CN103966250B - Adjustment effect produced by regulation and control gene on nucleoside antibiotic biosynthesis - Google Patents

Abstract

The invention relates to an adjustment effect produced by a regulation and control gene on nucleoside antibiotic biosynthesis, and concretely relates to regulation and control functions and a regulation and control mode of a biosynthesis regulation and control gene ssaA in a sansanmycin biosynthesis gene cluster in Streptomyces sp. SS (CGMCC No. 1764). The invention also relates to a method for improving a sansanmycin yield of a sansanmycin production bacterial strain, and the method comprises improving a yield of the sansanmycin production bacterial strain by ssaA gene overexpression. The invention also relates to a method for improving a sansanmycin yield in a ssaA regulation and control mode and the method comprises removing the finished product in culture to eliminate inhibition produced by the finished product on ssaA functions.

Description

Controlling gene biosynthetic adjustment effect to nucleoside antibioticss

Invention field

The present invention relates to the tune in the biological synthesis gene cluster of sansanmycin in streptomycete Streptomyces sp.SS The section positive adjusting function of gene ssaA and its biosynthetic reverse feedback regulation pattern to sansanmycin.The present invention also relates to And pass through to improve gene copy number and carry out overexpression using the strong promoter of constitutive expression to positive regulator gene to improve The method of sansanmycin yield.The invention still further relates to removing negative feedback by reducing sansanmycin concentration in fermentation liquid The method to improve sansanmycin yield for the suppression.

Background technology:

Sansanmycin is by streptomycete Streptomyces sp.SS (the Chinese micro- life finding in China's Soils of Guizhou The common micro-organisms center culture presevation number of thing culture presevation administration committee be CGMCC No.1764) produced by one group of uridnine Peptide antibiotics, such antibiotic family also includes pacidamycins, napsamycins and mureidomycins etc. (as Fig. 1).Sansanmycin to Pseudomonas aeruginosa Pseudomonas aeruginosa, in conjunction with mycobacteria Mycobacterium tuberculosis H37Rv and multiple-drug resistance tuberculosis mycobacterium have good inhibiting effect.Uridnine The peptide antibiotics mechanism of action is novel, by the key enzyme UDP-N- acetylmuramic acid-pentapeptide during suppression Cell wall synthesis Translocase and suppress Cell wall synthesis.At present, clinically also not UDP-N- acetylmuramic acid-pentapeptide indexing enzyme level Agent, will not produce crossing drug resistant with used antibiotic, and therefore uridnine peptides are likely to be searching novel low-toxicity, narrow spectrum One of optimum selection of the lead compound of antibacterials or drug candidate.

Streptomycete can produce the secondary metabolite in a large number with medical value, including clinical antibiotic, cancer therapy drug And immunosuppressant etc..The regulation and control of secondary metabolism of Streptomyces product are complex processes being related to multistage level modulation.Typically For, the approach specificity being in antibiotic resistance gene cluster being in this multilevel regulated and control network afterbody adjusts base Cause, controls the generation of corresponding antibiotic.Most approach specific transcriptional regulatory factor is belonging to streptomycete antibiotic Modulin family (Streptomyces antibiotic regulatory protein, SARP), such n-end of albumen contains There is a DNA binding structural domain (DNA binding domain, DBD), C- contains at end a bacterial transcription activator domain (bacterial transcriptional activation domain, BTAD), as controlled actinorhodin yield ActII-ORF4.Streptomycete LAL transcription factor family (large ATP-binding members of the LuxR Family, LAL) also it is normally present in the gene cluster of some antibiotic, the such as PikD in pikromycin gene cluster.Additionally, its The transcription regulatory factor of his type also has recently to be reported successively, such as polyene macrolide antibiotics pimaricin biosynthesiss Transcription activator PimM be to be made up of the PAS induction structure domain at N- end and the DNA binding structural domain at C- end；Atypical anti- The N- end answering regulatory factor (Atypical response regulators, ARRs) is a REC domain (Receiver Domain), C- end is a DNA binding structural domain.The multiformity of antibiotic regulatory factor, implies the various of its regulatory mechanism Property.Research shows, approach specific transcriptional activity factor JadR (ARRs family member) of jadomycin, its DNA binding activity By the reverse feedback regulation of end-product jadomycins, thus realizing to jadomycin biosynthetic finely regulating.Hendecane The approach specific transcriptional activity factor Aur1P of the approach specific transcriptional activity factor RedZ of base prodigiosin, auricin There is similar regulation and control model.Above research report shows, for ARRs, its activity is subject to the anti-of approach specific product Feedback adjusts and may is that a kind of phenomenon of generally existing.But whether other kinds of transcription regulatory factor also takes similar regulation and control Mechanism also needs to further study.

At present, the biological synthesis gene cluster of pacidamycin and napsamycin is by successful clone.Based on biological letter Breath credit analysis, the biological experiment result of inside and outside, the biosynthesis pathway of pacidamycin has obtained than solution in greater detail Release.In general, often there is at least one transcription regulator gene in the biological synthesis gene cluster of antibiotic, control this antibiosis The biosynthesiss of element, Zhang etc. is not found transcription by BLSTP analysis in pacidamycin biological synthesis gene cluster Regulator gene；In the napsamycin biological synthesis gene cluster of the reports such as Kaysser, npsA coding albumen with The possible sub- Mpps albumen of ArsR family Transcription inhibition in Streptomyces hygroscopicus has 42% similarity, Thus speculating that npsA may be the biosynthetic regulation of collagen gene of napsamycins, but there is no at present using biological experiment NpsA The report verified of function.

The present invention has cloned the biological synthesis gene cluster of sansanmycin first, is compared by secondary protein structure, in advance Surveying ssaA gene encoding production SsaA in biological synthesis gene cluster is a kind of new modulin, and N-terminal contains FHA domain (fork-head-associated), C-terminal contains LuxR class HTH die body, is ground by carrying out inside and outside function to ssaA gene Study carefully, illustrate the positive adjusting function of ssaA, and find that end-product sansanmycin has reverse feedback regulation effect to SsaA, Carry out overexpression using to positive regulator gene ssaA on the basis of this, improve the yield of sansanmycin.

Content of the invention：

Sansanmycin producing strains streptomycete Streptomyces sp.SS used in the present invention is Chinese micro- life The common micro-organisms center culture presevation number of thing culture presevation administration committee is the bacterial strain of CGMCC No.1764 (see patent of invention " one group of uridnine peptide antibiotics and its pharmaceutically accept salt, and its production and use.", application number 200610141075.7, publication number CN 101153052A), and (protect in the preservation of Chinese medicinal Microbiological Culture Collection administrative center Tibetan CPCC200442).

The present invention carries out gene order-checking first with illumina/Hiseq 2000 to Streptomyces sp.SS, The size of draft genome is about 8.1Mb, is distributed on 69 scaffolds (87 contigs), draft genome sequence is Through being uploaded in GenBank data base (accession number is AKXV00000000), [Wang L, Xie Y, Li Q et al., one plant is produced urine Draft genome sequence (the Draft genome sequence of Streptomyces of glycosides peptide antibiotics streptomycete Sp.SS, which produces a series of uridyl peptide antibiotic sansanmycins), antibacterial Magazine (Journal of Bacteriology), 2012,194 (24)：6988-6989].Using sansanmycin structure class Like thing pacidamycin biological synthesis gene cluster as probe, the draft genome of Streptomyces sp.SS is carried out Scanning obtains the biological synthesis gene cluster of sansanmycin.In order to obtain complete sansanmycin biosynthesis gene Cluster, further build Streptomyces sp.SS Large-insert genomic library, using alkali phosphatase enzyme mark ssaQ and The coded sequence of ssaF screens to 6000 clones in library as probe, obtains 5 positive colonies, wherein cosmid 13R-1 is positive for two probes, therefore selects it and is sequenced with shot gun method.Sequencing result combines draft genome Information, obtains complete sansanmycin biological synthesis gene cluster, and the analysis result according to BLATP is thus it is speculated that ssaH and ssaW It is probably left margin and the right margin gene (as Fig. 2) of sansanmycin biological synthesis gene cluster.

Using albumen is carried out with the online resource HHpred of the structural homology analysis gene to Unknown Function in gene cluster It is analyzed, find that the N-terminal of SsaA has a bipitch structure domain FHA (forkhead-associated domain, FHA), C End has one and contains " alpha-helix-corner-alpha-helix " die body (helix-turn-helix DNA-binding motif, HTH) DNA binding structural domain DBD.The DBD binding structural domain of SsaA is Streptomyces with other 3 homologous proteins NpsM and Streptomyces in PacA in coeruleorubidus, Streptomyces sp.HIL Y-82 SrosN15 albumen in roseosporus NRRL 15998 has very high similarity, and adjusts with the transcription of LuxR family The DBD binding structural domain similar (as Fig. 3) of the section factor.It is presumed that ssaA (SEQ ID No.1) is probably sansanmycin life Thing synthesizes regulator gene, and its coded product SsaA is the new modulin of a class.

The present invention is studied to the adjusting function of ssaA.Method first with PCR-targeting is entered to ssaA Row blocks (as Fig. 4 A), analyzes its biosynthetic impact on sansanmycin, and after finding ssaA blocking-up, producing strains do not produce Sansanmycin, and when ssaA imports overexpression in blocking-up bacterial strain again, block bacterial strain and recovered to produce again The ability of sansanmycin, and yield higher than wild type (as Fig. 4 B and 4C), confirming ssaA further is sansanmycin Biosynthesiss positive regulator gene.Method using real-time fluorescence PCR blocks strain and replys knot in bacterial strain to wild-type strain, ssaA Structure gene ssaH, the result that the transcriptional level of ssaN, ssaP, ssaX, ssaC is analyzed shows, blocks these genes in bacterial strain Transcriptional level significantly decline, and reply in bacterial strain transcriptional level and improve (as Fig. 4 D), result is changed with its yield level is Consistent, SsaA really positive regulator gene and be transcriptional level by control structure gene is described, reaches control The purpose of sansanmycin yield level.

The present invention heterogenous expression purification SsaA albumen in escherichia coli, find SsaA with the method for gel shift retardance (as Fig. 5) can be combined with structural gene promoter regions multiple in gene cluster, illustrate that SsaA is by being directly combined to structural gene Promoter region thus controlling the yield of sansanmycin.Obtain the binding site of SsaA and promoter region using footprinting (as Fig. 6 A), compares binding site using WebLogo, obtains the consistent binding sequence (as Fig. 6 B) of SsaA.To concensus sequence Be mutated and lacked, using gel shift detection SsaA and their binding ability, result show SsaA all can not and they Combine to form complex (as Fig. 6 C), demonstrate the correctness of the concensus sequence of acquisition.

It has also been found that end-product sansanmycin has reverse feedback regulation effect to the DNA binding ability of SsaA, When gel shift is tested the concentration of sansanmycin adding in reaction system and is gradually risen, SsaA and target gene The binding ability of promoter region gradually weakens (as Fig. 7 A and 7B).Surface plasma body resonant vibration (Surface plasmon Resonance, SPR) experiment show, promoter dna fragment ssaC-Dp-3 is coupled to SA chip surface, in sample introduction sample When the concentration of sansanmycin is gradually increased, the combination of SsaA and ssaC-Dp-3 is gradually inhibited (as Fig. 7 E), further Prove that sansanmycin has regulating and controlling effect to the DNA binding activity of SsaA.Shown using showing that plasma resonance is tested The SsaA that sansanmycin can be coupled with CM5 chip interacts (as Fig. 7 C and 7D), illustrates that sansanmycin can lead to Cross and interact thus changing the DNA binding activity of SsaA with SsaA.

The present invention, after confirming the positive adjusting function of ssaA, finds that end-product sansanmycin ties to the DNA of SsaA again Close activity and there is negative feedback, thus the biosynthesiss of negative feedback inhibition itself.On this basis it is proposed that right Sansanmycin biosynthetic regulation of collagen gene is carried out overexpression and is improved sansanmycin bacterial strain using ssaA regulation and control model The method of yield.

First, ssaA gene overexpression improves the method that sansanmycin produces the yield of bacterial strain

Using the copy number increasing positive regulator gene and using strong promoter method come overexpression positive regulator gene, from And increase the yield of antibiotic.The method of the copy number of increase positive regulator gene involved in the present invention is directed to The recombinant expression plasmid of the positive regulator gene of one or more copies is imported in sansanmycin wild strain.This is a series of heavy Group expression plasmid all comprises the nucleotide sequence of ssaA gene, and the transcription of gene itself and translation initiation and termination signal, wherein The upstream of gene includes at least containing a kind of promoter sequence.

The present invention is according to ssaA gene order design primer (the SEQ ID No.2 being obtained above: TATCATATGGTGATCCTGACCTGGCGG and SEQ ID No.3:TATGGATCCTCAGGCACATTGTGCCCT), with Sansanmycin producing strains genomic DNA is template, enters performing PCR reaction, and amplified production comprises coded sequence and the gene of gene The transcription of itself and translation initiation and termination signal.

The carrier building recombinant expression plasmid can be autonomous replication carrier, exist as a kind of extrachromosomal entity Carrier, it replicates the duplication not relying on chromosome, can be presented in multicopy, for example, plasmid pKC1139 [Kieser T, Bibb MJ, Buttner MJ et al., streptomycete genetic manipulation handbook (Practical Streptomyces Genetics) Nowe is controlled (Norwich), The John Innes Foundation；2000].In addition, carrier can also be this A kind of carrier of sample, after introducing host cell, it is incorporated in genome and is replicated together with the chromosome integrated, for example, Plasmid pSET152 [Kieser T, Bibb MJ, Buttner MJ et al., streptomycete genetic manipulation handbook (Practical Streptomyces Genetics) Nowe controls (Norwich), The John Innes Foundation；2000], pL646 [Hong B, Phornphisutthimas S, Tilley E et al., streptomyces griseuses produce streptomycin can by with A- cascade The unrelated mechanism of adpA in regulation and control is regulated and controled (Streptomycin production by Streptomyces griseus can be modulated by a mechanism not associated with change in the adpA Component of the A-factor cascade), biotechnology communications (Biotechnol Lett) 2007,29:57- 64] etc..For autonomous replication, carrier can contain further enables carrier duplication of autonomous replication in host cell to rise Point, for example, including but not limited to allow the origin of replication of pIJ101, pJV1, pSG5, pSGL1 of duplication in streptomycete [Kieser T, Bibb MJ, Buttner MJ et al., streptomycete genetic manipulation handbook (Practical Streptomyces Genetics) Nowe is controlled (Norwich), The John Innes Foundation；2000].

The carrier of the present invention is preferably containing the selected marker enabling transformed cell easily to be screened one or more.Choosing Selecting property labelling is such a gene, and its product provides antibiotic resistance, Biocide or virus resistance, heavy metal resistance etc. Deng.The example of bacterial selectable marker includes but is not limited to give the ammonia benzyl as being used for screening in escherichia coli for the antibiotic resistance The labelling of penicillin, kanamycin, chloromycetin or tetracyclin resistance or the thiostrepton for streptomycete screening, A Pu mycin Resistance etc..

The selection of suitable expression vector depends on target gene to be expressed and selected prokaryotic host cell.It is applied to this The expression vector of invention includes but is not limited to pKC1139, pIJ680, pIJ486/487, pIJ702, pFD666, pSGL1, PSET152, pIJ6902, pIJ8600 or their derivant, other preferably expression vectors referring to Kieser etc., lose by streptomycete Pass and put into practice [Kieser T, Bibb MJ, Buttner MJ et al., streptomycete genetic manipulation handbook (Practical Streptomyces Genetics) Nowe controls (Norwich), The John Innes Foundation；2000].

A kind of nucleotide sequence that promoter sequence is identified by host cell for the expression of nucleotide sequence.Promoter sequence Transcriptional control sequence containing direct polypeptide expression in row.Promoter can be to show transcriptional activity in selected host cell Any nucleotide sequence, including saltant type, truncated-type and hybrid promoters, and can be from coding and host cell homology or heterologous Obtain in the gene of extracellular or intracellular polypeptide.For the recombinant expression plasmid guiding the present invention in sansanmycin producing strains The promoter that the available promoter of transcription including but not limited to obtains from following gene：(aminoglycoside phosphoric acid shifts aphD Enzyme gene), tsr (thiostrepton resistant gene), ermE (erythromycin resistance gene), (subtilisin presses down for ssi, vsi Preparation gene), STI-II (serpin gene), β-gal (galactosidase gene), vph (viomycin resistance Gene), the startup of the ermE gene of constructive expression after tipA (tipA gene in shallow Streptomyces glaucoviolaceus) etc. and mutation Sub- strong promoter ermE*p.

Using the plasmid pL646 being integrated in producing strains genome as carrier in the present invention, constitutive expression ErmE*p, as promoter, after the coded sequence of ssaA being cloned into the ermE*p promoter of pL646, builds overexpression plasmid pL-ssaA.Imported in sansanmycin producing strains using the method engaging transfer, obtain output increased about 100% crosses table Reach bacterial strain SS/pL-ssaA.

2nd, the method improving sansanmycin producing strain using ssaA regulation and control model.

The present invention has confirmed the regulation and control model of ssaA, and that is, sansanmycin can be by with reference to modulin SsaA, suppressing Its activation to sansanmycin biosynthesiss structural gene promoter, and then suppress the biosynthesiss of sansanmycin, shape Become the negative feedback inhibition process (as Fig. 9) of product.According to this regulation and control model, the present invention proposes to design releasing dead end product pair The suppression of SsaA, the method thus improving producing strain.It including but not limited to refers to remove dead end product in fermentation system To release negative feedback inhibition：

During antibiotic fermentation, remove dead end product sansanmycin from culture medium, for example, can be trained using continuous Support or add the methods such as small molecule adsorbent, remove or reduce the sansanmycin concentration in fermentation liquid, release it to regulation and control egg White negative feedback inhibition, reaches the very big accumulation of product and the raising of whole yield.

Brief description

Fig. 1：The chemical constitution of some components of Sansanmycins, pacidamycins and napsamycins.

M-Tyr, meta TYR；TIC, four dehydrogenations -3 '-isoquinoline acid；MetSO, methionine sulfoxide.

Fig. 2：The heredity arrangement of Sansanmycin biological synthesis gene cluster.

25 open reading frame and each 5 open readings of gene cluster upstream and downstream in Sansanmycin biological synthesis gene cluster The heredity arrangement of frame.

Fig. 3：FHA the and DBD domain constructs comparison result of the SsaA based on sequence alignment.

A：The prediction domain of SsaA.

B：FHA domain sequence between SsaA and its structure homology albumen compares.

C：DBD domain sequence between SsaA and its structure homology albumen compares.

Fig. 4：Block the impact to sansanmycin yield and biosynthesiss structural gene transcriptional level for the ssaA

Aa：SsaA blocks the PCR checking of bacterial strain.

Ab：SsaA blocks the Southern blot qualification result of bacterial strain.

B：SsaA blocks bacterial strain SS/AKO (2) and the bacteriostatic activity detection replying bacterial strain SS/AKO/pL-ssaA (3).

C：SsaA blocks bacterial strain SS/AKO and replys bacterial strain SS/AKO/pL-ssaA fermentation culture yield after 144 hours HPLC analyzes.

D：Real-time quantitative RT-PCR analysis wild strain, ssaA block bacterial strain SS/AKO and reply bacterial strain SS/AKO/pL- The expression of sansanmycin biosynthesis gene in ssaA.

Fig. 5：Gel blocking method analyzes the knot of SsaA albumen and sansanmycin biological synthesis gene cluster Natural promoter area Close.

A：Expression and purification in escherichia coli for the ssaA.M, molecular weight standard；1, full bacterium；2, albumen after purification.

B：SsaA albumen and ssak, ssaQ, ssaX-Y, ssaU-A-3, ssaB, ssaV promoter no combines.-, probe；+, Probe+albumen.

C：SsaA albumen and ssaH, ssaN-P, ssaC-D, ssaU-A-1p, ssaU-A-2p, ssaWp promoter region combines And have concentration-dependent relation.C, probe+albumen+competitor dna.

Fig. 6：The identification of the consistent binding sequence of SsaA.

A：Analyze the binding site in ssaN-Pp promoter region for the SsaA using footprinting.

B：Using WebLogo, the binding site of SsaA is compared, obtain the consistent binding sequence of SsaA.

C：The correctness of the concensus sequence being obtained using the checking of gel blocking method.D1, SsaA binding sequence；D2, D3, SsaA Binding mutation sequence.

Fig. 7：The regulating and controlling effect of the DNA binding activity to SsaA for the sansanmycins.

A：The impact that Sansanmycin A (SS-A) is combined with ssaC-Dp or ssaU-A-1p to SsaA (3.5pmol).Swimming Road 1：Comprise only probe；Swimming lane 2：Probe and the SsaA of 3.5pmol；Swimming lane 3-10：In addition to equal probe with the SsaA of 3.5pmol, The sansanmycin A (50,100,200,300,450,600,800,1,000 μM) gradually rising containing concentration respectively.

B：The impact that Sansanmycin H (SS-H) is combined with ssaC-Dp or ssaU-A-1p to SsaA (3.5pmol).Swimming Road 1：Comprise only probe；Swimming lane 2：Probe and the SsaA of 3.5pmol；Swimming lane 3-10：In addition to equal probe with the SsaA of 3.5pmol, The sansanmycin A (50,100,200,300,450,600,800,1,000 μM) gradually rising containing concentration respectively.

C：Surface plasma body resonant vibration method is analyzed SS-A (12.5,25,50 μM of 3.125,6.25) and is coupled at CM5 core The interaction of SsaA is obtained on piece.

D：Surface plasma body resonant vibration method is analyzed SS-H (12.5,25,50,100,200 μM) and is coupled on CM5 chip Obtain the interaction of SsaA.

E：Surface plasma body resonant vibration method analyze SsaA and ssaC-Dp-3 fragment combination be subject to SS-A (50,100, 200,300 μM) suppression.

Fig. 8：The impact to sansanmycin yield for the overexpression ssaA.

A：The bacteriostatic activity detection of ssaA overexpression bacterial strain SS/pL-ssaA and control strain SS/pSET152.

B：Overexpression bacterial strain overexpression bacterial strain SS/pL-ssaA and control strain SS/pSET152 fermentation culture are after 144 hours The HPLC analysis of yield.

Fig. 9：The reverse feedback regulation ideograph to ssaA for the sansanmycin.

SS, sansanmucin.

Specific embodiment

The structure of embodiment 1.Streptomyces sp.SS genomic library, screening

The extraction of Streptomyces sp.SS genomic DNA according to《Streptomycete genetic manipulation handbook》Described in method Carry out [Kieser T, Bibb MJ, Buttner MJ et al., streptomycete genetic manipulation handbook (Practical Streptomyces Genetics) Nowe controls (Norwich), The John Innes Foundation；2000].Use first Sau3AI by the DNA fragmentation of Streptomyces sp.SS genomic DNA portion enzyme action to 40-50kb size, using small intestinal alkali Acid phosphatase (NEB) is to these fragment dephosphorylation process.POJ446 uses HpaI enzyme action first, and small intestinal phosphorylase removes phosphoric acid Change, recycle BamHI enzyme action, obtain the two-arm of long 2.0kb and 8.0kb.Using T4 ligase by genome processed above Fragment and carrier two-arm connect.Connection product utilizes Gigapack III XL Gold packaging extract (Stratagene) carry out in vitro package, by recombinant phage transfection host cell E.coli XL-1blue MR.Using alkalescence The probe ssaQ of phosphatase enzyme mark, ssaF (GE Healthcare, Amersham Gene Images AlkPhos Direct Labelling and Detection System) colony hybridization screening is carried out to about 6000 clones in acquisition library.Miscellaneous Hand over and wash temperature is 65 DEG C of (GE Healthcare, Amersham Gene Images AlkPhos Direct Labelling and Detection System).Using CDP-Star (GE Healthcare, Amersham Gene Images AlkPhos Direct Labelling and Detection System) detected.Picking positive colony enters Row shotgun sequencing.

Embodiment 2.ssaA blocks structure and the detection of sansanmycin yield of strain

Using PCR-targeting method [Gust B, Challis GL, Fowler K et al., using PCR- practice shooting Method is replaced to the gene of streptomycete and is found that the necessary protein structure domain (PCR- of biosynthesiss sesquiterpene targeted Streptomyces gene replacement identifies a protein domain needed for Biosynthesis of the sesquiterpene soil odor geosmin), NAS's proceeding (Proc.Natl.Acad.Sci), 2003,100 (4)：1541-1546] ssaA gene is carried out function blocking.Design one first To primer P1 and P2 (SEQ ID No.4: AAGACCCGCCACCACGGCAGCTCCGACGCCAAGGAACGGattccggggatccgtcg acc and SEQ ID No.5: ACGTTTGAGATCGGGAAGCAGCGCCAGGTGTTCCTCCCGtgtaggctggagctgct tc), 5 ' ends of each primer There are 39bp and target gene ssaA homology, there are 19 or 20bp and streptomycin resistance gene (aadA) homology in 3 ' ends, with containing aadA's Plasmid pIJ779 is template, and obtaining middle by PCR is streptomycin resistance gene, and its two ends is that the linear of the homology arm of 39bp beats Target DNA.By electroporated for linear target practice DNA in the Host Strains BW25113/10R-1-SCP2KO containing Red recombination system, lure Lead Red recombination system to express in right amount, lambda exonuclease is attached to linear target practice DNA two homology arm end, enzyme action produces free 3 ' Single stranded DNA section, so that sent out between the target gene ssaA on two homology arms and cosmid 10R-1-SCP2KO in the way of chain intrusion Raw restructuring.Linear target practice DNA is inserted between homology arm, and the DNA sequence between upper two homology arms of cosmid 10R-1-SCP2KO (574bp) replaced by it, thus completing the orientation to ssaA to knock out the cosmid 10R-1-SCP2KO- obtaining target gene disappearance AKO.By engaging the method that shifts, 10R-1-SCP2KO-AKO is imported in Streptomyces sp.SS, first with containing There is the bacterial strain of homologous single-crossover in the MS solid medium screening of A Pu mycin, then by this single exchange strains without antibiotic S5 solid medium on continuous pass 5-6 generation after, select the double crossing over bacterial strain sensitive to A Pu mycin.Side first with PCR Method verifies, primer P3 and P4 is respectively in the position of about 100bp outside 39bp homologous sequence to the double crossing over bacterial strain obtaining Put, ssaA blocks the fragment that bacterial strain should be able to expand about 1.56kp, and wild-type strain then should be able to expand 0.93kb's Fragment (as Fig. 4 Aa).The method recycling Southern blotting is verified further, is made with streptomycin resistance gene aadA For probe, carry out enzyme action with PstI genome, due to there is not streptomycin resistance gene aadA in wild-type strain, therefore should Hybridization is less than band；And ssaA blocks the fragment (as Fig. 4 Ab) that bacterial strain then should be able to hybridize to 5.9kb.PCR detection and Southern blotting results of hybridization is consistent with expection, shows that ssaA is correct in Streptomyces sp.SS Knock out, block strain and be named as SS/AKO.

Detect, using bacteriostatic experiment, the change of production blocking bacterial strain, result shows, compared with wild-type strain, block bacterial strain The fermentation liquid of SS/AKO no bacteriostasis, do not produce sansanmycin, but work as and lead expression plasmid by engaging the method shifting When entering to block in bacterial strain SS/AKO, transformant SS/AKO/pL-ssaA of acquisition has been recovered to produce the ability of sansanmycin again (as Fig. 4 B and 4C), confirmation ssaA is sansanmycin biosynthesiss positive regulator gene further.

Embodiment 3.ssaA blocks the analysis of gene expression in bacterial strain

After the culture 48 hours in the fermentation medium of each bacterial strain inclined plane inoculating, 10mL bacterium solution is collected by centrifugation, utilizes PureYield^TMRNA Midiprep System (Promega company of the U.S.) extracts total serum IgE.Using great company of Beijing Yuanping City Turbo Script1st-strand cDNA Synthesis Kit synthesizes the first chain cDNA.Divided using real-time fluorescence quantitative PCR SsaA and structural gene ssaH in analysis SS/AKO, the transcriptional level of ssaN, ssaP, ssaX, ssaC, selected structural gene is base Because of some gene in the border of cluster or the contrary gene of two transcriptional orientations.Result shows, with wild strain and reply Bacterial strain SS/AKO/pL-ssaA compares, and is nearly no detectable the transcription of these genes in blocking bacterial strain SS/AKO.And reply In bacterial strain, the transcriptional level ratio of these genes is high in wild-type strain, this yield water with two bacterial strain sansanmycin Flat is consistent.Above test result indicate that, ssaA is to regulate and control sansanmycin by the transcriptional level of control structure gene Yield.

Embodiment 4. gel shift method analyzes the target start sub-district of SsaA

Using primer ssaA-pET16b-F and ssaA-pET16b-R (SEQ ID No.2 and SEQ ID No.6: TATCTCGAGTCAGGCACATTGTGCCCT) expand 747bp ssaA complete genome coding region, this fragment is cloned into pET- NdeI the and Xho I site of 16b, obtains recombiant plasmid pET-16b-A, and sequencing correctly converts afterwards to E.coli BL21 (DE3) In.Recombinant bacterial strain is inoculated in ZYM-5052 culture medium, cultivates to OD=1.0 at 37 DEG C, after 20 DEG C of continuation 16 hours Collects thalline.Expression product SsaA albumen merges 10 histidine in N-terminal, using HisTrap^TMFF crude(Amer-sham Biosciences) to His₁₀- tagged SsaA carries out purification, is then taken off using the desalting column PD-10 of GE company of the U.S. Salt, the His after desalting processing₁₀- tagged SsaA be stored in TGEK buffer (10mM Tris-Hcl, 10% Glycerol, 0.1mM EDTA, 50mM KCl, pH7.9), be stored in -80 DEG C stand-by.

12 gene promoter area fragments ssaHp in design primer amplification gene cluster, ssaKp, ssaN-Pp, ssaQp, SsaX-Yp, ssaU-A-1p, ssaU-A-2p, ssaU-A-3p, ssaBp, ssaC-Dp, ssaVp and ssaWp is probe (genetic interval of ssaU and ssaA divides into three overlapped DNA fragmentations), with Thermo Scienticfic company Test kit carries out gel shift experiment.Result display SsaA can be with intergenic region ssaN-Pp, ssaU-A-1p, ssaU-A- 2p and ssaC-Dp or bordering gene upstream promoter area combine to form stable complex, but can not be with other detections DNA fragmentation combine (as Fig. 5), point out sansanmycin gene cluster in most gene be to be entered in the form of operator Row transcription.

Above test result indicate that SsaA is by being directly combined to the promoter region of structural gene thus controlling The yield of sansanmycin.

The identification of the consistent binding sequence of embodiment 5.SsaA

Using footprinting, the gene promoter area fragment being combined with SsaA above is analyzed, to obtaining SsaA Binding site in these fragments.Using method amplification gene promoter region DNA fragmentation ssaN-Pp, the ssaU-A-1p of PCR, SsaU-A-2p and ssaC-Dp, is cloned in pGEM-T carrier, and the correctness of sequence verification sequence.Drawn using general Thing T7 and SP6 (wherein one primer is marked by the use of 5 '-Alexa-647) amplification of DNA fragments is as probe.PCR primer fine jade After sepharose Purified in electrophoresis reclaims, carry out concentration mensuration using spectrophotometer NanoDrop 2000.By 240pmol His₁₀The DNA fragmentation of-SsaA and 50ng labelling cumulative volume be 90 μ l system in be incubated 20 minutes in 25 DEG C, add 0.1U DNase I (grade I, Roche, Mannheim, Germany) digests 60 seconds in 30 DEG C, adds 10 μ l 500mM EDTA (pH 8.0) heats 10 minutes with terminating reaction in 70 DEG C.The DNA fragmentation of digestion is dissolved in 20 μ l after phenol-chloroform extracting and reclaiming Sample-loading buffer in (the DNA size criteria 600 containing 0.3 μ l, Beckman Coulter, CA, USA).Using GenomeLab GeXP Genetic Analysis System (Beckman Coulter) is analyzed to sample, gained Data separate GenomeLab eXpress Profiler program (Beckman Coulter) is analyzed processing, and obtains SsaA obtains binding site on these gene promoter areas.

Using WebLog, the gene promoter area binding site obtaining is compared, obtain the consistent binding sequence of SsaA GTMCTGACAN2TGTCAGKAC (as Fig. 6 B), containing two 9bp inverted repeat (inverted repeat, IR), middle Interval 2bp catenation sequence.In order to verify the correctness of the concensus sequence of acquisition, design three oligonucleotide sequences, first only Containing classical consistent binding site (GTCCTGACAGCTGTCAGGAC, D1), one of anti-in Article 2 oligonucleoside sequence It is replaced by ATTCA (GTCATTCAAGCTGTCAGGAC, D2) to the CTGAC of sequence, in Article 3 oligonucleotide sequence, have one The GTCAG of individual reverse sequence is lacked (GTCCTGACAGCT-----GAC, D3).With gel shift test detection SsaA and these The binding ability of oligonucleotide sequence, experiment shows that SsaA can only combine to form stable complex (as Fig. 6 C) with D1.Experiment Our correctness of concensus sequence of obtaining of result verification, and illustrate two inverted repeat pair in concensus sequence All critically important in the combination of SsaA.

Embodiment 6.sansanmycin can be by interacting thus changing the DNA binding activity of SsaA with SsaA

In order to detect that whether end-product sansanmycin have an impact to the DNA binding activity of SsaA, using in embodiment 5 Described gel shift experimental technique, adds sansanmycin A (SS-A) and sansanmycin H (SS- in reaction system H), detect under conditions of sansanmycin exists, the combination energy of SsaA and gene promoter area ssaC-Dp and ssaU-A-1p Power.Test result indicate that, when the concentration of sansanmycin A adding in reaction system gradually rises, SsaA and mesh The binding ability of mark DNA gradually weakens (as Fig. 7 A).The concentration of the sansanmycin H adding when reaction system gradually rises When, also obtain similar result (as Fig. 7 B).Surface plasma body resonant vibration (surface plasmon resonance, SPR) Experiment also demonstrates the above results, and PCR amplification obtains ssaC-Dp-3 promoter region DNA fragmentation, after carrying out 3 '-Biotin labellings, It is coupled to SA chip surface, coupling density is 200RU (Response Unites, RU), when addition in the SsaA sample of 100nM During the SS-A that concentration is gradually increased, the binding curve of SsaA and saC-Dp-3 is gradually inhibited (as Fig. 7 E).Experimental result table Bright sansanmycin is inhibited to the DNA binding activity of SsaA.

In order to whether observe sansanmycin by interacting thus affecting its DNA binding activity with SsaA, we Carry out SPR experiment using CM5 chip.Amino coupled test kit first with GE Healthcare company of the U.S. is even by SsaA It is coupled to CM5 chip surface, density is 8500RU.When SS-A the or SS-H sample introduction gradually rising concentration, its knot with SsaA Close curve to be gradually increased, and there is concentration dependent (as Fig. 7 C and 7D).Experimental result explanation sansanmycin be by with SsaA interacts thus changing the DNA binding activity of SsaA, realizes negative feedback inhibition.

The overexpression research of embodiment 7.ssaA

Expand ssaA using primer ssaA-pET16b-F and ssaA-pICL-R (SEQ ID No.1 and SEQ ID No.2) Gene coding region fragment (747bp), is cloned in pGEM-T carrier, through sequencing determine correct after, be cloned into pL646 NdeI and BamHI site, obtains recombiant plasmid pL-ssaA, is integrated in Streptomyces sp.SS by engaging transfer, and integrates To its chromosomeAttB site, obtains overexpression bacterial strain SS/pL-ssaA.Overexpression bacterial strain is fermented, and with pressing down The experiment of bacterium Activity determination and HPLC analysis determine sansanmycin yield.By the wild mushroom of same concentrations and overexpression bacterial strain spore Fullness over the chest during pregnancy liquid is inoculated in 100ml seed culture medium in 28 DEG C of concussion and cultivates 72 hours.With 5% inoculum concentration transferred species to 100ml bis- In level fermentation medium, continue culture 7 days in 28 DEG C.Sansanmycin activity is the suppression to Pseudomonas aeruginosa by it Be constructed for detection.290 μ l fermented liquid supernatant are added and is placed on F403 calibrating solid medium (containing Pseudomonas aeruginosa In Oxford cup on 1%V/V), cultivate 16 hours for 37 DEG C, judge the height of its activity by the size measuring inhibition zone.Knot Fruit shows, compared with wild-type strain, the yield of overexpression bacterial strain SS/pL-ssaA is significantly improved (as Fig. 8 A).

Using HPLC, the yield of overexpression bacterial strain is analyzed, by the fermentation liquid of wild mushroom and overexpression bacterial strain carry out from The heart, collects supernatant.Take 2ml fermented liquid supernatant C₁₈Cartrige column (360mg, Millipore, MA, USA) adsorbs, first With 5ml deionized water wash pillar, then use the methanol of 2ml 60% will adsorb under the sansanmycin eluting on pillar Come.The eluent taking 30 μ l carries out HPLC analysis, and chromatographic column is：Waters XBridge^TMC₁₈column(4.6×150mm, 3.5μm,Waters,Dublin,Ireland)；Flow velocity is 1ml min^-1；Column temperature is 40 DEG C；Mobile phase is：0.1% (W/V) (NH4) 2CO3-MeOH in 40 minutes from 80:20 gradients are changed into 60:40；Detection wavelength is：254nm.Test result indicate that, mistake High about 100% (as Fig. 8 B) of the yield of expression strain SS/pL-ssaA.

Claims (4)

1. improve sansanmycin and produce the method that bacterial strain produces the yield of sansanmycin, adjust including making biosynthesiss The expression that section gene ssaA produces in bacterial strain in sansanmycin improves, the sequence of described biosynthetic regulation of collagen gene ssaA As shown in SEQ ID No.1, described production bacterial strain is streptomycete (Streptomyces).

2. method according to claim 1 is it is characterised in that described expression rises to：Will be with biosynthetic regulation of collagen gene The vector introduction that ssaA is operably connected produces to sansanmycin and realizes described expression raising in bacterial strain.

3. biosynthetic regulation of collagen gene ssaA produces bacterial strain production sansanmycin's in preparation for improving sansanmycin Purposes in the recombinant vector of yield, the sequence of described biosynthetic regulation of collagen gene ssaA is as shown in SEQ ID No.1.

4. improve sansanmycin bacterial strain using the product reverse feedback regulation pattern of biosynthetic regulation of collagen gene ssaA gene to produce The method of amount, methods described includes：Constantly remove sansanmycin end-product during the fermentation, improve sansanmycin's Whole yield；The sequence of described biosynthetic regulation of collagen gene ssaA is as shown in SEQ ID No.1.