CN106520866A - Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene - Google Patents

Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene Download PDF

Info

Publication number
CN106520866A
CN106520866A CN201611146639.6A CN201611146639A CN106520866A CN 106520866 A CN106520866 A CN 106520866A CN 201611146639 A CN201611146639 A CN 201611146639A CN 106520866 A CN106520866 A CN 106520866A
Authority
CN
China
Prior art keywords
sace
erythromycin
gene
strain
red
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201611146639.6A
Other languages
Chinese (zh)
Other versions
CN106520866B (en
Inventor
张部昌
任少华
汪焰胜
吴杭
王春宇
王浩
高娟子
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui University
Original Assignee
Anhui University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui University filed Critical Anhui University
Priority to CN201611146639.6A priority Critical patent/CN106520866B/en
Publication of CN106520866A publication Critical patent/CN106520866A/en
Application granted granted Critical
Publication of CN106520866B publication Critical patent/CN106520866B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
    • C12P19/62—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin the hetero ring having eight or more ring members and only oxygen as ring hetero atoms, e.g. erythromycin, spiramycin, nystatin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses a saccharopolyspora erythraea by modifyingSACE_3980A method for increasing the output of erythrocin by gene engineering of the deletion of the TetR family transcription regulation gene in saccharopolyspora erythraeaSACE_3980The erythromycin high-yield engineering strain is obtained, and the yield can be greatly improved by fermenting and producing the erythromycin by using the obtained strain, thereby providing a new technical support for improving the yield of the erythromycin in industrial production.

Description

Yield of erythrocin is improved by transforming the red mycete SACE_3980 genes of sugared many spores Method
Technical field
The present invention relates to gene engineering technology field, and in particular to a kind of by transforming the red mycete SACE_3980 of sugared many spores The method that gene improves yield of erythrocin.
Background technology
Erythromycin is produced by the red mycete cometabolism of sugared many spores, belongs to typical polyketide, and its component includes Erythromycin A (Er-A), berythromycin (Er-B), Erythromycin C (Er-C), Erythromycin D (Er-D), Erythromycin E (Er-E) and erythromycin F (Er-F) etc..Such antibiosis have broad-spectrum antibacterial action, and its antimicrobial spectrum is similar to penicillin, has stronger to gram positive bacteria Inhibitory action.Clinically wide variety of in erythromycin each component is Erythromycin A, its bacteriostatic activity highest, and erythromycin system Row chemical derivative (clarithromycin, Azithromycin, Roxithromycin, Ketek etc.) is also widely used for treating infectious disease Disease, the annual sales volume of erythromycin and its derivant reach tens billion of dollars.
Erythromycin has important function in field of medicaments, but its yield still has much room for improvement.Traditional optimization of fermentation conditions is improved The method of Erythromycin A yield is time-consuming and uneconomical, is not suitable for extensively application.And by engineered method, it is red in sugared many spores Increase the copy number of synthetic gene in mycete chromosome, or transform controlling gene to obtain erythromycin by the method for gene knockout Superior strain, has good prospect.
The report erythromycin high yield such as Rodriguez in 2003 is mainly due to its controlling gene, rather than synthetic gene, more Make us that research emphasis are turned to regulator gene.2005, Ramos etc. was standard by original with sequence similarity, 26S Proteasome Structure and Function Core biology transcription regulator be divided into LysR, AraC/XylS, TetR, LuxR, LacI, ArsR, IcIR, MerR, AsnC, MarR, NtrC (EBP), OmpR, DeoR, Cold shock, GntR and Crp totally 16 families.Wherein TetR families controlling gene is in DNA There are the conservative of height, wide participation regulation and control multi-drug resistance, antibiotic synthesis, osmotic stress reaction etc. raw on binding structural domain Thing activity.Various TetR families transcription regulators for participating in antibiotic or streptomycete Morphological Differentiation are reported in recent years, such as SCO1712, SAV151, SAV576, jadY, atrA etc., imply TetR families controlling gene in secondary metabolism of Streptomyces and resist Importance in raw element biosynthesiss.There are 101 TetR family genes in the red mycete full-length genome of many spores of sugar, however it is many with regard to sugar Still seldom, the only participation of report regulates and controls the red mycete shape of sugared many spores to the red mycete cometabolism TetR families controlling gene research of spore Controlling gene SACE_7040, SACE_0012 and regulation and control erythromycin anabolism gene SACE_5599, SACE_ of state differentiation 3986, SACE_3446, SACE_7301 etc., and it is also unclear for what its precise mechanism for adjusting yield of erythrocin was illustrated.
The content of the invention
The object of the invention is exactly to pass through to lack negative regulator gene SACE_3980 in the red mycete of sugared many spores, many by transforming sugar The red mycete SACE_3980 genes of spore improve yield of erythrocin method.
The present invention is achieved by the following technical solutions：
It is a kind of to improve yield of erythrocin method by transforming the red mycete SACE_3980 genes of sugared many spores, it is characterised in that：It is logical Crossing genetic engineering approach makes SACE_3980 gene inactivations in the red mycete of sugared many spores, obtains the red mycete erythromycin high yield work of sugared many spores Journey bacterial strain, with described strain fermentation production erythromycin.
Described one kind improves yield of erythrocin method, its feature by transforming the red mycete SACE_3980 genes of sugared many spores It is that described SACE_3980 gene outcomes can be with negative regulation erythromycin biosynthesiss.
Application of the SACE_3980 genes in industrial strain, it is characterised in that：TetR house is lacked in high industrial production bacterial strain Race open gene SACE_3980, obtains high productive mutant, can be used for erythromycin production.
It is an advantage of the invention that：
Erythromycin biosynthesiss negative regulator SACE_3980 is screened in present invention research, by genetic engineering approach SACE_3980 gene copies on the red mycete chromosome of sugared many spores are lacked, erythromycin superior strain is obtained in that, is that commercial production is carried Homoerythromycin fermentation yield provides technical support.
When knocking out SACE_3980 genes in the red mycete A226 of many spores of sugar, yield of erythrocin improves 29.3%, and in Δ SACE_3980 genes are covered in SACE_3980 deletion mutation strains, yield of erythrocin is restored, and shows that SACE_3980 is one Participate in the biosynthetic negative regulatory factor of erythromycin.By the use of high industrial production bacterial strain WB as starting strain, lack on its chromosome SACE_3980 genes are lost, makes yield of erythrocin improve 15.8%, illustrate that lacking SACE_3980 genes improves yield of erythrocin Technology is equally applicable in high industrial production bacterial strain.
Description of the drawings
Fig. 1：SACE_3980 genes and periphery contiguous gene positional information on chromosome；
Fig. 2：The chromosome segment homologous recombination technique schematic diagram of the present invention and the PCR identifications of deletion mutation strain,
(A) Δ SACE_3980 mutation constructions schematic diagram,
(B) the PCR identifications of Δ SACE_3980 mutants：SACE_3980 genes (639bp) are by tsr resistant genes (1360bp) after replacing, length is changed into 1727bp；M,5000bp DNA Marker；
Fig. 3：The antibacterial analysis of starting strain A226 and deletion mutation strain Δ SACE_3980 and Erythromycin A output per day point Analysis,
(A) the antibacterial analysis of A226 starting strains and Δ SACE_3980 mutant fermentation liquids,
(B) the HPLC analyses of six days Erythromycin A products of starting strain A226 and deletion mutation strain Δ SACE_3980；
Fig. 4：The reply of SACE_3980 genes, the structure of overexpression bacterial strain and Erythromycin A volume analyses,
(A) the PCR identifications of A226/pIB139-3980 covering, overexpression bacterial strain:PCR primer is apr resistant genes (776bp)；M, 5000bp DNA Marker,
(B) starting strain A226, deletion mutation strain Δ SACE_3980, disappearance covering bacterial strain and the unloaded control strain of covering, The HPLC analyses of overexpression bacterium A226/pIB139-3980 and overexpression zero load control strain Erythromycin A；
Fig. 5：The impact of SACE_3980 gene pairss strain morphology differentiation and the measure of Δ SACE_3980 mutant Biomass,
(A) the spore growth situation of Δ SACE_3980 mutants and wild type A226 bacterial strains, wherein 1：A226 bacterial strains, 2： Δ SACE_3980 mutants, 3：Reply bacterial strain Δ SACE_3980/pIB139-3980,4：Overexpression strains A 226/pIB139- 3980,
(B) Δ SACE_3980 mutants and the mycelial biomass estimation of wild type A226 bacterial strains.
Fig. 6：The structure of erythromycin high industrial production bacterial strain WB/SACE_3980 deletion mutation strains and Erythromycin A volume analyses,
(A) the PCR identifications of WB/ Δs SACE_3980 mutants：SACE_3980 genes (639bp) are by tsr resistant genes (1360bp) after replacing, length is changed into 1727bp；M, 5000bp DNA Marker,
(B) the HPLC analyses of superior strain WB and deletion mutation strain WB/ Δ SACE_3980 Erythromycin A yield.
Specific embodiment
Embodiment 1
1.1 bacterial strains, plasmid and growth conditionss
Used in test to bacterial strain and plasmid be shown in Table 1.Escherichia coli 37 DEG C LB liquid medium or addition Cultivate on the solid LB flat boards of 1.25% agar.The red mycete of many spores of erythromycin producing strain sugar and its engineered strain are in 30 DEG C of Trypsins Peptone soybean broth (TSB) culture medium is cultivated on the R3M flat boards containing 2.2% agar.
1.2 materials, DNA operations and sequencing
PEG3350, lysozyme, TES, casamino acid, thiostrepton, apramycin are bought from Sigma companies.TSB、 Yeast extract, peptone are bought in Oxoid companies.Glycine, agar powder, Sodium Chloride and other biological reagents are all purchased from examination Agent company.The general operation technology of escherichia coli and the red mycete of sugared many spores is according to standard operation.The synthesis of primer and DNA sequencing by Sangon Biotech (Shanghai) Co., Ltd. completes.
Strain used and plasmid in the research of table 1
2 present invention of table builds the primer of synthesis
The structure of 1.3 SACE_3980 deletion mutant bodies
The primer sequence synthesized in test is shown in Table 2.PUCTSR plasmids are the BamH I and Sma I restriction enzyme sites in pUC18 Between insert 1360bp thiostrepton resistance gene (tsr).In order to knock out the SACE_3980 bases in the red mycete of sugared many spores Cause, respectively with 3980-P1/3980-P2 and 3980-P3/3980-P4 be primer, the red mycete A226 genomes of sugared many spores be template, The homologous fragment of each about 1.5kb in upstream and downstream of PCR amplification SACE_3980 genes.
Above-mentioned two 3980-U and 3980-D upstream and downstream fragments are connected respectively to the tsr resistant gene sequences of pUCTSR respectively Row both sides, complete to build plasmid pUCTSR Δs 3980；With 3980-P1 and 3980-P4 as primer, 3980 plasmid of pUCTSR Δs is as mould 3980U-tsr-D large fragments are converted by plate, PCR amplification 3980U-tsr-D large fragments using chromosome segment homologous recombination technique In the red mycete protoplast of many spores of sugar, Positive mutants strain is screened according to thiostrepton resistance, obtain SACE_3980 gene quilts The engineering strain that tsr is replaced.Using 3980-P5 and 3980-P6 as identification primer, with plasmid pUCTSR Δs 3980 as positive Template, A226 genomes enter performing PCR identification for negative template, and positive deletion mutant is named as Δ SACE_3980 (see Fig. 3 A).
1.4 SACE_3980 genes reply the structure of bacterial strain
SACE_3980 genes are amplified using the primer 3980-P7 and 3980-P8 of design, and electrophoresis is reclaimed, using NdeI Double digestion is carried out with pIB139 and is reclaimed with SACE_3980 genetic fragments of the Xba I restriction endonucleases respectively to being recovered to, passed through T4DNA ligases are connected to SACE_3980 genetic fragments on pIB139, successfully obtain integrative plasmid pIB139-3980.So PIB139-3980 is imported in Δ SACE_3980 protoplasts by the protoplast transformation method that PEG is mediated afterwards.By peace General mycin preliminary screening, enters performing PCR identification by object of apramycin resistance gene (apr), and the reply Strain Designation of acquisition is ΔSACE_3980/pIB139-3980。
Overexpression SACE_3980 genes in 1.5 starting strain A226
The red mycete A226 protoplasts of many spores of protoplast transformation technological sourcing sugar that pIB139-3980 is mediated by PEG In, enter performing PCR identification by object of apramycin resistance gene (apr), obtain positive strain and be named as A226/pIB139- 3980。
The red mold fermentation product HPLC detections of 1.6 sugared many spores
The red mycete of sugared many spores is inoculated with TSB culture medium, after 30 DEG C of shaken cultivation 48 hours, R5 liquid cultures is forwarded to Base, 30 DEG C of shaken cultivation 144 hours, is then extracted to fermentation liquid using organic solvent, after being evaporated using water-bath, is added 1mL methanol dissolves and uses 0.22 μm of organic filter membrane to process, and goes up the Erythromycin A content in machine testing sample afterwards.
The red fungal hyphae body Biomass detection of 1.7 sugared many spores
Respectively Δ SACE_3980 mutants are inoculated in the liquid TSB of 30mL with A226 with identical inoculum concentration, 30 DEG C After shaking table culture 48 hours, 30 DEG C of rotating speed 220rpm shaking table cultures are transferred in R5 culture medium 144 hours, when period arranges different Between section sampling, weigh dry cell weight with washes of absolute alcohol post-drying, each repeated sampling twice, and obtains meansigma methodss, measures Fungal biodiversity curve is drawn according to experimental data after end.
The structure of 1.8 erythromycin high industrial production bacterial strain WB/ Δ SACE_3980 bacterial strains and HPLC detections
SACE_3980 is lacked in erythromycin high industrial production bacterial strain WB, verifies that correct Strain Designation is WB/ Δ SACE_ 3980.And the tunning by WB superior strains with deletion mutation strain WB/ Δ SACE_3980 carries out HPLC detections.Mutant structure Process and HPLC detections are built with reference to above-mentioned 1.3 and 1.6 methods.
Interpretation of result：
2.1 deletion mutation strain Δ SACE_3980 are improved compared with starting strain A226 yield of erythrocin.
SACE_3980 is shown in Fig. 1 with position of the gene on the red mycete chromosome of sugared many spores is closed on.SACE_3980 genes lack Lose mutant A226/ Δ SACE_3980 building processs and see Fig. 2A.SACE_3980 deletion mutants body is containing 30 μ g ml-1 Screen on the R3M flat boards of thiostrepton and confirmed (see Fig. 2 B) by PCR.
Δ SACE_3980 ferments in R5 fluid mediums 6 days (144h), and fermented supernatant fluid is collected by centrifugation；Point sample is in containing The LB planar surfaces of bacillus subtilises bacterium solution, 37 DEG C culture 12 hours after observe flat board on inhibition zone size, as a result show：Δ The fermentation liquid inhibition zone of SACE_3980 is compared with A226 substantially (see Fig. 3 A) bigger than normal, preliminary to infer that SACE_3980 genes are probably negative tune Save the yield in erythromycin.
After fermentation liquid is extracted, Jing HPLC detect daily Erythromycin A yield, it is found that the 6th day Δ SACE_3980 relatively sets out 28.3% (see Fig. 3 B) of the output increased of strains A 226, HPLC results again show that SACE_3980 is that to participate in erythromycin biological Negative regulation of synthesis.
2.2 SACE_3980 genes are replied and overexpression.
In order to the raising for verifying yield of erythrocin in mutant Δ SACE_3980 is because that SACE_3980 gene delections are drawn Rise, using SACE_3980 expression vector pIB139-3980 and pIB139 carriers (as control), be directed respectively into Δ SACE_ In the protoplast of 3980 mutants and starting strain A226, obtain and reply bacterial strain and unloaded Δ SACE_3980/pIB139- 3980th, Δ SACE_3980/pIB139, overexpression bacterial strain and zero load A226/pIB139-3980, A226/pIB139, PCR identifications Confirm (see Fig. 4 A).A226 and Δ SACE_3980 series mutations strain are carried out into shake flask fermentation afterwards, HPLC testing results show：Δ The Erythromycin A yield of SACE_3980 raises 29.3% compared with A226；Reply the red mould of bacterial strain Δ SACE_3980/pIB139-3980 Plain A yield is recovered substantially compared with A226；The Erythromycin A yield of A226/pIB139-3980 reduces about 20% (see figure compared to A226 4B)；HPLC testing results further demonstrate that SACE_3980 genes can bear the biosynthesiss for adjusting Erythromycin A.
2.3 disappearance SACE_3980 gene pairss thalli growths and the impact of spore shape differentiation.
The dry cell weight of the fermentation Δ SACE_3980 mutants of 6 days and A226 bacterial strains is determined, respective change curve is drawn, As a result show that Δ SACE_3980 is little (see Fig. 5 A) compared with the Biomass difference of A226, implies the disappearance of SACE_3980 genes simultaneously The primary metabolite of thalline is not affected.
In order to determine whether SACE_3980 genes regulate and control the Sporulation of thalline, by mutant Δ SACE_3980, reply Bacterial strain Δ SACE_3980/pIB139-3980, overexpression strains A 226/pIB139-3980 and wild type control strain A226 It is applied on R3M flat boards simultaneously, 30 DEG C are cultivated 72 hours, observe bacterial strain spore growth situation.As a result show compared to A226, Δ The spore shape no significant difference (Fig. 5 B) of SACE_3980 mutants, illustrates that the disappearance of SACE_3980 genes does not affect spore Formed.
2.4 the high industrial production bacterial strain WB/ Δ SACE_3980 of transformation improve yield of erythrocin.
The structure of WB/ Δ SACE_3980 mutants is carried out first, and building process is shown in Fig. 6 A with reference to Fig. 2A, PCR identifications.Afterwards WB/ Δ SACE_3980 mutants and high industrial production bacterial strain WB coated plates are activated, shaking for industrial seed culture medium is then respectively connected to In bottle, after cultivating 2 days under 30 DEG C of rotating speed 220rpm, in switching industrial fermentation culture medium, continue culture 6 days.Extract after fermentation ends Concentration Jing HPLC analyses are taken, compare starting strain WB, and the yield of erythrocin of WB/ Δ SACE_3980 has been respectively increased 15.8% (see Fig. 6 B).In this explanation superior strain WB, SACE_3980 genes are also involved in adjusting the yield of erythromycin.
CCCAAGCTTGCGGTGTTCATCAGCGCGAT
GCTCTAGAGCTCGACGAACAGCCGGATG
CGGGGTACCAGATCACCACCGTCCTGCG
CCGGAATTCAGCCTCAACGTGCGGTTCA
GCATGCCACAAAGGCTAACTCGGT
AAGTCAGCACAGGCGTCCTCAGT
GGAATTCCATATGATGGCGGTCATGAGCGAGCC
GCTCTAGATCAGCCGCAGCAGGCGGCC
GGAGTGCATATGGTGCAATACGAATGGCGAAAAG
CTCAAAGCTTCAGCCAATCGACTGGCGAGCG

Claims (3)

1. a kind of by transforming the red mycete of sugared many sporesSACE_3980The method that gene improves yield of erythrocin, it is characterised in that：It is logical Cross during genetic engineering approach makes the red mycete of sugared many sporesSACE_3980Gene inactivation, obtains the red mycete erythromycin high yield work of sugared many spores Journey bacterial strain, with described strain fermentation production erythromycin.
2. according to claim 1 a kind of by transforming the red mycete of sugared many sporesSACE_3980Gene improves yield of erythrocin Method, it is characterised in that it is describedSACE_3980Gene outcome can be with negative regulation erythromycin biosynthesiss.
3.SACE_3980Application of the gene in industrial strain, it is characterised in that：TetR families are lacked in high industrial production bacterial strain Open geneSACE_3980, high productive mutant is obtained, can be used for erythromycin production.
CN201611146639.6A 2016-12-13 2016-12-13 Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene Active CN106520866B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611146639.6A CN106520866B (en) 2016-12-13 2016-12-13 Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611146639.6A CN106520866B (en) 2016-12-13 2016-12-13 Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene

Publications (2)

Publication Number Publication Date
CN106520866A true CN106520866A (en) 2017-03-22
CN106520866B CN106520866B (en) 2021-01-01

Family

ID=58342196

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611146639.6A Active CN106520866B (en) 2016-12-13 2016-12-13 Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene

Country Status (1)

Country Link
CN (1) CN106520866B (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107881190A (en) * 2017-11-15 2018-04-06 安徽大学 Method for improving lincomycin yield by modifying streptomyces lincolnensis S L CG _2919 gene
CN109136253A (en) * 2018-09-28 2019-01-04 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _5754 gene approach
CN109321618A (en) * 2018-11-13 2019-02-12 安徽农业大学 A method of yield of erythrocin is improved by the red mould SACE_5717 gene of the more spores of sugar
CN110157756A (en) * 2019-03-11 2019-08-23 安徽大学 A method of yield of erythrocin is improved by the red mould SACE_0303 gene of the more spores of transformation sugar
CN111139192A (en) * 2019-12-16 2020-05-12 安徽大学 Method for improving erythromycin yield by modifying saccharopolyspora erythraea SACE _4682 gene
CN111363710A (en) * 2020-03-04 2020-07-03 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _4839 gene pathway

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102816814A (en) * 2012-04-07 2012-12-12 安徽大学 Method for improving erythrocin yield through inactivation saccharopolyspora erythraea SACE_3446 gene
CN103849642A (en) * 2014-01-13 2014-06-11 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _3986 gene
CN106148378A (en) * 2016-07-19 2016-11-23 安徽大学 Improve yield of erythrocin by sugared many spores red mould SACE_Lrp gene approach

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102816814A (en) * 2012-04-07 2012-12-12 安徽大学 Method for improving erythrocin yield through inactivation saccharopolyspora erythraea SACE_3446 gene
CN103849642A (en) * 2014-01-13 2014-06-11 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _3986 gene
CN106148378A (en) * 2016-07-19 2016-11-23 安徽大学 Improve yield of erythrocin by sugared many spores red mould SACE_Lrp gene approach

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NCBI: "NC_009142.1", 《GENBANK》 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107881190A (en) * 2017-11-15 2018-04-06 安徽大学 Method for improving lincomycin yield by modifying streptomyces lincolnensis S L CG _2919 gene
CN107881190B (en) * 2017-11-15 2021-02-09 安徽大学 Method for improving lincomycin yield by modifying streptomyces lincolnensis SLCG _2919 gene
CN109136253A (en) * 2018-09-28 2019-01-04 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _5754 gene approach
CN109136253B (en) * 2018-09-28 2021-08-10 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _5754 gene approach
CN109321618A (en) * 2018-11-13 2019-02-12 安徽农业大学 A method of yield of erythrocin is improved by the red mould SACE_5717 gene of the more spores of sugar
CN109321618B (en) * 2018-11-13 2021-06-18 安徽农业大学 Method for improving erythromycin yield through saccharopolyspora erythraea SACE _5717 gene
CN110157756A (en) * 2019-03-11 2019-08-23 安徽大学 A method of yield of erythrocin is improved by the red mould SACE_0303 gene of the more spores of transformation sugar
CN110157756B (en) * 2019-03-11 2022-03-29 安徽大学 Method for improving erythromycin yield by modifying saccharopolyspora erythraea SACE _0303 gene
CN111139192A (en) * 2019-12-16 2020-05-12 安徽大学 Method for improving erythromycin yield by modifying saccharopolyspora erythraea SACE _4682 gene
CN111139192B (en) * 2019-12-16 2022-04-15 安徽大学 Method for improving erythromycin yield by modifying saccharopolyspora erythraea SACE _4682 gene
CN111363710A (en) * 2020-03-04 2020-07-03 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _4839 gene pathway
CN111363710B (en) * 2020-03-04 2022-02-18 安徽大学 Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _4839 gene pathway

Also Published As

Publication number Publication date
CN106520866B (en) 2021-01-01

Similar Documents

Publication Publication Date Title
CN106520866A (en) Method for improving yield of erythromycin by modifying saccharopolyspora erythraea SACE _3980 gene
Luo et al. Activation and characterization of a cryptic polycyclic tetramate macrolactam biosynthetic gene cluster
CN107881190B (en) Method for improving lincomycin yield by modifying streptomyces lincolnensis SLCG _2919 gene
CN110157756B (en) Method for improving erythromycin yield by modifying saccharopolyspora erythraea SACE _0303 gene
JP6882330B2 (en) Carrimycin biosynthetic gene cluster
CN103849642B (en) Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _3986 gene
Yu et al. Genome shuffling of Streptomyces roseosporus for improving daptomycin production
Li et al. Biosynthesis and molecular regulation of secondary metabolites in microorganisms
CN102816814A (en) Method for improving erythrocin yield through inactivation saccharopolyspora erythraea SACE_3446 gene
WO2019214347A1 (en) Genetic screening method for negative regulatory factor of streptomyces biosynthesis gene cluster
CN112251456B (en) Method for improving lincomycin yield through streptomyces lincolnensis regulation gene combination modification
CN109136253A (en) Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _5754 gene approach
CN110484481A (en) A method of lincomycin yield is improved by transformation Str. lincolnensis SLCG_3128 gene
CN103205451B (en) Yield of erythrocin is improved by the many spores of sugar red mould SACE_7301 gene approach
CN109321618B (en) Method for improving erythromycin yield through saccharopolyspora erythraea SACE _5717 gene
CN106148378A (en) Improve yield of erythrocin by sugared many spores red mould SACE_Lrp gene approach
CN111139192B (en) Method for improving erythromycin yield by modifying saccharopolyspora erythraea SACE _4682 gene
Pinjari et al. Detection and expression of biosynthetic gene clusters in actinobacteria
WO2019223433A1 (en) Genetically engineered bacterium of fidaxomicin and construction method and application thereof
CN103361345B (en) The biosynthetic method of the biological components and parts strengthening secondary metabolite of restructuring regulation and control
CN111363710B (en) Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _4839 gene pathway
CN111197019B (en) Method for improving yield of erythromycin through saccharopolyspora erythraea SACE _1906 gene approach
CN105316383B (en) A method of improving the oxytetracycline yield of streptomycete by gene disruption
CN106190854B (en) A kind of preparation method of desert pseudocyst bacterium and oritavancin intermediate
CN117904162A (en) Method for improving erythromycin yield by modifying rhodosporidium saccharatum SACE_5680 gene and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant