CN107746826A - A kind of method by co-expressing metK1 and metK2 genes raising lincomycin yield in Str. lincolnensis - Google Patents

Abstract

The invention discloses one kind by co-expressing in Str. lincolnensismetK1WithmetK2The method that gene improves lincomycin yield, it is characterised in that described method is：Co-expressed by genetic engineering approach in Str. lincolnensismetK1WithmetK2Gene, Str. lincolnensis lincomycin high-yielding engineering bacterial strain is obtained, the strain fermentation obtained with the technology can improve lincomycin yield.

Description

It is a kind of that by co-expressing, metK1 and metK2 genes raising woods can be mould in Str. lincolnensis The method of plain yield

Technical field

The present invention relates to gene engineering technology field, and in particular to it is a kind of by co-express in Str. lincolnensis metK1 and The method that metK2 genes improve lincomycin yield.

Background technology

Streptomycete can produce abundant secondary metabolite, and these secondary metabolites and its derivative are widely used, Antibiotic, anticarcinogen, immunodepressant etc..The antibiotic and anticarcinogen medically used at present, more than more than half all It is as caused by streptomycete^].Genome sequencing research finds that streptomycete contains multiple biological synthesis gene clusters, and these genes Cluster or silence, or biosynthesis ability is weaker, it is necessary to could obtain industrial production superior strain by screening.Past work Industry production bacterial strain is mainly obtained by physically or chemically method of mutagenesis.Traditional induced-mutation technique not only takes, and randomness is larger, Theoretical property can not be provided to breeding to instruct.The object of the invention be exactly by genetic engineering approach gene targeted alteration come obtain woods can Mycin superior strain.

Str. lincolnensis NRRL2936 is the first plant of lincomycin producing strain isolated from soil for 1962.It is secondary Metabolite LCM (Lin-A) is important lincosamides, at present lincomycin sequence of chemical derivative (Lincomycin Hydrochloride, clindamycin etc.) is widely used for treating infectious diseases.As lincomycin and its derivative are being cured Treatment is growing with commercial demand, has attracted how many scientists improve its yield to study.With other actinomycetes Seemingly, also cluster concentrates on a DNA fragmentation biosynthesis gene of lincomycin.Nineteen ninety-five, Peschke etc. are in Lin Kelian The successful clone biological synthesis gene cluster of lincomycin, its gene cluster size are 35kb in mould 78-11, include 27 openings Reading frame and at least 12 transcriptional units.Up to the present, on gene in lincomycin biological synthesis gene cluster, lmrC, LmbH, lmbB2, lmbU and lmbQ etc. studies have reported that.

The biosynthesis pathway of lincomycin includes two parts:A part synthesizes its amino acid composition third by TYR Base proline (PPL), another part synthesizes its glycosyl moiety α-first sulphur woods by sedoheptulose 7-phosphate can amine (MTL).Obtain Propyl group proline and methyl sulphur lincosamide be attached by amido link, so as to obtain N- demethyl lincomycins, it is again The methyl in S-adenosylmethionine molecule is transferred on propyl group proline molecule in the presence of N- transmethylases, so as to Obtain the molecule of complete LCM.There are three methyl in LCM molecular structure, and streptomycete antibiotic is biological Methyl is mainly derived from S-adenosylmethionine (SAM) in synthesis, is mainly catalyzed and synthesized by SAM synzyme MetK.It is existing Research shows, by adding SAM in vitro or being overexpressed metK genes lifting methyl supply capacity, to be remarkably improved the production of antibiotic Amount.Such as in streptomyces coelicolor, being overexpressed metK genes and external addition SAM has identical effect, can improve it and put The yield of line purpurine.S-adenosylmethionine is accumulated in Avid kyowamycin can also improve the yield of AVM.We are Through completing woods streptomycete LC-G gene order-checking (numbering in Genbank is CP022744), pass through sequence alignment It was found that two metK1 (SLCG_1651) and metK2 with metK with very high homology in Str. lincolnensis LC-G be present (SLCG_3830).And at present for the metK1 in Str. lincolnensis and metK2 function and the shadow to lincomycin yield Sound is not clear.

The content of the invention

The object of the invention is exactly that SAM synthase genes metK1 and metK2 raisings woods can in Str. lincolnensis by co-expressing The yield of mycin.

The present invention is achieved by the following technical solutions：

The New function of metK1 and metK2 genes or application：MetK1 and metK2 genes are as S-adenosylmethionine (SAM) synthase gene, its expression product can the positive biosynthesis for influenceing lincomycin.

A kind of method for improving fermenting and producing lincomycin yield, it is characterised in that described method is：Pass through gene work Journey approach will co-express from Str. lincolnensis LC-G metK1 and metK2 genes in LCGL, improve lincomycin production Amount.

The New function of described metK1 and metK2 genes or application, building woods as starting point using metK1 and metK2 can be mould The technical method of plain superior strain, it is characterised in that find exist and metK homologys in Str. lincolnensis according to bioinformatics Higher metK1 and metK2 genes, corresponding albumen is obtained using the expression and purification of albumen, recycles enzymatic reaction to determine base The function of cause, finally by metK1 and metK2 is overexpressed altogether in LCGL, improve the yield of lincomycin.

A kind of method by co-expressing metK1 and metK2 genes raising lincomycin yield in Str. lincolnensis, it is special Sign is that described method is：By genetic engineering approach co-express Str. lincolnensis in SAM synthase genes metK1 and MetK2, Str. lincolnensis lincomycin high-yielding engineering bacterial strain is obtained, the strain fermentation obtained with the technology can improve woods can Mycin yield.

It is an advantage of the invention that：

The SAM synthase gene related to methyl supply in lincomycin biosynthesis is have chosen in present invention research MetK1 and metK2, the production of lincomycin is improved by co-expressing SAM synthase genes metK1 and metK2 in Str. lincolnensis Amount, lincomycin high-yielding engineering bacterial strain is obtained, improving lincomycin fermentation yield for industrial production provides technical support.

MetK1 and MetK2 albumen is expressed in Escherichia coli BL-21,43.5KD purifying protein is obtained respectively, will obtain MetK1 and MetK2 be used to carry out enzymatic reaction (using methionine and ATP as substrate), reaction is detected after terminating using HPLC The material of generation, as a result show that two albumen all have synthesis SAM function.When in Str. lincolnensis industrial strain LCGL point Not Guo Biaoda metK1 and metK2 genes when, 15% and 22% has been respectively increased relative to zero load in lincomycin yield, further MetK1 and metK2 genes, the output increased of lincomycin 27% are co-expressed in LCGL.Then in the Lin Kelian of more high yield MetK1 and metK2 is co-expressed in mould industrial strain LA219X, lincomycin yield improves 17% relative to zero load.Explanation MetK1 and metK2 is co-expressed in Str. lincolnensis industrial strain, high producing strain for lincomycin can be obtained.

Brief description of the drawings

Fig. 1：MetK1 and metK2 bioinformatic analysis comparison chart in Str. lincolnensis

Fig. 2：MetK1 and MetK2 enzymatic reaction figures

(A) MetK1 and MetK2 protein purifications figure.M：Albumen marker；1：The MetK1 albumen of purifying；2：Purifying MetK2 albumen.(B) ATP and L-methionine are changed into SAM by MetK1 and MetK2 albumen respectively.1：KCl, MgCl2 and MetK1 or MetK2；2：ATP, L-methionine, KCl and MgCl2；3：ATP, L-methionine, KCl, MgCl2 and MetK1；4：ATP, L-methionine, KCl, MgCl2 and MetK2；5：SAM standard items (detection time is 6.9 minutes).

Fig. 3：Str. lincolnensis LCGL structure

(A) 4 × attB is integrated in Str. lincolnensis LC-G by homologous recombination^ΦC31The schematic diagram in site；(B) Lin Kelian Mould LCGL PCR qualification figures；(C) LC-G, LC-G/pSOK804 and LC-G/pPM927 LCM volume analysis figure； (D) LC-G, LC-G/pSOK804 and LC-G/pPM927 LCM volume analysis figure；(E) LC-G and LCGL bacterial strains mycelia The measure of body biomass；(F) LC-G and LCGL bacterial strains spore growth situation.

Fig. 4：MetK1 is overexpressed in Str. lincolnensis LCGL can improve the yield of LCM

(A) in LCGL/pIB139 and LCGL/pIB139-metK1 strain cells SAM detection；

(B) detection of LCGL/pIB139 and LCGL/pIB139-metK1 bacterial strains LCM yield.

Fig. 5：Influences of the metK2 to LCM yield is lacked and is overexpressed in Str. lincolnensis LCGL

(A) schematic diagram of metK2 genes is lacked in Str. lincolnensis LC-G by homologous recombination；(B) mutant strain Δ MetK2 PCR qualification figures；(C) (2,4,6 days) LCGL, Δ metK2, LCGL/pIB139 and LCGL/pIB139- during fermenting SAM detection in metK2 strain cells；(D) the yield detection of the LCM of LCGL and its derivative.

Fig. 6：MetK1 or metK2 is overexpressed in Str. lincolnensis can increase lmbU, lmbR and lmbA transcription

(A) lmbU in LCGL/pIB139 and LCGL/pIB139-metK1 bacterial strains, the detection of lmbR and lmbA transcriptional levels； (B) detection of LCGL/pIB139 and LCGL/pIB139-metK1 bacterial strains lmbU, lmbR and lmbA transcriptional level.

Fig. 7：MetK1 or metK2 is co-expressed in Str. lincolnensis can increase the yield of LCM

(A) LCM in LCGL/pIB139 and LCGL/pIB139-metK1-metK2 (SLCGL-K1-K2) bacterial strain Yield detects；(B) LA219X/pIB139 and LA219X/pIB139-metK1-metK2 (SLA219X-K1-K2) bacterial strain middle forest can Mycin A yield detection.

Embodiment

Embodiment 1

1.1 bacterial strains, plasmid and growth conditions

In experiment using to bacterial strain and plasmid be shown in Table 1.Escherichia coli are trained in 37 DEG C of liquid LB (Luria-Bertani) Support base or cultivated on the LB flat boards for adding 1.25% agar.Str. lincolnensis and its engineered strain in 30 DEG C of industrial culture mediums or Cultivated on the MGM flat boards containing 2.2% agar.

1.2 materials, DNA operations and sequencing

PEG3350, lysozyme, TES, casamino acid, A Baila mycins are bought from Sigma companies.TSB, yeast extraction Thing, peptone are bought in Oxoid companies.Glycine, agar powder, sodium chloride and other biological reagents are all purchased from Reagent Company. The general operation technology of Escherichia coli and Str. lincolnensis is according to standard operation.The synthesis of primer and DNA sequencing give birth to work by Shanghai Bioengineering Co., Ltd completes.

The bacterial strain and plasmid that table 1 uses in testing

1.3 metK1 and metK2 gene pET28a expression plasmids are built

Respectively using metK1-P1/metK1-P2 and metK2-P1/metK2-P2 as primer, with Str. lincolnensis LC-G genes Group is template, and amplification obtains metK1 and metK2 genes；

PCR expands metK1 gene primers：

metK1-P1：5ˊ-AAACATATG(underlined sequence is Nde I digestion position to GTGTCCCGTCGCTTGTTCA-3 ˊ Point),

metK1-P2：5ˊ-AAAGCGGCG(underlined sequence is EcoR I digestion position to TTACAGCCCCGCCGCCTT-3 ˊ Point)；

PCR expands metK2 gene primers：

metK2-P1：5ˊ-AAACATATG(underlined sequence is Nde I digestion position to ATGTCTCGTCGTCTGTT-3 ˊ Point),

metK2-P2：5ˊ-AAAGCGGCG(underlined sequence is EcoR I digestion position to TCAGATGCCCGCAGCT-3 ˊ Point)；

Respectively by metK1 the and metK2 gene clonings of acquisition to pET28a, and primer metK1-P1/ corresponding to using MetK1-P2 and metK2-P1/metK2-P2 enters performing PCR checking；Digestion verification is carried out with NdeI/EcoR I again, is obtained correctly PET28a-metK1 and pET28a-metK2 plasmids, it is then introduced into BL21 competence, obtains protein expression host BL21 (DE3)-MetK1 and BL21 (DE3)-MetK2.

1.4MetK1 and MetK2 protein expression and purifications

Protein expression strain BL21 (DE3)-MetK1 and BL21 (the DE3)-MetK2 that will be obtained.Connect with 1% inoculum concentration Plant after being cultivated 12 hours into test tube, then be inoculated into 2% inoculum concentration in the shaking flask of the 250ml containing 50ml liquid LB, 37 Appropriate IPTG is added after DEG C culture 1.5h, and is taken after inducing 20h, culture to terminate in 16 DEG C and run albumen after appropriate bacterium solution thermal denaturation and become Property glue, observation destination protein whether successful expression.

Destination protein after successful expression carries out ni-sepharose purification experiment, is first washed using the gradient imidazole buffer of appropriate concentration Removing impurities albumen, finally destination protein is eluted with 160mM imidazole buffers, that is, obtains destination protein after purification.

The enzymatic reaction of 1.5 MetK1 and MetK2 albumen

MetK1 and MetK2 albumen after purification is incubated and is containing 0.1mmol/L Tris/HCl, pH 8.2,5mmol l^-1ATP,5mmol l^-1L-methionine, 200mmol/L KCl and 10mmol/L MgCl2 the μ l bodies of mix reagent 100 37 degree two hours in system, reaction put it into terminating reaction in mixture of ice and water after terminating.After the completion of reaction, detected with HPLC Reaction product, see if there is SAM generations.

1.6 Str. lincolnensis LCGL structure

In order that with integrating vector pIB139, one section of 240bp base is synthesized comprising 4 Φ C31attB sites, sequence Row are as follows:

(italic represents It is EcoRI/XbalI and BamHI/HindIII restriction enzyme sites, what underscore represented is 4 attB sequences).With lincomycin base It is respectively that primer PCR amplifies SLCG_7011 bases with attB-P1/attB-P2and attB-P3/attB-P4 because group is template Because of each about 2.0kb of upstream and downstream homology arm fragment.

PCR expands homology arm fragment primer：

attB-P1：5’-AAAGAATTC(sequence of line is EcoRI enzyme to ATCGTGGAGATGTTCCGCGAGCA-3 ' Enzyme site),

attB-P2：5’-AAAGGATCC(sequence of line is BamHI digestion to GGGGTGCCGTGCGGCCAGGGCG-3 ' Site)；

attB-P3：5’-AAATCTAGA(sequence of line is XbaI digestion to GGCGCCGAGCTGCTGGTTCCGGA-3 ' Site),

attB-P4：5’-AAAAAGCTT(sequence of line is HindIII enzyme to CGTGAGCCGTACGGGCGCGAT-3 ' Enzyme site).

Respectively by above-mentioned upstream and downstream and 4 × attB^ΦC31Three DNA fragmentations are utilized respectively EcoRI/BamHI, XbaI/HindIII and XbaI/BamHI is connected on corresponding pKC1139, completes structure plasmid pKC1139-4 × attB^ΦC31； Using chromosome segment homologous recombination technique by pKC1139-4 × attB^ΦC31Fragment is imported in Str. lincolnensis LC-G, passes through two The homologous recombination of wheel, that is, SLCG_7011 genes are obtained by 4 × attB^ΦC31The engineering strain of replacement, uses attB-P5/ AttB-P6 primer PCRs verify that the mutant is successfully built, and are named as LCGL.PCR good authentications obtain the primer of mutant strain For：

attB-P5：5’-ATCCGCGGCATGCGGCTGGAGAT-3’；

attB-P6：5’-CGAGGCGGTGCCGTGTCGTTCGA-3’

Similarly, obtain and contain 4 × attB^ΦC31The engineering strain LA219X in site

The structure of 1.7 metK2 deletion mutant bodies

We have attempted many methods and have lacked metK1 (SLCG_1651) base in Str. lincolnensis LC-G and LCGL simultaneously Cause, but all have failed.

PUCTSR plasmids are to insert 1.36kb thiostreptons between pUC18 BamH I and Sma I restriction enzyme sites to resist Property gene (tsr).In order to knock out the metK2 in Str. lincolnensis (SLCG_3830) gene, metK2-P1/metK2- is used respectively P2 and metK2-P3/metK2-P4 is primer, Str. lincolnensis LC-G genomes are template, and PCR expands the upper and lower of metK2 genes Swim each about 1.5kb homology arm SU and SD DNA fragmentation.

PCR expands SU DNA fragmentation primers：

metK2-P1：5’-AAAAAGCTT(sequence of line is HindIII enzyme to GCCCACTACCGGTTCCAGTAC-3 ' Enzyme site),

metK2-P2：5’-AAATCTAGA(sequence of line is XbaI enzyme to CGACGAGTCGTATCCGATACCCA-3 ' Enzyme site)；

PCR expands SD DNA fragmentation primers：

metK2-P3：5’-AAAGGTACC(sequence of line is KpnI digestion to GCGTACGCCATCGGCAAGGCC-3 ' Site),

metK2-P4：5’-AAAGAATTC(sequence of line is EcoRI digestion to GAAGGTGTTGGTGCCCACAC-3 ' Site).

Two DNA fragmentations of above-mentioned SU and SD are connected to pUCTSR tsr resistant genes both sides respectively, complete structure plasmid pUCTSR-ΔmetK2；With containing Tsr and metK2 upstream and downstream in plasmid pUCTSR- Δs metK2 under EcoRI/HindIII digestions DNA fragmentation, be subsequently attached on the pKC1139 containing identical restriction enzyme site, obtain pKC1139- Δs metK2.Utilize Chromosome segment homologous recombination technique imports pKC1139- Δ metK2 fragments in Str. lincolnensis LCGL, according to sulphur Streptothrix Resistance polypeptide screens mutant, that is, obtains the engineering strain that metK2 genes are replaced by thiostrepton resistance gene (tsr), Verify that the mutant is successfully built using metK2-P5 and metK2-P6 primer PCRs, be named as Δ metK2.PCR good authentications The primer for obtaining deletion mutation strain is：

metK2-P5：5’-TATCGGATACGACTCGTCG-3’；

metK2-P6：5’-CCTTGCCGATGGCGTACGC-3’

1.8metK2 genes reply the structure of bacterial strain

In order to introduce metK2 genes in Δ metK2, PCR amplification metK2 gene primers are devised：

Upstream：5’-AAACATATGATGTCTCGTCGTCTGTT-3 ' (sequence of line is NdeI restriction enzyme site),

Downstream：5’-AAAGAATTCTTACAGCCCCGCCGCCTT-3 ' (sequence of line is EcoRI restriction enzyme site).

MetK2 genes are amplified from Str. lincolnensis LC-G genomes, are inserted into pIB139 Nde I and EcoRI enzymes Between enzyme site, construction expression plasmid pIB139-metK2 then will by the protoplast transformation method of PEG mediations PIB139-metK2 is imported in Δ metK2.By apramycin preliminary screening, with apramycin resistance gene (apr) for object Enter performing PCR identification, the reply Strain Designation of acquisition is Δ metK2/pIB139-metK2.Apr PCR identification primers are as follows：

apr-P1：GGAGTGCATATGGTGCAATACGAATGGCGAAAAG

apr-P2：CTCAAAGCTTCAGCCAATCGACTGGCGAGCG

Overexpression metK1 and metK2 gene in 1.9 Str. lincolnensis LCGL

In order to be overexpressed metK2 genes in LCGL, PCR amplification metK1 gene primers are devised：

Upstream：5’-AAACATATGGTGTCCCGTCGCTTGTTCA-3 ' (sequence of line is NdeI restriction enzyme site),

Downstream：5’-AAAGAATTCTTACAGCCCCGCCGCCTT-3 ' (sequence of line is EcoRI restriction enzyme site).

MetK1 genes are amplified from Str. lincolnensis LC-G genomes, are inserted into pIB139 NdeI and EcoRI digestions Between site, construction expression plasmid pIB139-metK1, then by the protoplast transformation method of PEG mediations by pIB139- MetK1 and pIB139-metK2 are directed respectively into LCGL.By apramycin preliminary screening, with apramycin resistance gene (apr) performing PCR identification is entered for object, the overexpression bacterial strain of acquisition is respectively designated as LCGL/pIB139-metK1 and LCGL/ pIB139-metK2。

Common overexpression metK1 and metK2 gene in 2.0 Str. lincolnensis LCGL

With pIB139-metK2 templates, the metK2 fragments containing PermE* are amplified, then by itself and pIB139-metK1 Digestion is carried out using NotI/EcoRV, transformation and selection is then connected and obtains plasmid pIB139-metK1-metK2.Mediated by PEG Protoplast transformation method by pIB139-metK1-metK2 import LCGL in.Pass through apramycin preliminary screening, Yi Anpu Mycin resistant gene (apr) is that object enters performing PCR identification, and the coexpression bacterial strain of acquisition is respectively designated as LCGL/pIB139- metK1-metK2。

Similarly, the coexpression bacterial strain obtained in LA219X is LA219X/pIB139-metK1-metK2.

The transcription analysis of related gene in 2.1 LCGL/pIB139-metK1 and LCGL/pIB139-metK2 bacterial strains

24h LCGL/pIB139-metK1 and LCGL/pIB139-metK2 and empty carrier bacterial strain LCGL/ will be cultivated respectively PIB139 using Syrup-homogenizing instrument is broken and SBS Genetech RNA extracts kits obtain needed for RNA, digested through DNA, after PCR changes into cDNA, Use machine testing on quantitative real time PCR Instrument.

2.2 Str. lincolnensis fermentation production HPLCs detect

By Str. lincolnensis and related mutation strain after slant medium culture 7 days, 1cm is shoveled²Access in seed culture medium 240rpm30 DEG C of culture 48h, the 2ml that then transfers continue to cultivate 168h into fermentation medium.Then zymotic fluid is handled Detected with HPLC.

SAM content detections in 2.3 Str. lincolnensis

Str. lincolnensis and related mutation strain are distinguished to 1mL sample when fermenting 2 days, 4 days and 6 days, then by sample Carry out processing and HPLC detection.

Interpretation of result：

MetK1 and metK2 bioinformatics compares analysis in 3.1 Str. lincolnensis

By with Str. lincolnensis LC-G sequence alignments (Fig. 1), it has been found that and SAM synzyme bases in other streptomycetes Because metK has very two gene SLCG_1651 (metK1) of high homology and SLCG_3830 (metK2).Such as come from day SCO1476 and MetK1 in Streptomyces Syancus has 93.5% similitude, there is 81.5% similitude with MetK2；AVM hereinafter strepto- SAV_6874 and MetK1 has 93.5% similitude in bacterium, there is 83% similitude with MetK2.

ATP and L-methionine can be changed into SAM by 3.2MetK1 and MetK2

Fig. 2A shows MetK1 and MetK2 albumen (size 43.5KDa) successful expression and purified.By MetK1 after purification Incubated with MetK2 albumen and containing 0.1mmol/L Tris/HCl, pH 8.2,5mmol l^-1ATP,5mmol l^-1L- 37 DEG C of 2h in methionine, 200mmol/L KCl and 10mmol/L MgCl2 the μ l systems of mix reagent 100, reaction knot Terminating reaction in mixture of ice and water is put it into after beam.After the completion of reaction, with HPLC detect reaction product, Fig. 2 B find with SAM standard items contrast, and detect SAM in the reaction system containing MetK1 and MetK2 albumen, illustrate MetK1 and MetK2 albumen Function with SAM synzyme.3.3 Str. lincolnensis LCGL structure

Because LC-G itself contains two integration sites VWB and pSAM2, when we are whole pPM927 and pSOK804 difference When closing on the genome of Str. lincolnensis, lincomycin yield have dropped half (see Fig. 3 C).Due to Str. lincolnensis base Because group lacks Φ C31attB sites, integrating vector pIB139 is prevented to use, so we are constructed containing Φ C31attB The Str. lincolnensis LCGL of integration site.LCGL building process is shown in Fig. 3 A, and is confirmed (see Fig. 3 B) by PCR.LCGL is existed Ferment 7 days, analyzed after extraction concentration through HPLC, its LCM yield is as LC-G yield (see figure in fermentation medium 3D), while its biomass and spore shape and starting strain LC-G are also consistent (see Fig. 3 E and F).PIB139 is imported into woods Lincomycin yield can not influenceed in streptomycete LCGL.

MetK1 genes are overexpressed in 3.4 LCGL can improve the yield of LCM

In order to verify influences of the metK1 to lincomycin yield, expression vector pIB139-metK1 is imported into LCGL Structure is overexpressed bacterial strain LCGL/pIB139-metK1.Fermented and HPLC detections, find cell during fermenting 2,4 and 6 days Interior SAM contents have been respectively increased 1.8,2.5 and 1.8 times (Fig. 4 A) than control LCGL/pIB139.It is consistent with its, mistake The LCM yield of expression metK1 bacterial strains compares control strain, improves 15% (P<0.01).As a result overexpression is confirmed MetK1 improves the yield of lincomycin by increasing internal SAM contents.

MetK2 genes are overexpressed in 3.5 LCGL can improve the yield of LCM

In order to study the biosynthesis whether metK2 participates in lincomycin, metK2 gene deletion mutants Δs metK2's Building process is shown in Fig. 5 A.Deletion mutation is screened on the MGM flat boards containing thiostrepton and is confirmed by PCR (see figure 5B).SAM contents ratio control LCGL intracellular during fermenting 2,4 and 6 days Δ metK2 reduces by 31% respectively, 42% He 50% (Fig. 5 C).Δ metK2 ferments 7 days in fermentation broth, is analyzed after extraction concentration through HPLC, its LCM 55% (see Fig. 5 D) of yield reduction of the yield than starting strain LCGL.Biometric measurement is carried out to the thalline to ferment daily simultaneously It is fixed, as a result show that Δ metK2 and LCGL biomass difference are little, imply metK2 missing does not influence the thalline of bacterial strain Growth.In order to confirm that mutant strain Δ metK2 phenotype is the research and design of the present invention entirely due to caused by metK2 gene mutations The covering experiment of metK2 genes.PIB139-metK2 includes erythromycin resistance gene strong promoter PermE* and complete MetK2 genes, for covering mutant strain Δ metK2.Fermented and HPLC detections, Δ metK2/pIB139-metK2 woods can be mould Plain yield returns to horizontal (see Fig. 5 D) consistent with starting strain LCGL's.

In order to further study MetK2 and lincomycin relation, metK2 is overexpressed in LCGL.Fermented and HPLC Detection, intracellular SAM contents ratio control LCGL/pIB139 has been respectively increased 2.6 during finding fermentation 2,4 and 6 days, 3.0 and 2.2 times (Fig. 5 C).Consistent with its, the LCM yield for being overexpressed metK2 bacterial strains compares control strain, carries High 22% (P<0.001).As a result confirm that being overexpressed metK2 significantly increases internal SAM contents to improve lincomycin Yield.

3.6 MetK1 and MetK2 can promote the transcription of lincomycin biosynthesis gene and controlling gene

Because SAM is found that the biosynthesis of streptomycete antibiotic rather than a first can be adjusted as signaling molecule Base donor, using qRT-PCR detections lmbA, (SLCG_0227, a lincomycin synthetic gene coding glutamy turn peptide for we Enzyme), lmbR (SLCG_0245, individual lincomycin synthetic gene encode transaldolase) and lmbU (SLCG_0253, positive regulation base Because regulate and control lincomycin biosynthesis) transcriptional level.QRT-PCR as a result, it was confirmed that metK1 be overexpressed bacterial strain in, lmbA, LmbR compares unloaded bacterial strain LCGL/pIB139 with lmbU and 1.75,1.83 and 2.2 times (see Fig. 6 A) has been respectively increased, and in metK2 It is overexpressed in bacterial strain, lmbA, lmbR compare unloaded bacterial strain LCGL/pIB139 with lmbU and be respectively increased 5.5,3.7 and 6.1 times (see Fig. 6 B), illustrate MetK1 and MetK2 synthesis SAM to regulate and control the biosynthesis of lincomycin, and MetK2 contribution is big In MetK1.

MetK2 genes are overexpressed in 3.7 LCGL can improve the yield of LCM

In order to further improve the yield of lincomycin, we co-express metK1 and metK2 in LCGL.LCGL/ The yield of pIB139-metK1-metK2 LCM significantly improves 27% (P<0.01) relative to empty carrier LCGL/ pIB139。

The applicability of lincomycin yield and general is improved in Str. lincolnensis in order to inquire into coexpression metK1 and metK2 All over property, pIB139-metK1-metK2 is directed in the LA219X bacterial strains of more high yield.Just as might be expected, LA219X/ PIB139-metK1-metK2 (2.92g/L) shows 17% (P<0.01) LA129X/pIB139 is compared in raising.Imply at it MetK1 and metK2 is co-expressed in his lincomycin industrial strain come improve the yield of lincomycin be likely to have very much it is important Commercial value.

Sequence table

<110>University of Anhui

<120>A kind of method by co-expressing metK1 and metK2 genes raising lincomycin yield in Str. lincolnensis

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1209

<212> DNA

<213>Str. lincolnensis (Streptomyces lincolnensis)

<400> 1

gtgtcccgtc gcttgttcac ctcggagtcc gtgaccgagg gtcaccccga caagatcgct 60

gaccagatca gcgacaccat cctcgacgcg ctgctcaagg aggacccgtc gtcccgggtc 120

gccgtcgaga cgctgatcac caccggcctg gtgcacgtgg ccggcgaggt caccaccaag 180

acctacgcac ccatcgcgca gctggtgcgc gacaagatcc tggagatcgg ctacgactcc 240

tccaagaagg gcttcgacgg cgcctcctgc ggcgtctcgg tgtccatcgg cgcgcagtcc 300

ccggacatcg cccagggcgt cgacaccgcc tacgagcagc gtgtcgaggg cgacgaggac 360

gaactcgaca agcagggcgc cggcgaccag ggcctgatgt tcggctacgc gtgcgacgag 420

acgccgaccc tgatgccgct gccgatcttc ctggcgcacc gcctgtccaa gcgcctctcc 480

gaggtccgca agaacggcac catcccctac ctgcgccccg acggcaagac gcaggtcacc 540

atcgagtacg acggtgacaa ggcggtccgt ctggacacgg tcgtggtctc ctcgcagcac 600

gccagcgaca tcgacctgga gtcgctgctc gcccccgaca tccgtgagtt cgtcgtcgag 660

gcggagctga aggcgctcct cgacgagggc atcaagctgg agaccgaggg ctaccgcctc 720

ctggtgaacc cgaccggccg cttcgagatc ggcggtccga tgggcgacgc cggcctcacc 780

ggccgcaaga tcatcatcga cacctacggc ggcatgtccc gccacggcgg cggcgccttc 840

tccggcaagg acccgtccaa ggtggaccgc tccgcggcgt acgcgatgcg ctgggtcgcc 900

aagaacgtcg tcgccgcggg cctcgccacc cgctgcgagg tccaggtcgc ctacgccatc 960

ggcaaggccg agccggtcgg tctcttcgtc gagaccttcg gtaccgcgaa ggtcgacacc 1020

gacaggatcg agaaggcgat cgacgaggtc ttcgacctcc gcccggccgc catcatccgc 1080

gacctcgacc tcctgcgccc gatctacgcc cagaccgcgg cctacggcca cttcggccgc 1140

gagctccccg agttcacctg ggagaagacg gaccgcgtgg acgcgctgcg gaaggcggcg 1200

gggctgtaa 1209

<210> 2

<211> 1221

<212> DNA

<213>Str. lincolnensis (Streptomyces lincolnensis)

<400> 2

atgtctcgtc gtctgttcac ctcggagtcc gtgaccgaag ggcatcccga caagatcgcc 60

gaccggatca gcgacaccat cctcgacgcg ctgctgagcg aggatccggc ctcccgcgtc 120

gccgtggaaa ccatgatcac cacaggtcag gtgcacatcg cgggtgaggt caccacccgc 180

gcctacgcac cggtggccca gctggtccgc gacaccgtcg tgggtatcgg atacgactcg 240

tcggccaagg gcttcgacgg caactcctgt ggcgtatcgg tgtccatcgg cgcccagtcc 300

cccgatatcg cgcagggcgt cgactcggcg tacgagaagc gcatcgaggg cctttccggt 360

ggcgaagagg accggctgga ccagcagggt gccggcgacc agggtctgat gttcggctac 420

gccaccgacg agacgccgtc gctgatgccg ctgcccatcc atctggcgca ccggctgtcc 480

gagcgcctgt cggccgtgcg gaaggacggg accgtcccgt atctgcgtcc cgacggcaag 540

actcaggtga ccatcgagta cgagggcagc aggccggtac gcctggacac ggtcgtcgtg 600

tcctctcagc acgccgccgg catcgacctg gacctgctgc tcacccccga catccgcgag 660

gaagtcgtcg gccacgtcct ggatcagctc gcgcaggacg gcatcaagct cgacaccgag 720

ggttacaggc tgctggtgaa ccccaccggc cggttcgaga tcggcggtcc gatgggcgat 780

gcgggcctga ccggccggaa gatcatcgtc gatacgtatg gcggcatggc ccggcacggc 840

ggcggggcct tctccggcaa ggacccgtcg aaggtcgacc gttccgcggc gtacgcgatg 900

cgctgggtgg cgaagaacgt ggtcgcggcc ggtcttgcca cccgctgtga agtgcaggtc 960

gcgtacgcca tcggcaaggc ccgcccggtg ggtctcttcg tcgagacctt cggcaccgcc 1020

gtggtcgcca cggacaggat cgagggggcc atcggcgagg tcttcgacct ccgcccggcc 1080

gcgatcatcc gtgacctgga cctgctgcgg cccgtctacg cgcagacctc gtcgtacgga 1140

cacttcggcc gcgagcaccc ggacttcacc tgggagagca cggaccgggc cccgcacctc 1200

aggtcagctg cgggcatctg a 1221

Claims (3)

1. The New function of 1.metK1 and metK2 genes or application：MetK1 and metK2 genes are as S-adenosylmethionine (SAM) Synthase gene, its expression product can the positive biosynthesis for influenceing lincomycin.
2. A kind of 2. method for improving fermenting and producing lincomycin yield, it is characterised in that described method is：Pass through genetic engineering Approach will co-express from Str. lincolnensis LC-G metK1 and metK2 genes in LCGL, improve lincomycin yield.
3. 3. New function or the application of metK1 and metK2 genes according to claim 1, it is characterised in that believed according to biology Breath, which is learned, finds metK1 the and metK2 gene higher with metK genetic homologies be present in Str. lincolnensis, utilizes the expression of albumen Purifying obtains corresponding albumen, recycles enzymatic reaction to determine the function of gene, finally by co-expressed in LCGL metK1 and MetK2 genes, improve lincomycin yield.