CN112251456B - Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification - Google Patents
Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification Download PDFInfo
- Publication number
- CN112251456B CN112251456B CN202011140715.9A CN202011140715A CN112251456B CN 112251456 B CN112251456 B CN 112251456B CN 202011140715 A CN202011140715 A CN 202011140715A CN 112251456 B CN112251456 B CN 112251456B
- Authority
- CN
- China
- Prior art keywords
- lincomycin
- slcg
- streptomyces
- yield
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/76—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Actinomyces; for Streptomyces
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/36—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Actinomyces; from Streptomyces (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/64—Preparation of S-glycosides, e.g. lincomycin
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Disclosure of the inventionA method for improving the yield of lincomycin by the combined modification of the regulatory gene of streptomyces lincomycin features that the transcriptional regulatory gene of Lrp family is combined and knocked out in streptomyces lincomycinSLCG_ 4846And TetR family transcriptional regulatory genesSLCG_2919And (4) obtaining the product. Meanwhile, the invention also discloses a method for improving the yield of lincomycin by the combined transformation of streptomyces lincomosus regulatory genes. The method sequentially carries out traceless knockout on a plurality of genes by homologous recombination technology, and resistance genes are not introduced in the process, thereby not only reducing the fermentation cost, but also ensuring the genetic stability. Meanwhile, the growth of thalli is not influenced in the process, and most importantly, multiple knockout experiments can be continuously carried out in the same strain. The method can greatly improve the yield of the lincomycin and provide a new technical support for improving the yield of the lincomycin in industrial production.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a method for improving lincomycin yield through streptomyces lincomosus regulation gene combination modification.
Background
Antibiotics are a class of secondary metabolites that inhibit the growth of pathogenic bacteria, more than half of which are streptomyces. The streptomyces lincolnensis of the invention belongs to one of streptomyces, the produced antibiotic is lincomycin, and the lincomycin is mainly used for treating infection caused by gram-positive bacteria clinically, and the derivative of the lincomycin has better effect on treating bacterial infection, especially anaerobic bacterial infection.
The genetic modification of streptomyces lincolnensis is uninterrupted, and the traditional mutagenesis method is time-consuming, has high randomness and is not suitable for further genetic modification. Since the twenty-first century, novel and efficient genetic engineering technologies such as large-fragment homologous recombination, Cre/loxP and CRIPSR/Cas 9 bring opportunities for genetic improvement of streptomyces lincolnensis to improve the yield of lincomycin biosynthesis.
Lincomycin is formed by condensation of propylproline (PPL) and Lincosamide (LSM) and then modified, and is acted by various regulatory factors in the process. In recent years, a variety of regulatory factors, such as Lrp, TetR, BldD, LmbU, BldA and AdpA, have been found to regulate lincomycin biosynthesis. However, compared with other antibiotics, the research on the biosynthesis and control of lincomycin is relatively limited, and the directed modification of streptomyces lincomycin to obtain high-yield strains is not facilitated. The invention aims to obtain a lincomycin high-yield strain by knocking out two regulatory genes in a gene engineering way in a combined way, is used for producing lincomycin or intermediate products, and lays a foundation for modifying a plurality of regulatory genes.
The Lrp (Leucine-responsive regulatory protein) family is a transcription regulatory factor widely existing in bacteria and archaea, and participates in a plurality of important physiological processes such as microbial hair generation, heavy metal transport, polypeptide transportation, energy metabolism and the like. Recently, various Lrp/AsnC family transcriptional regulators of actinomycetes are involved in antibiotic yield and morphological differentiation, such as BkdR, SCO2140, SACE _ Lrp, SCO3361, SACE _5717 and SLCG _ Lrp, and the like, and the importance of Lrp family regulatory genes in actinomycetes antibiotic biosynthesis is suggested.
The TetR Family transcription regulating factors (TFRs) play an important role in regulating physiological processes such as biosynthesis of antibiotics, morphological differentiation of thalli, drug efflux, primary metabolism, quorum sensing, coping with osmotic stress and the like. In recent years, various TFRs involved in antibiotic production and morphological differentiation of Streptomyces have been reported, such as SAV _576, SAV _3619, SCO _1712, AtrA, SLCG _2919, etc., suggesting the importance of TetR family regulatory genes in Streptomyces secondary metabolism and antibiotic biosynthesis.
Disclosure of Invention
The invention aims to make up for the defects of the prior art, and provides a method for improving the yield of lincomycin by modifying streptomyces lincomycin regulatory gene combinations, so that the yield of the lincomycin is further improved, and a lincomycin high-yield strain is obtained. The genome of streptomyces lincolensis contains a plurality of genes for coding Lrp family transcription regulating factors, and the genes are subjected to knockout experiments to find that: after the SLCG-4846 gene is deleted, the lincomycin yield of the strain is improved by 23 percent compared with that of the original strain. The SLCG-4846 gene is supplemented back in the deletion mutant strain, the lincomycin yield is restored to the level of the original strain, and the SLCG-4846 negatively regulates the biosynthesis of the lincomycin. And then SLCG-4846 is knocked out in an industrial strain LA219X, so that the yield of the mutant strain is remarkably improved, and the amplification reaches 11.5%.
The early laboratory discovers that the transcription regulatory factor SLCG-2919 of the TetR family has negative regulation effect on the biosynthesis of lincomycin.
In order to further improve the yield of lincomycin, the invention carries out combined transformation on two regulatory factors, namely SLCG-4846 and SLCG-2919, and obtains a double knock-out strain LA219X delta 4846-2919.
The invention is realized by the following technical scheme:
a method for improving the yield of lincomycin through the modification of streptomyces lincomycin regulation gene combinations is characterized in that the gene combinations of Lrp family transcription regulation factors and TetR family transcription regulation factors in streptomyces lincomycin are subjected to traceless knockout through homologous recombination, strains are obtained after knockout, and the obtained strains are used for producing lincomycin through fermentation.
Resistance genes are not introduced in the homologous recombination traceless knockout process, and multiple knockout experiments are continuously carried out in the same strain.
The gene for coding the Lrp family transcription regulating factor is SLCG-4846 gene, the gene for the TetR family transcription regulating factor is SLCG-2919 gene, and SLCG-4846 and SLCG-2919 gene products can negatively regulate lincomycin biosynthesis.
The construction method specifically comprises the following steps:
(1) amplifying an SLCG-4846 upstream fragment by taking a streptomyces linkensis high-yield strain LCGL genome as a template and 4846-P1 and 4846-P2 as primers; amplifying an SLCG _4846 downstream fragment by taking 4846-P3 and 4846-P4 as primers;
(2) connecting the upstream and downstream fragments of SLCG-4846 to a pKC1139 vector in a manner of enzyme digestion and connection to construct a pKC 1139-delta 4846 vector;
(3) the pKC 1139-delta 4846 vector is transformed into streptomyces lincolensis LCGL, and after screening, the SLCG-4846 deletion mutant delta SLCGL-4846 is obtained.
The application of the deletion mutant strain in improving the yield of lincomycin at the fermentation level.
SLCG-4846 is transformed in an industrial strain LA219X, and the transformation method comprises the following steps:
(1) amplifying an SLCG _4846 upstream fragment by taking a genome of a streptomyces linkensis high-producing strain LA219X as a template and 4846-P1 and 4846-P2 as primers; amplifying an SLCG _4846 downstream fragment by taking 4846-P3 and 4846-P4 as primers;
(2) connecting the upstream and downstream fragments of SLCG-4846 to a pKC1139 vector in a manner of enzyme digestion and connection to construct a pKC 1139-delta 4846 vector;
(3) the pKC 1139-delta 4846 vector is transformed into Streptomyces lincolnensis LA219X, and after screening, the SLCG _4846 deletion mutant strain LA219X delta 4846 is obtained.
The application of the industrial mutant strain in improving the yield of lincomycin at the fermentation level.
A combined deletion mutant strain is constructed on the basis of the deletion mutant strain LA219X delta 4846 by the following method:
(1) amplifying an SLCG _2919 upstream fragment by taking a streptomyces lincolnensis high-producing strain LA219X genome as a template and 2919-P1 and 2919-P2 as primers; amplifying SLCG _2919 downstream fragments by using 2919-P3 and 2919-P4 as primers;
(2) connecting the upstream and downstream fragments of SLCG-2919 to a pKC1139 vector in a mode of enzyme digestion and connection to construct a pKC 1139-delta 2919 vector;
(3) the pKC 1139-delta 2919 vector is transformed into an industrial deletion mutant strain LA219X delta 4846, and after screening, a combined deletion mutant strain LA219X delta 4846-2919 is obtained.
The application of the combined deletion mutant strain in improving the yield of lincomycin at the fermentation level.
The invention has the advantages that:
in the research of the invention, a lincomycin biosynthesis negative regulator SLCG-4846 is screened, and a lincomycin high-yield strain can be obtained by deleting SLCG-4846 genes on a streptomyces lincomycin chromosome through a genetic engineering approach.
SLCG _2919 negatively regulates lincomycin biosynthesis. SLCG-2919 is knocked out in streptomyces lincomycin, and the yield of lincomycin is obviously improved. In order to seek for more high-yield streptomyces lincolnensis, the invention carries out combined transformation on two regulatory genes, namely SLCG-4846 and SLCG-2919, obtains the streptomyces lincolnensis LA219X delta 4846-2919, further improves the lincomycin yield, and provides technical support for improving the lincomycin fermentation yield in industrial production. In addition, the combined knockout of two regulatory genes in Streptomyces lincolensis is the first case.
The construction method of the combined modified strain is simple, and a resistance gene is not introduced in the knockout process, so that the fermentation cost is reduced, and the genetic stability is also ensured. Meanwhile, the knockout does not affect the growth of the thalli. Most importantly, multiple knockout experiments can be continuously carried out in the same strain, and a foundation is laid for further modification of high-yield strains.
Drawings
FIG. 1 shows the positional information of SLCG-4846 gene and neighboring genes on a chromosome.
FIG. 2 is a schematic diagram of the construction of the Δ SLCGL _4846 mutant and the PCR identification of deletion mutants, wherein:
(A) the construction of the Δ SLCGL _4846 mutant is shown schematically;
(B) PCR identification of Δ SLCGL _4846 mutant.
FIG. 3 shows the construction of SLCG-4846 gene complementation strain, PCR identification of Δ SLCGL-4846/pIB 139-4846 complementation strain and Δ SLCGL-4846/pIB 139 complementation empty-load strain: the PCR product was the apr resistance gene (776 bp).
FIG. 4 shows the effect of SLCG-4846 gene on the morphological differentiation of strain and the determination of biomass of the mutant strain Δ SLCGL-4846, in which:
(A) measuring the biomass of the delta SLCGL-4846 mutant strain and the mycelium of the starting strain LCGL strain;
(B) spore growth of the Δ SLCGL _4846 mutant and the starting strain LCGL strain.
FIG. 5 is HPLC analysis of original strain LCGL, deletion mutant strain Δ SLCGL _4846, deletion anaplerotic strain and anaplerotic no-load control strain lincomycin.
FIG. 6 shows the construction of LA 219X. delta. 4846-2919 mutant and the PCR identification of deletion mutant:
(A) schematic diagram of LA 219X. delta. 4846-2919 mutant construction;
(B) PCR identification of LA 219X. DELTA.4846-2919 mutant.
FIG. 7 is a graph showing the effect of SLCG-4846 and SLCG-2919 genes on morphological differentiation of strains and the determination of biomass of LA 219X. delta. 4846 mutant strain, in which:
(A) biomass measurement of mycelium of LA 219X. DELTA.4846-2919 mutant strain and LA219X starting strain;
(B) spore outgrowth of the LA 219X. DELTA.4846-2919 mutant strain and the starting strain LA219X strain.
FIG. 8 shows the analysis of the lincomycin production of the starting strain LA219X, the single knock-out mutant LA 219X. delta. 4846 and the double knock-out mutant LA 219X. delta. 4846-2919.
Detailed Description
The technical scheme of the invention is further explained by combining the specific examples as follows:
the strains and plasmids used in the examples are shown in Table 1, and the sequences of the primers synthesized are shown in Table 2. Coli were cultured on liquid LB medium at 37 ℃ or on solid LB plates supplemented with 1.25% agar. The lincomycin producing strain streptomyces lincolnensis and its engineering strain are cultured in Tryptone Soy Broth (TSBY) medium at 30 ℃ or on MGM plates containing 2.2% agar.
The materials used in the examples were PEG3350, lysozyme, TES, casamino acid, thiostrepton, apramycin from Sigma. TSB, yeast extract, peptone were purchased from Oxoid. Glycine, agar powder, sodium chloride and other biological reagents were purchased from reagent companies. General procedures for E.coli and S.lincolnensis were performed according to standard protocols. The synthesis of primers and DNA sequencing were performed by Biotechnology engineering (Shanghai) Inc.
Table 1 strains and plasmids used in the study
TABLE 2 primers used in this study
Example 1
Construction of deletion mutant of SLCG-4846 Gene:
as shown in FIGS. 1 and 2, in order to knock out the SLCG-4846 gene in Streptomyces lincolnensis, homologous fragments of about 1.8kb upstream and downstream of the SLCG-4846 gene were PCR-amplified using 4846-P1/4846-P2 and 4846-P3/4846-P4 as primers and the LCGL genome of Streptomyces lincolnensis as a template, respectively. The two 4846-U and 4846-D upstream and downstream fragments were ligated to pKC1139 vector at the same time to complete the construction of plasmid pKC 1139. delta. 4846, as shown in A in FIG. 2. A protoplast transformation technology is utilized to transform the pKC1139 delta 4846 plasmid into a streptomyces lincolnensis protoplast, and a positive mutant strain is screened according to the apramycin resistance, so that a gene engineering strain knocked out by the SLCG _4846 gene is obtained. The primers 4846-P5 and 4846-P6 were used as primers for identification, plasmid pKC 1139. DELTA. 4846 was used as a positive template, LCGL genome was used as a negative template for PCR identification, and the positive deletion mutant was named as. DELTA.SLCGL-4846 (as shown in B in FIG. 2).
Example 2
Construction of SLCG-4846 Gene-recovering Strain:
the SLCG-4846 gene is amplified by using designed primers 4846-P7 and 4846-P8, and is recovered by electrophoresis, the recovered SLCG-4846 gene fragment and pIB139 are subjected to double enzyme digestion by using NdeI and XbaI endonucleases respectively and are recovered, the SLCG-4846 gene fragment is connected to pIB139 through T4 DNA ligase, and the plasmid pIB139-4846 is successfully obtained. pIB139-4846 and pIB139 were then introduced into Δ SLCGL _4846 protoplasts by the PEG-mediated transformation of protoplasts. Through the primary screening of apramycin, the apramycin resistance gene (apr, 776bp) is used as a target for PCR identification, and the obtained revertants are named as delta SLCGL _4846/pIB139-4846 and a anaplerotic empty-load strain delta SLCGL _4846/pIB139 (see figure 3).
Example 3
And (3) detecting the biomass of the streptomyces lincolensis mycelium:
respectively inoculating the Delta SLCGL-4846 mutant strain and LCGL in liquid TSBY with the same inoculation amount, carrying out shake culture at 30 ℃ for 48 hours, then transferring to 50mLYMG culture medium, carrying out shake culture at 30 ℃ and 240rpm for 7d, setting different time periods for sampling, washing with absolute ethyl alcohol, drying and weighing the dry weight of the thallus, repeatedly sampling twice each time, obtaining an average value, and drawing a thallus biomass curve according to experimental data after the measurement is finished, wherein as shown in B in figure 4, the deletion of SLCG-4846 gene does not obviously affect the biomass of the thallus.
Example 4
And (3) observing the spore morphology of the streptomyces lincolensis:
marking on an industrial culture medium, respectively coating the spore glycerol bacterial liquid of LCGL and delta SLCGL-4846 on the industrial culture medium with the same inoculation amount, airing in a super clean bench, and then placing in a constant temperature incubator at 30 ℃ for inverted growth. Spore growth was observed and recorded every 24h, and as shown in a in fig. 4, deletion of SLCG _4846 did not affect spore morphology of the cells.
Example 5
And (3) HPLC detection of the fermentation product of the streptomyces lincolensis:
coating glycerol bacterial liquid of LCGL, Δ SLCGL _4846, Δ SLCGL _4846/pIB139 and Δ SLCGL _4846/pIB139-4846 spores on slant culture medium, culturing for 7d, digging 1cm2Inoculating to a seed culture medium, carrying out shake culture at 30 ℃ for 48 hours, transferring to a fermentation culture medium, carrying out shake culture at 30 ℃ for 7 days, and centrifuging 2ml of bacterial liquid at 12000rpm for 10 min; then 200ul of supernatant is taken and added with 800ul of absolute ethyl alcohol to be mixed evenly, and centrifugation is carried out for 10 minutes at 12000 rpm; and finally, injecting the supernatant into a detection bottle through an organic filter membrane for yield detection, wherein as shown in fig. 5, compared with the original strain LCGL, the yield of the delta SLCGL _4846 mutant lincomycin A is improved by 23%, and after SLCG _4846 is supplemented in the delta SLCGL _4846, the yield of the mutant lincomycin A is restored to the level of the original strain, which indicates that SLCG _4846 plays a negative regulation role in lincomycin biosynthesis. Then, fermentation experiments are also carried out on the industrial strain LA219X, the single knock-out strain LA219X delta 4846 and the double knock-out strain LA219X delta 4846-2919, and the fermentation products are detected by HPLC to find that: as shown in FIG. 8, the yield of the single knock-out strain LA 219X. delta. 4846 was 2.80g/L, which is 11.5% higher than that of the original strain, and the yield of the double knock-out strain LA 219X. delta. 4846-E2919 was 12.1% higher than that of the single knock-out strain, which is 25.1% higher than that of the original strain. Procedure for construction of double knock-out mutants referring to example 1 above, Biomass detection and sporesThe morphological observation is as shown in examples 3 and 4, specifically in FIGS. 6 and 7.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
<110> university of Anhui
<120> method for improving lincomycin yield through streptomyces lincomosus regulation gene combination modification
<130> 1
<160> 17
<170> PatentIn version 3.3
<210> 1
<211> 28
<212> DNA
<213> Artificial sequence
<400> 1
aaaaagcttc tcagggggcg cgggatct 28
<210> 2
<211> 27
<212> DNA
<213> Artificial sequence
<400> 2
aaatctagag acagaccgac gaggcgc 27
<210> 3
<211> 29
<212> DNA
<213> Artificial sequence
<400> 3
aaatctagaa gcgacgtgga cggcctgga 29
<210> 4
<211> 29
<212> DNA
<213> Artificial sequence
<400> 4
aaagaattcg gtcgataccg gcttccgcg 29
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
gcagctcatc caggccctga 20
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<400> 6
tacgggagac gcccttggtg 20
<210> 7
<211> 29
<212> DNA
<213> Artificial sequence
<400> 7
aaacatatga tggacgcggt ggacaggca 29
<210> 8
<211> 29
<212> DNA
<213> Artificial sequence
<400> 8
aaatctagac tatgcctctt cgggcagct 29
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
gcaatacgaatggcgaaaag 20
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
ctggcggatg caggaagatc 20
<210> 11
<211> 29
<212> DNA
<213> Artificial sequence
<400> 11
aaaaagcttg gcaagccggt ggacacgct 29
<210> 12
<211> 29
<212> DNA
<213> Artificial sequence
<400> 12
aaatctagac tccgacacga cctcgtaca 29
<210> 13
<211> 29
<212> DNA
<213> Artificial sequence
<400> 13
aaagatatct tcgggctgtt ggaggcggg 29
<210> 14
<211> 29
<212> DNA
<213> Artificial sequence
<400> 14
aaagaattcc gtacagccgg tgcaggccc 29
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence
<400> 15
atggctgaga tcgggctgcg 20
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence
<400> 16
ttactcggta acgctctccg 20
<210> 17
<211> 456
<212> DNA
<213> Streptomyces lincolnensis
<400> 17
atggacgcgg tggacaggca gctcatccag gccctgaggg agaacggccg ggcctcctac 60
gcggagctgg ggcgcctcgt cggtctgtcg ggacccagcg tcaccgaccg catcaaccgg 120
ctggaggcgg ccggtgtcat caccggttac cgcgccaccg tcgacgccgc ctcgctcggc 180
ctgggcgtca ccgcgctgat cggcatctcc ctctccgacg ccgccgacca cgaggacgtg 240
gcggcccgga tgaaggacct cagcgagatc gaggactgct ggttcatcgc gggcgacgac 300
tccttcatgc tcaaggtgcg cgcgagcgac gtggacggcc tggagaagat catccggcgg 360
ctcagcggca ccaagggcgt ctcccgtacc cgtaccacca tcgtgctctc cacgaagtgg 420
gagaaccggg tcggggagct gcccgaagag gcatag 456
Claims (2)
1. A method for improving lincomycin yield through streptomyces lincomycin regulation gene combination modification is characterized in that traceless knockout is carried out by utilizing homologous recombination, resistance genes are not introduced in the knockout process, knockout experiments can be continuously carried out for multiple times in the same strain, specifically, genes coding for an Lrp family transcription regulation factor SLCG-4846 and a TetR family transcription regulation factor SLCG-2919 in streptomyces lincomycin are obtained after being subjected to combined knockout, and lincomycin is produced through fermentation by using the strain.
2. The method for improving lincomycin production through streptomyces lincomycin regulatory gene combination modification as claimed in claim 1, wherein the method is characterized in thatSLCG_4846The gene product can negatively regulate the biosynthesis of lincomycin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011140715.9A CN112251456B (en) | 2020-10-22 | 2020-10-22 | Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011140715.9A CN112251456B (en) | 2020-10-22 | 2020-10-22 | Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112251456A CN112251456A (en) | 2021-01-22 |
| CN112251456B true CN112251456B (en) | 2022-05-03 |
Family
ID=74264191
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011140715.9A Active CN112251456B (en) | 2020-10-22 | 2020-10-22 | Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251456B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113755517B (en) * | 2021-10-18 | 2023-04-07 | 安徽大学 | Construction method and application of SLCG _5407 gene modified streptomyces lincolnensis |
| CN114317390A (en) * | 2021-12-24 | 2022-04-12 | 安徽大学 | Seed culture medium for streptomyces lincolnensis genetic engineering bacteria and method for producing lincomycin by culture and fermentation |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107881190B (en) * | 2017-11-15 | 2021-02-09 | 安徽大学 | Method for improving lincomycin yield by modifying streptomyces lincolnensis SLCG _2919 gene |
| CN107746826A (en) * | 2017-11-22 | 2018-03-02 | 安徽大学 | A kind of method by co-expressing metK1 and metK2 genes raising lincomycin yield in Str. lincolnensis |
| CN110484481B (en) * | 2019-07-17 | 2022-04-15 | 安徽大学 | Method for improving lincomycin yield by modifying streptomyces lincolnensis SLCG _3128 gene |
| CN111117942B (en) * | 2020-01-16 | 2021-05-25 | 华东理工大学 | Genetic engineering bacterium for producing lincomycin and construction method and application thereof |
-
2020
- 2020-10-22 CN CN202011140715.9A patent/CN112251456B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112251456A (en) | 2021-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106520866B (en) | Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene | |
| CN112251456B (en) | Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification | |
| CN110157756B (en) | Method for improving erythromycin yield by modifying saccharopolyspora erythraea SACE _0303 gene | |
| CN102952813B (en) | Synthetic method and extraction process of blue natural dye | |
| CN111621458B (en) | BVG90_11450 gene-deleted serratia marcescens engineering bacterium | |
| CN107881190B (en) | Method for improving lincomycin yield by modifying streptomyces lincolnensis SLCG _2919 gene | |
| Jeong et al. | Genetic engineering system for syngas-utilizing acetogen, Eubacterium limosum KIST612 | |
| CN108490193B (en) | Based on transcription group secondary metabolism of Streptomyces strong promoter method for digging and application | |
| CN110484481B (en) | Method for improving lincomycin yield by modifying streptomyces lincolnensis SLCG _3128 gene | |
| CN109321618B (en) | Method for improving erythromycin yield through saccharopolyspora erythraea SACE _5717 gene | |
| CN111154705B (en) | Bacillus thermoglucosidasius engineering bacterium and construction method and application thereof | |
| CN109136253B (en) | Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _5754 gene approach | |
| CN110174514B (en) | Streptomyces secondary metabolism efficient promoter mining method based on proteomics and application | |
| WO2020048125A1 (en) | Construction and application of efficient streptomyces genome simplification system | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| CN115806922A (en) | Genetically engineered strain of zymomonas mobilis and application thereof | |
| CN111363710B (en) | Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _4839 gene pathway | |
| CN111849790B (en) | Recombinant cephalosporium acremonium engineering bacteria and construction method and application thereof | |
| CN111197019B (en) | Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _1906 gene approach | |
| CN111718884B (en) | BVG90_08615 gene-deleted serratia marcescens engineering bacterium | |
| WO2018056794A1 (en) | Microorganism capable of utilizing acetic acid as sole carbon source | |
| CN113755517B (en) | Construction method and application of SLCG _5407 gene modified streptomyces lincolnensis | |
| CN112779174B (en) | Saccharomyces cerevisiae genetically engineered bacterium for knocking out Cln3 gene, construction method and application thereof | |
| CN112458136A (en) | Saccharopolyspora erythraea with modified SACE-1409 gene and application thereof | |
| CN103740789A (en) | Method for improving fermentation level of validamycin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |