CN106520866B

CN106520866B - Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene

Info

Publication number: CN106520866B
Application number: CN201611146639.6A
Authority: CN
Inventors: 张部昌; 任少华; 汪焰胜; 吴杭; 王春宇; 王浩; 高娟子
Original assignee: Anhui University
Current assignee: Anhui University
Priority date: 2016-12-13
Filing date: 2016-12-13
Publication date: 2021-01-01
Anticipated expiration: 2036-12-13
Also published as: CN106520866A

Abstract

The invention discloses a saccharopolyspora erythraea by modifyingSACE_3980A method for increasing the output of erythrocin by gene engineering of the deletion of the TetR family transcription regulation gene in saccharopolyspora erythraeaSACE_3980The erythromycin high-yield engineering strain is obtained, and the yield can be greatly improved by fermenting and producing the erythromycin by using the obtained strain, thereby providing a new technical support for improving the yield of the erythromycin in industrial production.

Description

Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for improving the yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene.

Background

The erythromycin is generated by secondary metabolism of saccharopolyspora erythraea, belongs to a typical polyketide antibiotic, and comprises the components of erythromycin A (Er-A), erythromycin B (Er-B), erythromycin C (Er-C), erythromycin D (Er-D), erythromycin E (Er-E), erythromycin F (Er-F) and the like. The antibiotics have broad-spectrum antibacterial action, the antibacterial spectrum of the antibiotics is similar to that of penicillin, and the antibiotics have strong inhibition effect on gram-positive bacteria. The clinical widely used of each component of erythromycin is erythromycin A, which has the highest bacteriostatic activity, while chemical derivatives of erythromycin series (clarithromycin, azithromycin, roxithromycin, telithromycin, etc.) are also widely used for treating infectious diseases, and the annual sales of erythromycin and its derivatives reaches hundreds of billions of dollars.

Erythromycin plays an important role in the field of medicine, but the yield thereof is still to be improved. The traditional method for improving the yield of the erythromycin A by optimizing the fermentation conditions is time-consuming and uneconomical, and is not suitable for wide application. And the copy number of the synthetic gene is increased in the chromosome of the saccharopolyspora erythraea by a gene engineering method, or the regulatory gene is modified by a gene knockout method to obtain the erythromycin high-yield strain, so that the method has good prospect.

In 2003, Rodriguez et al reported that erythromycin high yield was mainly due to its regulatory gene rather than a synthetic gene, and further led us to focus on research on regulatory genes. In 2005, Ramos et al, based on sequence similarity, structure and function, classified prokaryotic transcriptional regulators into 16 families, LysR, AraC/xylS, TetR, LuxR, LacI, ArsR, IcIR, MerR, AsnC, MarR, NtrC (EBP), OmpR, DeoR, Cold shock, GntR and Crp. Wherein, the TetR family regulation gene has high conservation on the DNA binding structural domain and is widely involved in regulating and controlling biological activities such as multi-drug resistance, antibiotic synthesis, osmotic stress response and the like. Recently, various TetR family transcriptional regulators involved in morphological differentiation of antibiotics or streptomycetes, such as SCO1712, SAV151, SAV576, jadY, atrA, etc., have been reported, suggesting the importance of TetR family regulatory genes in secondary metabolism of streptomycetes and biosynthesis of antibiotics. There are 101 TetR family genes in the whole genome of saccharopolyspora erythraea, however, the research on secondary metabolic TetR family regulatory genes of saccharopolyspora erythraea is still very rare, and only the regulatory genes SACE _7040, SACE _0012 and the regulatory genes SACE _5599, SACE _3986, SACE _3446, SACE _7301, etc., which are involved in regulating morphological differentiation of saccharopolyspora erythraea, are reported, and the explanation on the precise mechanism for regulating erythromycin yield is not clear.

Disclosure of Invention

The invention aims to provide a method for improving the yield of erythromycin by deleting a negative control gene SACE _3980 in saccharopolyspora erythraea and modifying a gene SACE _3980 of saccharopolyspora erythraea.

The invention is realized by the following technical scheme:

a method for improving the yield of erythrocin by modifying a saccharopolyspora erythraea SACE _3980 gene is characterized in that: the SACE _3980 gene in the saccharopolyspora erythraea is inactivated through a genetic engineering way to obtain a saccharopolyspora erythraea erythromycin high-yield engineering strain, and the strain is used for producing erythromycin through fermentation.

The method for improving the yield of the erythromycin by modifying the saccharopolyspora erythraea SACE _3980 gene is characterized in that the SACE _3980 gene product can negatively regulate and control the biosynthesis of the erythromycin.

The application of the SACE _3980 gene in industrial strains is characterized in that: a TetR family transcriptional gene SACE _3980 is deleted in an industrial high-yield strain to obtain a high-yield mutant strain which can be used for producing erythromycin.

The invention has the advantages that:

in the research of the invention, an erythromycin biosynthesis negative regulator SACE _3980 is screened, and an erythromycin high-yield strain can be obtained by deleting SACE _3980 gene copy on a saccharopolyspora erythraea chromosome through a genetic engineering approach, so that technical support is provided for improving the erythromycin fermentation yield in industrial production.

When SACE _3980 gene is knocked out from the saccharopolyspora erythraea A226, the yield of erythromycin is improved by 29.3%, and when SACE _3980 gene is supplemented in the delta SACE _3980 deletion mutant strain, the yield of erythromycin is recovered, which indicates that SACE _3980 is a negative regulatory factor involved in erythromycin biosynthesis. The industrial high-yield strain WB is used as an initial strain, and the SACE _3980 gene is deleted on the chromosome of the industrial high-yield strain WB, so that the erythromycin yield is improved by 15.8 percent, and the technology of deleting the SACE _3980 gene to improve the erythromycin yield is also applicable to the industrial high-yield strain.

Drawings

FIG. 1: position information of the SACE _3980 gene and the neighboring genes on the chromosome;

FIG. 2: the invention discloses a technical scheme of homologous recombination of chromosome segments and PCR identification of deletion mutant strains,

(A) a schematic diagram of the construction of the delta SACE-3980 mutant,

(B) PCR identification of Δ SACE _3980 mutant: the SACE _3980 gene (639bp) is replaced by tsr resistance gene (1360bp) and then the length is 1727 bp; m,5000bp DNA Marker;

FIG. 3: antibacterial analysis of a starting strain A226 and a deletion mutant strain delta SACE-3980 and daily yield analysis of erythromycin A,

(A) bacteriostatic analysis of A226 original strain and delta SACE-3980 mutant strain fermentation liquor,

(B) HPLC analysis of erythromycin A products of the original strain A226 and the deletion mutant strain delta SACE _3980 for six days;

FIG. 4: SACE-3980 gene reversion, construction of over-expression strain and erythromycin A yield analysis,

(A) A226/pIB139-3980 complementation and PCR identification of over-expression strain, wherein the PCR product is apr resistance gene (776 bp); m,5000bp DNA Marker,

(B) HPLC analysis of a starting strain A226, a deletion mutant strain delta SACE _3980, a deletion complementation strain and a complementation no-load control strain, an overexpression strain A226/pIB139-3980 and an overexpression no-load control strain erythromycin A;

FIG. 5: the influence of the SACE _3980 gene on the morphological differentiation of the strain and the measurement of the biomass of the mutant strain of the delta SACE _3980,

(A) spore outgrowth of the Δ SACE _3980 mutant and wild-type a226 strain, wherein 1: a226 strain, 2: Δ SACE — 3980 mutant, 3: the revertant strain delta SACE _3980/pIB139-3980, 4: over-expression strain A226/pIB139-3980,

(B) bioassay of mycelia of the Δ SACE _3980 mutant strain and the wild-type a226 strain.

FIG. 6: construction of an industrial high-yield erythromycin strain WB/SACE _3980 deletion mutant strain and erythromycin A yield analysis,

(A) PCR identification of WB/Δ SACE _3980 mutant: the SACE _3980 gene (639bp) is replaced by tsr resistance gene (1360bp) and then the length is 1727 bp; m,5000bp DNA Marker,

(B) HPLC analysis of the yield of erythromycin A of the high-producing strain WB and the deletion mutant WB/. DELTA.SACE-3980.

Detailed Description

Example 1

1.1 strains, plasmids and growth conditions

The strains and plasmids used in the experiments are shown in Table 1. Coli were cultured on liquid LB medium at 37 ℃ or on solid LB plates supplemented with 1.25% agar. Erythromycin producing bacteria Rhodosporidium and its engineered strain were cultured in Tryptone Soy Broth (TSB) medium at 30 ℃ or on R3M plates containing 2.2% agar.

1.2 materials, DNA manipulation and sequencing

PEG3350, lysozyme, TES, casamino acids, thiostrepton, apramycin were purchased from Sigma. TSB, yeast extract, peptone were purchased from Oxoid. Glycine, agar powder, sodium chloride and other biological reagents were purchased from reagent companies. General procedures for E.coli and Rhodotorula saccharopolyspora were performed according to standard procedures. The synthesis of primers and DNA sequencing were performed by Biotechnology engineering (Shanghai) Inc.

Table 1 strains and plasmids used in the study

TABLE 2 primers synthesized by the present invention

1.3 construction of deletion mutant of SACE _3980 Gene

The sequences of the primers synthesized in the assay are shown in Table 2. The pUCTSR plasmid is obtained by inserting 1360bp thiostrepton peptide resistance gene (tsr) between BamH I and Sma I cleavage sites of pUC 18. In order to knock out the SACE _3980 gene in the Saccharopolyspora erythraea, about 1.5kb homologous fragments of the SACE _3980 gene at the upstream and downstream are respectively amplified by PCR by using 3980-P1/3980-P2 and 3980-P3/3980-P4 as primers and the Saccharopolyspora erythraea A226 genome as a template.

Respectively connecting the two 3980-U and 3980-D upstream and downstream fragments to two sides of a tsr resistance gene sequence of pUCTSR to complete construction of a plasmid pUCTSR delta 3980; 3980-P1 and 3980-P4 are used as primers, a pUCTSR delta 3980 plasmid is used as a template, a 3980U-tsr-D large fragment is amplified by PCR, a chromosome fragment homologous recombination technology is utilized to transform the 3980U-tsr-D large fragment into saccharopolyspora erythraea protoplast, a positive mutant strain is screened according to thiostrepton resistance, and a genetic engineering strain with the SACE _3980 gene replaced by tsr is obtained. The PCR identification was carried out using 3980-P5 and 3980-P6 as identification primers, plasmid pUCTSR. DELTA.3980 as a positive template and A226 genome as a negative template, and the positive deletion mutant was named as. DELTA.SACE-3980 (see FIG. 3A).

1.4 construction of the Sace _3980 Gene-recovering Strain

The SACE _3980 gene is amplified by using designed primers 3980-P7 and 3980-P8 and recovered by electrophoresis, the recovered SACE _3980 gene fragment and pIB139 are subjected to double enzyme digestion by using NdeI and Xba I endonucleases respectively and recovered, and the SACE _3980 gene fragment is connected to the pIB139 through T4DNA ligase, so that the integrative plasmid pIB139-3980 is successfully obtained. pIB139-3980 was then introduced into Δ SACE _3980 protoplasts by the PEG-mediated transformation of protoplasts. Through the primary screening of apramycin, PCR identification is carried out by taking an apramycin resistance gene (apr) as an object, and the obtained revertant strain is named as delta SACE _3980/pIB 139-3980.

1.5 overexpression of SACE _3980 Gene in starting Strain A226

pIB139-3980 is introduced into Rhodosporidium glycopolyspora A226 protoplast by PEG mediated protoplast transformation technology, PCR identification is carried out by taking an apramycin resistance gene (apr) as an object, and the obtained positive strain is named as A226/pIB 139-3980.

1.6 Glycidopolyspora erythraea fermentation product HPLC detection

Inoculating saccharopolyspora erythraea into a TSB culture medium, carrying out shake culture at 30 ℃ for 48 hours, transferring to an R5 liquid culture medium, carrying out shake culture at 30 ℃ for 144 hours, extracting fermentation liquor by using an organic solvent, evaporating to dryness by using a water bath kettle, adding 1mL of methanol for dissolving, treating by using a 0.22 mu m organic filter membrane, and then detecting the content of erythromycin A in a sample by using a computer.

1.7 Glycidosporium Saccharopolyspora mycelium Biomass detection

Respectively inoculating the delta SACE _3980 mutant strain and A226 strain into 30mL of liquid TSB with the same inoculation amount, carrying out shake cultivation for 48 hours at 30 ℃, then transferring the mutant strain into an R5 culture medium, carrying out shake cultivation for 144 hours at 30 ℃ and 220rpm, setting different time periods for sampling, washing the strain with absolute ethyl alcohol, drying and weighing the dry weight of the strain, repeatedly sampling twice each time, obtaining an average value, and drawing a strain biomass curve according to experimental data after the measurement is finished.

1.8 construction and HPLC detection of industrial high-yield erythromycin WB/delta SACE _3980 strain

SACE _3980 was deleted from an industrial high-producing strain WB of erythromycin, and it was confirmed that the correct strain was named WB/. DELTA.SACE _ 3980. And carrying out HPLC detection on the WB high-yield strain and the fermentation product of the deletion mutant strain WB/delta SACE _ 3980. Mutant construction procedure and HPLC assay refer to methods 1.3 and 1.6 above.

And (4) analyzing results:

2.1 the deletion mutant strain delta SACE _3980 has higher yield of erythromycin than the original strain A226.

The location of SACE _3980 and adjacent genes on the chromosome of Rhodotorula saccharopolyspora is shown in FIG. 1. The construction process of SACE _3980 gene deletion mutant A226/delta SACE _3980 is shown in FIG. 2A. The SACE _3980 gene deletion mutant contains 30 mu g ml^-1Thiostrepton was screened on an R3M plate and confirmed by PCR (see FIG. 2B).

Fermenting the delta SACE _3980 in an R5 liquid culture medium for 6 days (144h), and centrifuging to collect a fermentation supernatant; spotting on the surface of an LB plate containing bacillus subtilis liquid, culturing for 12 hours at 37 ℃, and observing the size of a bacteriostatic zone on the plate, wherein the result shows that: the fermentation broth inhibition zone of SACE _3980 is significantly larger than that of A226 (see FIG. 3A), and it is preliminarily concluded that SACE _3980 gene may be down-regulated in erythromycin production.

After the fermentation liquor is extracted, the yield of the erythromycin A per day is detected by HPLC, and the yield of the delta SACE _3980 is improved by 28.3 percent on the sixth day compared with the yield of the starting strain A226 (see figure 3B), and the HPLC result shows that the SACE _3980 is a negative regulator participating in the biosynthesis of the erythromycin again.

2.2 SACE _3980 Gene reversion and overexpression.

To verify that the improvement of erythromycin yield in the mutant Δ SACE _3980 is caused by the deletion of the SACE _3980 gene, the expression vectors pIB139-3980 and pIB139 of the SACE _3980 gene (as controls) were introduced into protoplasts of the Δ SACE _3980 mutant and the starting strain a226, respectively, to obtain a revertant strain and an empty Δ SACE _3980/pIB139-3980, Δ SACE _3980/pIB139, an overexpression strain and empty a226/pIB139-3980, a226/pIB139, and PCR identification was performed (see fig. 4A). And then performing shake flask fermentation on the A226 and delta SACE _3980 series mutant strains, wherein HPLC detection results show that: the yield of the erythromycin A of the delta SACE _3980 is increased by 29.3 percent compared with that of A226; the yield of the erythromycin A of the recovered strain delta SACE _3980/pIB139-3980 is basically recovered compared with that of A226; the erythromycin A production of A226/pIB139-3980 was reduced by about 20% compared to A226 (see FIG. 4B); HPLC detection results further indicate that SACE _3980 gene can down-regulate the biosynthesis of erythromycin A.

2.3 Effect of deletion of SACE _3980 Gene on growth of thallus and differentiation of spore morphology.

The dry weight of the cells of the mutant strain of the SACE _3980 and the strain A226 after fermentation for 6 days is measured, and a corresponding change curve is drawn, so that the result shows that the biomass of the SACE _3980 is not greatly different from that of the A226 (see figure 5A), and the fact that the deletion of the SACE _3980 gene does not influence the primary metabolism of the cells is suggested.

In order to determine whether the SACE _3980 gene regulates the sporulation of thalli, a mutant strain delta SACE _3980, a revertant strain delta SACE _3980/pIB139-3980, an overexpression strain A226/pIB139-3980 and a wild type control strain A226 are coated on an R3M plate at the same time, cultured for 72 hours at 30 ℃, and the spore growth condition of the strains is observed. The results show no significant difference in spore morphology of the Δ SACE _3980 mutant compared to a226 (fig. 5B), indicating that deletion of the SACE _3980 gene does not affect spore formation.

2.4 the improved industrial high-producing strain WB/delta SACE _3980 has improved erythromycin production.

Firstly, the construction of WB/delta SACE _3980 mutant strain is carried out, the construction process is shown in FIG. 2A, and the PCR identification is shown in FIG. 6A. And then, plate coating and activating the WB/delta SACE _3980 mutant strain and the industrial high-yield strain WB, respectively inoculating the WB and the industrial high-yield strain WB into shake flasks of an industrial seed culture medium, culturing the WB and the industrial high-yield strain WB for 2 days at the rotation speed of 220rpm at the temperature of 30 ℃, transferring the WB and the industrial high-yield strain WB into an industrial fermentation culture medium, and continuously culturing. After the fermentation, the extraction concentration is analyzed by HPLC, and compared with the starting strain WB, the yield of erythromycin of WB/delta SACE _3980 is respectively improved by 15.8 percent (see figure 6B). This indicates that SACE _3980 gene in the high producing strain WB is also involved in regulating the production of erythromycin.

CCCAAGCTTGCGGTGTTCATCAGCGCGAT

GCTCTAGAGCTCGACGAACAGCCGGATG

CGGGGTACCAGATCACCACCGTCCTGCG

CCGGAATTCAGCCTCAACGTGCGGTTCA

GCATGCCACAAAGGCTAACTCGGT

AAGTCAGCACAGGCGTCCTCAGT

GGAATTCCATATGATGGCGGTCATGAGCGAGCC

GCTCTAGATCAGCCGCAGCAGGCGGCC

GGAGTGCATATGGTGCAATACGAATGGCGAAAAG

CTCAAAGCTTCAGCCAATCGACTGGCGAGCG

Claims

1. A method for improving the yield of erythrocin by modifying a saccharopolyspora erythraea SACE _3980 gene is characterized in that: the SACE _3980 gene in the saccharopolyspora erythraea is inactivated through a genetic engineering way to obtain a saccharopolyspora erythraea erythromycin high-yield engineering strain, and the strain is used for producing erythromycin through fermentation.

2. The method of claim 1, wherein the SACE _3980 gene is capable of negatively regulating erythromycin biosynthesis, comprising modifying the SACE _3980 gene of Rhodosporidium saccharopolyspora.

3. The method for improving the yield of erythromycin by modifying a Sace _3980 gene of Rhodosporidium saccharopolyspora according to claim 1, wherein the method comprises the following steps: a TetR family transcriptional gene SACE _3980 is deleted in an industrial high-yield strain to obtain a high-yield mutant strain which can be used for producing erythromycin.