2 times of volumes, butanone extraction liquid, behind the centrifugal 5min of 8000rpm, gets supernatant liquor and carries out the HPLC analysis, and its HPLC analyzes shown in Fig. 4 A.The result shows that three mutant strains clone sub-M1, the M2 high yield microbiotic A201A consistent with M3.The output of wild type strain M.thermotolerans SCSIO 00652 and M.thermotolerans SCSIO 00652 mutant strain Ju3001 microbiotic A201A is respectively 12.5mg/L and 312.5mg/L, and the output of the microbiotic A201A of M.thermotolerans SCSIO 00652 mutant strain Ju3001 is compared with wild type strain M.thermotolerans SCSIO 00652 and exceeded 25 times more than.Proved that thus MtdA albumen plays a role as a negativity regulator in the biosynthesizing of microbiotic A201A, inactivation MtdA gene can improve the output of the microbiotic A201A of M.thermotolerans SCSIO 00652 significantly.
Claims (2)
- One kind in microbiotic A201A biosynthesizing as the mtdA gene that the negativity regulator plays a role, it is characterized in that its nucleotide sequence is shown in SEQ ID NO.1.
- 2. the protein of the described mtdA genes encoding of claim 1 is characterized in that, its aminoacid sequence is shown in SEQ IDNO.2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110340905.XA CN102373171B (en) | 2011-11-01 | 2011-11-01 | Nucleoside antibiotic A201A superior strain and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110340905.XA CN102373171B (en) | 2011-11-01 | 2011-11-01 | Nucleoside antibiotic A201A superior strain and construction method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102373171A CN102373171A (en) | 2012-03-14 |
CN102373171B true CN102373171B (en) | 2013-08-14 |
Family
ID=45792403
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201110340905.XA Expired - Fee Related CN102373171B (en) | 2011-11-01 | 2011-11-01 | Nucleoside antibiotic A201A superior strain and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102373171B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103416437A (en) * | 2012-05-23 | 2013-12-04 | 徐州诺特化工有限公司 | Preparation method for modified cytidine antibiotic oil suspension |
CN105061537B (en) * | 2015-07-29 | 2018-02-02 | 中国科学院南海海洋研究所 | A kind of nucleoside antibiotic and its application in antibacterials are prepared |
CN108587991B (en) * | 2015-10-10 | 2021-03-05 | 中国科学院南海海洋研究所 | Bacterial strain for highly producing cyclic peptide compounds |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5098837A (en) * | 1988-06-07 | 1992-03-24 | Eli Lilly And Company | Macrolide biosynthetic genes for use in streptomyces and other organisms |
CN100396773C (en) * | 2005-07-22 | 2008-06-25 | 中国农业大学 | Gene engineering bacteria for producing crown bacterin and its construction method |
CN101974464B (en) * | 2010-10-18 | 2012-07-04 | 中国科学院南海海洋研究所 | Streptomyces and process for preparing antimycin antibiotics by fermentation using same |
-
2011
- 2011-11-01 CN CN201110340905.XA patent/CN102373171B/en not_active Expired - Fee Related
Non-Patent Citations (2)
Title |
---|
抗生素A201A 的生物合成机制及其工程改造;李军;《网络公开》;20091123;全文 * |
李军.抗生素A201A 的生物合成机制及其工程改造.《网络公开》.2009, |
Also Published As
Publication number | Publication date |
---|---|
CN102373171A (en) | 2012-03-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Marcone et al. | Old and new glycopeptide antibiotics: From product to gene and back in the post-genomic era | |
van Dissel et al. | A novel locus for mycelial aggregation forms a gateway to improved Streptomyces cell factories | |
CN110218244B (en) | Compound ilamycin F and application thereof | |
CN102181470B (en) | Method for improving yield of Streptomyces antibiotics and plasmid thereof | |
WO2017114034A1 (en) | Carrimycin biosynthetic gene cluster | |
CN102373171B (en) | Nucleoside antibiotic A201A superior strain and construction method thereof | |
CN110157756A (en) | A method of yield of erythrocin is improved by the red mould SACE_0303 gene of the more spores of transformation sugar | |
CN101402959A (en) | Promotor replacement method for improving volume of production of bacillus subtilis surfactin | |
CN103215281B (en) | Biosynthetic gene cluster of grincamycin and P-1894B and application thereof | |
CN101613712A (en) | Improve the method for Avrmectin and/or ivermectin output and produce bacterial strain | |
CN110029069A (en) | The palpus saccharopolyspora strain engineered strain and its application that one plant of flaviolin gene cluster knocks out | |
CN112251456B (en) | Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification | |
Yan et al. | Ktedonosporobacter rubrisoli gen. nov., sp. nov., a novel representative of the class Ktedonobacteria, isolated from red soil, and proposal of Ktedonosporobacteraceae fam. nov. | |
CN103820474A (en) | Biosynthesis gene cluster of polyenoid and polyol macrolide compound | |
CN102703495A (en) | Method for improving yield of streptomycete antibiotic and plasmid thereof | |
CN106906238A (en) | A kind of streptomycete antibiotic biological synthesis gene cluster multicopy amplification method and application | |
CN102911957B (en) | Biosynthesis gene cluster of griseoviridin and viridogrisein and application of biosynthesis gene cluster | |
CN105255936A (en) | Method for establishing salinispora arenlocola CNS-205 gene genetic manipulation system | |
CN102719388A (en) | Method for improving yield of streptomyces antibiotics and plasmids thereof | |
Gusek et al. | Review of the Streptomyces lividans/vector plJ702 system for gene cloning | |
Bethencourt et al. | Comparative genomics and proteogenomics highlight key molecular players involved in Frankia sporulation | |
CN106190854B (en) | A kind of preparation method of desert pseudocyst bacterium and oritavancin intermediate | |
CN104164399A (en) | High-producing strain for cyclic lipopeptide antibiotic--himastatin and construction method thereof | |
CN103740789B (en) | Improve the method for validamycin fermentation level | |
CN101475944A (en) | Promoter replacement method for improving Bacillus amyloliquefaciens yield |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130814 Termination date: 20211101 |