CN101195655B - Regulating protein for polyoxin synthesis, encoding gene and application thereof - Google Patents

Abstract

The invention discloses a polyoxin synthesized regulatory protein, a relative encoding gene and application thereof, wherein the protein is represented as (a) or (b), (a) is the protein composed of amino acid residue sequences of sequence 1 in a sequence table, (b) is the protein derived from (a) via substituting and/or deleting and/or adding one or several amino acid residues on the amino acid residue sequences of sequence 1 in a sequence table, with polyoxin synthesis function. The inventive polyoxin synthesized regulatory protein and relative encoding gene has significant value for polyoxinproduction and high value for improving Polyoxin yield.

Description

The synthetic modulin of a kind of Polyoxin and encoding gene and application

Technical field

The present invention relates to the synthetic modulin of a kind of Polyoxin and encoding gene and application.

Background technology

Polyoxin belongs to the peptidyl nucleoside antibiotics, and this class microbiotic also comprises new Polyoxin, albomycin, aminopurine mycin, miharamycin and nikemycin except Polyoxin.Polyoxin has been realized commercially producing in Japan, and is extensive use of as antimycotic agricultural chemicals on agricultural.Polyoxin is that cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis) produces, and is that first finds to suppress the biosynthetic nucleoside antibiotics of fungal cell wall chitin, is mainly used in the control plant pathogenic fungi and infects.The pyridine base yl nucleosides of Polyoxin mainly contains four kinds of uridine, thymus pyrimidine, HMU (5-hydroxyl methyluracil) and 5-carboxylic acid uridylics.On the structure, Polyoxin is the analog of UDP-GlcNAc, activity (the Endo of competitive inhibition chitin synthetase, A., Kakiki, K., and Misato, T.1970.Mechanism of action of the antifugalagent polyoxin D.J.Bacteriol.104:189-196; Hori M, Eguchi J, Kakiki K, MisatoT.1974.Studies on the mode of action of polyoxins.VI.Effect of polyoxin B onchitin synthesis in polyoxin-sensitive and resistant strains of Alternariakikuchiana.J Antibiot (Tokyo) .27 (4): 260-266).

Polyoxin is as the advantage that agricultural antifungal antibiotic uses: 1) toxicity is low, be widely used, be applied to agriculture production in states such as Japan for more than 30 years as the ideal biological pesticide, not having the pollution problem to environment, is that the expert that various countries produce various green foods recommends first-selected medication.2) though Polyoxin has been used many decades, the bacterium that do not find the cause of disease so far produces large-scale resistance.3) Polyoxin is as safe as a house to crop, even overdose also is difficult for producing poisoning.4) working concentration of Polyoxin is 50～200ppm, and useful effect dosage is low, has high efficiency.

Polyoxin mechanism of action uniqueness, it optionally suppresses chitinous the synthesizing of composition of fungal cell wall.The similarity of different fungal cell wall route of synthesis has determined the broad spectrum of this product, and Polyoxin all has stronger restraining effect to mastigomycetes, ascomycetes, 25 kinds of fungies of imperfect fungi.

Polyoxin is except as the agricultural antifungal antibiotic, and Polyoxin D has restraining effect to medically important fungi.Gottlieb et al report Polyoxin D in 1991 handles Candida albicans (C.albicans) can make it that epithelial adherence rate is reduced.This some component of hint Polyoxin may cause that application prospect is arranged in the disease treatment fungi.The Polyoxin D of lower concentration handles palace portion's cochliobolus (Cochliobolusmiyabeanus), forms the protoplastis spline structure of osmotic pressure sensitivity; Under the high density, can cause the Candida albicans chainingization, terminal globoferous cell is to the osmotic pressure sensitivity, and these terminal globoferous cells are put into water and can be broken after Polyoxin is handled, and in 1.5M KCl solution plasmolysis take place.Because Polyoxin is to the restraining effect of chitin synthetase, albicans cell can be swelling to 2 to 3 times of (Endo of original size, A., Kakiki, K., and Misato, T.1970.Mechanism of action of the antifugal agent polyoxinD.J.Bacteriol.104:189-196; Becker JM, Covert NL, Shenbagamurthi P, Steinfeld AS, Naider be D inhibits growth of zoopathogenicfungi Antimicrob Agents Chemother.23 (6) F.1983.Polyoxin: 926-929).In addition, Polyoxin also influences the formation of Candida albicans germ tube.

Since Polyoxin separates from the cocoa streptomycete first from nineteen sixty-five, add by substrate with the study group headed by the Isono, isotopically tagged method is inferred the route of synthesis that Polyoxin, but the report that does not also have Polyoxin synthetic gene to be cloned so far is to the biosynthetic molecular mechanism of Polyoxin and even still belong to blank so far to its Study of Mechanism.Studies show that antibiotic biosynthesizing relates to the biochemical reaction of a series of complexity, relevant therewith gene cluster is arranged, and their expression is subjected to multilevel multi-level regulation and control.Usually the biosynthetic regulation and control of microbiotic are mainly carried out three levels: the regulation and control of (1) approach specificity; (2) all relevant with the form differentiation with microbiotic multiple-effect is regulated and control; (3) regulation and control of overall importance.Approach specificity regulatory gene (Pathway-SpecificRegulatory Genes) is only regulated and control certain antibiotic biosynthesizing specifically.These regulatory genes generally interlock in microbiotic biosynthesis gene cluster, regulate and control transcribing of they.The most antibiotics biological synthesis gene cluster all comprises approach specificity regulatory gene, has plenty of one, has plenty of two or more.

Summary of the invention

The purpose of this invention is to provide the synthetic modulin of kind of Polyoxin and encoding gene and application.

Polyoxin provided by the present invention synthesizes modulin, and name is called polR, is following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the synthetic adjusting function of Polyoxin by (a) deutero-protein.

Wherein, the sequence in the sequence table 1 is made up of 1112 amino-acid residues.

In order to make polR in (a) be secreted in cell pericentral siphon or the substratum or to make its function-stable, proteinic N end that can the amino acid residue sequence of sequence 1 is formed in by sequence table connects signal peptide sequence, for the polR in (a) is convenient to purifying, proteinic N end or C end that can the amino acid residue sequence of sequence 1 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1. label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	11	EQKLISEEDL

Above-mentioned (b) but in the polR synthetic, also can synthesize its encoding gene earlier, carry out biology according to following method again and express and to obtain.The encoding gene of polR in above-mentioned (b) can pass through SEQ ID № in the sequence table: the codon of one or several amino-acid residue of disappearance in 2 the dna sequence dna, and/or carry out the missense mutation of one or several base pair, and/or at the encoding sequence of its 5 ' end attach signal peptide, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The encoding gene (polR) of the synthetic modulin of above-mentioned Polyoxin also belongs to protection scope of the present invention.

The encoding sequence of the encoding gene (polR) of the synthetic modulin of described Polyoxin is 5 ' end 420-3758 position nucleotide sequence of sequence 2 in sequence table.

The genomic gene of the synthetic modulin of above-mentioned Polyoxin can have one of following nucleotide sequence:

1) dna sequence dna of sequence 2 in the sequence table;

2) polynucleotide of protein sequence shown in the sequence 1 in the code sequence tabulation;

3) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with sequence in the sequence table 2.

Wherein, sequence 1 is made up of 3809 deoxynucleotides in the sequence table, and 5 of sequence 2 ' end 420-3758 position nucleotides sequence is classified encoding sequence as in sequence table.

The rigorous condition of above-mentioned height can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.

The expression vector, transgenic cell line and the host bacterium that contain the encoding gene of the synthetic modulin of above-mentioned Polyoxin all belong to protection scope of the present invention.

It is big more a lot of than general microbiotic biosynthetic controlling albumen (200-400aa) that Polyoxin of the present invention synthesizes modulin (1112aa), is a kind of new microbiotic modulin.

Show by gene functional research, polR in the source bacterial strain cocoa streptomycete Ah rope mutation of the encoding gene polR of the synthetic modulin of Polyoxin of the present invention is destroyed, this bacterial strain has promptly lost the generation ability of Polyoxin, again the polR gene of introducing a copy in the ruined mutant strain of polR can make Polyoxin produce again, shows that this gene is the synthetic positive regulating gene of a Polyoxin.

Experimental results show that, in cocoa streptomycete Ah rope mutation, import the polR gene of single copy, can make the Polyoxin output of this bacterial strain improve 2-3 doubly, illustrate that synthetic modulin of Polyoxin of the present invention and encoding gene thereof are extremely important to the production application of Polyoxin, have great value aspect the raising Polyoxin output (Polyoxin).

Description of drawings

Fig. 1 is that the HPLC of Polyoxin in the polR gene disruption mutant strain fermented liquid analyzes collection of illustrative plates

Fig. 2 is the pSET152::polR plasmid map

Fig. 3 is that the activity of Polyoxin in the high-yielding engineering bacterial strain detects

Fig. 4 produces the curve of Polyoxin output for high-yielding engineering bacterial strain

Fig. 5 is that the HPLC of Polyoxin in the high-yielding engineering bacterial strain analyzes

Embodiment

The acquisition of embodiment 1, the synthetic modulin of Polyoxin and encoding gene (polR) thereof

The present invention screens cocoa streptomycete cosmid library with structure gene sanX in the nikemycin biosynthetic pathway in the streptomyces ansochromogenes as probe, the positive colony cosmid 9A that screens has been carried out the subclone order-checking, and it sequencing and analysis have been carried out, find 34 open reading frame altogether, wherein the polR gene is positioned at the flank of polyoxin biosynthesis gene a small bundle of straw, etc. for silkworms to spin cocoons on.The acquisition concrete grammar of synthetic modulin of Polyoxin of the present invention and encoding gene (polR) thereof is as described below.

1, the preparation of probe

According to the sequence information of streptomyces ansochromogenes sanX gene design degenerate primer (dxf:5 '-GTGACCCTSATCCCSGACCTSATCGAG-3 '; Dxr:5 '-GACCGCGGCGGCGCGCAGRTCSGTSGC-3 '), with cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis strain; Available from CGMCC; AS4.1602) total genome carries out the dna fragmentation (sequence 3 in the sequence table) that pcr amplification goes out 466bp as template, find that through order-checking its amino acid sequence coded and SanX homology are 70%, with behind this dna fragmentation usefulness on-radiation digoxigenin labeled as the probe of gene clone.

2, make up genome cosmid library

Extract cocoa streptomycete Ah rope mutation (Streptomyces cacaoivar.asoensis strain; CGMCC (China General Microbiological Culture Collection Centre); AS4.1602) total DNA, pulsed field gel electrophoresis guarantees that total DNA size is more than 200kb.Choose restriction enzyme Sau3A and genome is carried out enzyme cut, the control enzyme is cut the time, guarantees that endonuclease bamhi size is 30-50kb, and dna fragmentation is carried out the dephosphorylation processing with calf intestine alkaline phosphatase (CIAP).Plasmid supercosl (available from stratagene) is carried out enzyme with XhoI cut back to close, carry out dephosphorylation with CIAP and handle, carry out enzyme with BamHI and cut, obtain two 6.9kb of difference and 1kb dna fragmentation as vector arms.The dna fragmentation of 30-50kb after enzyme cut mixes with 1kb dna fragmentation vector arms with 6.9kb and is connected, connect product and pack transfection E.coli Xblue MR bacterial strain (available from stratagene) with phage packaging albumen, coating amp resistance LB flat board, average per 1200 clones promptly form a complete cocoa streptomycete cosmid genomic library.

3, the acquisition of synthetic modulin of Polyoxin and encoding gene (polR) thereof

The 466 bp sanX homologous dna fragments that step 1 is obtained are as probe, by colony hybridization the cosmid gene library of the cocoa streptomycete of step 2 acquisition is screened, the positive colony cosmid 9A that screening is obtained send with Invitrogen order-checking company and checks order, the sequencing result (about 40kb) of cosmid 9A is analyzed, find that this sequence flank has shown a complete open reading frame (ORF), with its called after polR.The polR size is 3339bp, 5 of sequence 2 ' end 420-3758 position nucleotide sequence in sequence table, encode a protein of being made up of 1112 amino-acid residues (PolR), i.e. amino acid residue sequence shown in the sequence 1 in the sequence table.In the protein sequence database of NCBI, carried out homology relatively, find microbiotic biosynthetic controlling albumen (the SARPs) (Liu of PolR and streptomycete, G., Tian, Y., Yang, H., and Tan, H. (2005) A pathway-specific transcriptionalregulatory gene for nikkomycin biosynthesis in Streptomyces ansochromogenesthat also influences colony development.Mol Microbiol 55:1855-1866) higher homology is arranged, but its coded albumen (1112aa) is big more a lot of than general microbiotic biosynthetic controlling albumen (200-400aa), is the novel microbiotic modulin of a class.The structure prediction analysis find this proteic aminoterminal exist an intestinal bacteria transcriptional regulator OmpR type the DNA binding domains (in sequence table sequence 1 N-terminal the 30th to the 110th amino acids).

With cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis strain; AS4.1602) total DNA is as template, and with P3:5 ' GCCGGTGGACGATGTTCG 3 ', P4:5 ' GAACGCTCCTGGTCGCTCATC 3 ' is a primer, carries out pcr amplification, and the PCR system is H ₂O 27ul, DMSO2.5ul, 10 * KOD buffer 5ul, dNTP 5ul, MgCl ₂2ul (2mmol/L), each 3ul of P3/P4 concentration 5pmol/ul, total dna profiling 1.5ul (total about 50ng of DNA), (cumulative volume 50ul mixing carries out PCR to KOD plus for TOYOBOCO., LTD.Japan) 1ul, and the PCR program is 95 ℃ of 2min of elder generation; 94 ℃ of 30s then, 55 ℃ of 30s, 68 ℃ of 3.5min, totally 30 circulations; Last 68 ℃ are extended 10min, the result obtains the fragment of 3809bp, to check order after this fragment recovery, the result shows that this fragment has the nucleotide sequence of sequence 2 in the sequence table, it is the polR gene fragment, 5 of sequence 2 ' end 420-3758 position Nucleotide is encoding sequence in sequence table, the amino acid residue sequence of sequence 1 in the code sequence tabulation.

The functional verification of embodiment 2, polR gene

1, makes up polR blocked mutant and verify that this sudden change influences the Polyoxin synthetic

1) structure of the destruction carrier (pDR101) of polR gene

At two primers of polR indoor design (P1 and P2); P1:5 '-GAACGCTCCTGGTCGCTCATC-3 '; P2:5 '-ACGCCACCCTCCAGACCTACA-3 '.

With cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis strain; AS4.1602) total DNA is that primer carries out pcr amplification as template with P1 and P2, obtains the dna fragmentation of long 1885bp, shows through order-checking, and this fragment has 5 ' end 643-2527 position nucleotide sequence of sequence 2 in the sequence table, with this fragment name position polR-1.

The fragment that above-mentioned amplification is obtained is inserted into plasmid pKC1139 (Bierman M with flush end, Logan R, OBrien K, Seno ET, Rao RN, Schoner BE (1992) Plasmid cloning vectors forthe conjugal transfer of DNA from Escherichia coli to Streptomyces spp.Gene 116:43-49) EcoRV site, obtain recombinant vectors, and this recombinant vectors carried out enzyme is cut and sequence verification, will cut and check order through enzyme and show and contain the segmental recombinant plasmid name position pKC1139::polR-1 of polR-1 that above-mentioned amplification obtains.

The plasmid Supercos1 (available from stratagene) that will contain kalamycin resistance gene dna fragmentation (neo), behind BglII and SmaI double digestion, reclaim the dna fragmentation of 1kb and carry out flush endization with mung-bean nuclease, be inserted into the inner SmaI site of polR gene on the pKC1139::polR-1 plasmid, select the destruction carrier of the kantlex fragment direction of insertion recombinant plasmid (pKC1139::polR-1::neo) identical, called after pDR101 as the polR gene with the polR transcriptional orientation.

2) the polR gene disruption obtains polR deletion mutantion strain

At first pDR101 is changed over to E.coli ET12567 (MacNeil, D.J., Gewain, K.M., Ruby, C.L., Dezeny, G., Gibbons, P.H., and MacNei l, T. (1992) Analysis ofStreptomyces avermitilis genes required for avermectin biosynthesisutilizing a novel integration vector.Gene 111:61-68.), E.coliET12567 is dam ^-Dcm ^-HsdS ^-Bacterial strain, pDR101 is removed possible restriction and modification, extract the pDR101 plasmid in the E.coliET12567 transformant that obtains, the method of the protoplast transformation by streptomycete PEG1000 mediation changes pDR101 among the cocoa streptomycete Ah rope mutation (AS4.1602) over to, is the selection markers positive transformant with the apramycin.Concrete grammar is as described below:

A. centrifugal YEME substratum (Difco Yeast Extract 3g, Difco Tryptone5g, Oxoid Malt Extract 3g, the solution of the following bacterium of going out of adding before Sucrose 200g, adding distil water use to 1000ml: the MgCl of 2ml 2.5M of being collected in ₂.6H ₂O solution 20ml quality percentage composition is 50% Glucose solution, 50ml quality percentage composition is 10% Glycine solution) in cultivate about 40 hours cocoa streptomycete Ah rope mutation (AS4.1602) thalline, be that 10.3% sucrose solution is washed thalline 2 times with the quality percentage composition;

B. the thalline of using lysozyme soln (with protoplastis damping fluid configuration) the suspension step a of 2-4mg/ml to obtain at 30 ℃ of enzymolysis, forms protoplastis to microscopy; Shake test tube between action period several times, prevent that thalline from sinking to the bottom;

C. add protoplastis damping fluid (sucrose 103g, K in the thalline after step b handles ₂SO ₄0.25g, MgCl ₂6H ₂O, 2.02g, liquid microelement (ZnCl ₂40mg, FeCl ₃.6H ₂O 200mg, CuCl ₂.2H ₂O 10mg, MnCl ₂.4H ₂O 10mg, Na ₂B ₄O ₇.10H ₂O 10mg, (NH ₄) ₆Mo ₇O ₂₄.4H ₂O10mg, adding distil water is to 1000ml) 2ml, adding distil water is sterilized to 800ml, and add the following solution that bacterium is crossed in death of monks or nuns with preceding every 40ml: 0.5ml quality percentage composition is 0.5% KH ₂PO ₄Solution, 5ml quality percentage composition are 3.68% CaCl ₂2H ₂O solution, 5ml quality percentage composition is 5.73%, the TES solution of pH7.2) filter, obtain the protoplastis suspension;

D. centrifugal 10 minutes of the protoplastis suspension 3000rpm that step c is obtained abandons supernatant, suspends with remaining protoplastis damping fluid and precipitates; Add the protoplastis damping fluid and wash 1-2 time, centrifugal, abandon supernatant, suspend with remaining protoplastis damping fluid and precipitate;

E. add the DNA (pDR101) that will transform, mixing, add PEG1000 solution (with the configuration of protoplastis damping fluid) immediately to final concentration 25% (g/ml), mixing, add the protoplastis damping fluid within 3 minutes, centrifugal 7 minutes of 3000rpm abandons supernatant, suspends with remaining protoplastis damping fluid and precipitates;

F. add the protoplastis damping fluid, mixing is made into protoplastis concentration and is about 10 ⁸The protoplastis suspension of individual/ml, each R2YE flat board (agar 20g, sucrose 103g, MgCI ₂6H ₂O10.12g, K ₂SO ₄0.25g, liquid microelement (ZnCl ₂40mg, FeCl ₃.6H ₂O 200mg, CuCl ₂.2H ₂O 10mg, MnCl ₂.4H ₂O 10mg, Na ₂B ₄O ₇.10H ₂O 10mg, (NH ₄) ₆Mo ₇O ₂₄.4H ₂O10mg, adding distil water is to 1000ml) 2ml, Difco casamino acids 0.1g,

Difco Yeast Extract 5g, and the TES damping fluid (5.73%, pH7.2) 100ml, adding distil water adds the following solution that bacterium is crossed in death of monks or nuns before 1000ml uses: the 10ml mass percentage concentration is 0.5% KH ₂PO ₄Solution, 4ml 5mol/L CaCl ₂2H ₂O solution, 7ml 1mol/L NaOH solution, the 20ml mass percentage concentration is 50% Glucose solution, the 15ml mass percentage concentration is 20% L-proline solution) be coated with 28 ℃ of cultivations with 0.1ml protoplastis suspension; Every plate adds the apramycin solution (100mg/ml) of 1ul after 16-24 hour.

The transformant of the anti-apramycin that obtains after the above-mentioned conversion, random choose wherein 4 transformants is forwarded to enrichment thalline among the YEME that contains 10ug/ml apramycin (Apramycin), cut checking through plasmid extraction, enzyme, prove that the gained transformant all is the positive transformant that changes the pDR101 plasmid over to.

The positive transformant that one of them of above-mentioned screening is changed over to the pDR101 plasmid is forwarded to MM flat board (agar 10g, L-N 0.5g, the K that contains the 5ug/ml apramycin ₂HPO ₄0.5g, MgSO ₄.7H ₂O 0.2g, FeSO ₄.7H ₂O 0.01g, adding distil water adds 50ml 10% N.F,USP MANNITOL of sterilizing before 1000ml uses) on, cultivate after 7 days the preparation spore suspension for 28 ℃.After suitably diluting, with each plate 10 ⁴The concentration of individual spore is coated on the MM flat board that contains the 5ug/ml kantlex, in 39 ℃ of high-temperature cultivation.

The pKC1139 plasmid has the responsive to temperature type replicon, in that be higher than can not normal replication under 34 ℃ of conditions.Therefore, pDR101 can not self-replicating in the time of 39 ℃, has only when homologous recombination has taken place for polR gene and flanking sequence thereof and cocoa streptomycete chromosome---and single cross is changed or the bacterial strain of double exchange could be grown containing on the minimum medium of kantlex.If double exchange has taken place, then kalamycin resistance gene (neo) is replaced the polR gene, and this moment, bacterium colony showed as Km ^rAm ^s(kantlex is had resistance, and apramycin is not had resistance); If single cross has taken place changes, then whole pDR101 is inserted on the karyomit(e), and this moment, bacterium colony showed as Km ^rAm ^r(kantlex and apramycin are all had resistance).Concrete screening method is as described below:

Picking is above-mentioned to contain 39 ℃ of commentaries on classics pDR101 transformants that high-temperature cultivation obtains on the flat board of kantlex, and it is dull and stereotyped and contain on the MM flat board of 5ug/ml kantlex to be transferred to the MM that contains the 5ug/ml apramycin respectively.Screening can be grown on card is received the mycin flat board, and the transformant that can not on the apramycin flat board, grow, the polR gene that promptly obtains the kalamycin resistance gene fragment both sides in the pDR101 plasmid simultaneously with cocoa streptomycete Ah rope mutation (AS4.1602) genome in homologous sequence the transformant of double exchange (homologous recombination) has taken place, be polR deletion mutantion strain.

The wherein polR deletion mutantion strain of 3 strain generation double exchanges that screening is obtained is seeded on the MM substratum without any selective pressure, cultivate down at 28 ℃, pass and be forwarded to the MM substratum that contains the 5ug/ml kantlex respectively after 5 generations again and contain on the MM substratum of 5ug/ml apramycin, the result remains Km ^rAm ^s(kantlex is had resistance, and apramycin is not had resistance) illustrates that these polR deletion mutantion strains that obtain by double exchange are stable in heredity.

3) the Southern blotting of polR deletion mutantion strain hybridization checking

With step 2) stable Km in the above-mentioned 3 strain heredity that obtain ^rAm ^sType polR deletion mutantion strain is inoculated in the YEME substratum, 28 ℃, the 250rpm shaking culture is extracted total DNA respectively after 30 hours, with NotI and the laggard row agarose gel electrophoresis of NdeI double digestion, the dna fragmentation of the 1885bp that obtains with the amplification of the step 1) of digoxigenin labeled is that probe carries out Southern blot hybridization then, is contrast with cocoa streptomycete Ah rope mutation; The hybridization signal of cocoa streptomycete Ah rope mutation (AS4.1602) is inferred theoretically should be in the 2.4kb scope, and double exchange destroy the strain hybridization signal should be in the 3.4kb scope.Results of hybridization proves, step 2) Km that obtains ^rAm ^sHybridization signal band that type polR deletion mutantion strain occurs and the molecular weight size of calculating in theory consistent (3.4kb), illustrate that resulting mutant strain all is correct, promptly obtained kalamycin resistance gene dna fragmentation (neo) is inserted in the genomic polR gene of cocoa streptomycete Ah rope's mutation, thereby make the polR gene disruption, the mutant strain that can not express.

2, polR deletion mutantion strain Polyoxin output biological detection

With correct polR gene disruption mutant strain or cocoa streptomycete Ah rope mutation (the Streptomyces cacaoi var.asoensis strain of Southern blotting hybridization checking; AS4.1602) be seeded in respectively in the YEME substratum, behind 30 ℃ of cultivation 36h, (every L contains 30g N.F,USP MANNITOL at the SP substratum with 1% inoculum size respectively, the 10g Zulkovsky starch, the neutral soy peptone (neutralizedsoya peptone) of 5g, 8g Difco Yeast Extract) carries out Secondary Fermentation in, filter the wet thallus baking oven to dry to constant weight with quantitative paper after 120 hours and detect the anti-mycotic activity of dry cell weight and fermentating liquid filtrate, and carry out the amount of the Polyoxin of HPLC analyzing and testing fermentating liquid filtrate.

The anti-mycotic activity of fermentating liquid filtrate, be to be the activity that indicator detects various mycin with the long handle alternaric bacteria: 1. from inclined-plane switching long handle alternaric bacteria (available from CGMCC Alternaria longipes AS 3.2875) to the murphy juice substratum of 100ml, 28 ℃ of shaking culture 4 days, homogenized 5 minutes, stand-by; 2. in the culture dish of diameter 20cm, it is the PDA solid medium that 20% step 1 is cultivated the long handle alternaric bacteria bacterium liquid that obtains that adding 100ml contains volumn concentration; 3. detect eyeletting on the flat board with punch tool, in different holes, adding polR gene disruption mutant strain or cocoa streptomycete Ah rope mutation fermented liquid 50ul respectively, cultivating 18-24 hour for 28 ℃, detecting the inhibition zone size.

The result shows that polR deletion mutantion strain fermented liquid does not have anti-mycotic activity (not producing inhibition zone), show no longer to produce Polyoxin, and the thalline weight in wet base of surveying and cocoa streptomycete Ah rope mutation almost do not have difference.

Behind the filtering with microporous membrane of above-mentioned cultivation and fermentation liquid supernatant liquor with polR gene disruption mutant strain or cocoa streptomycete Ah rope mutation through diameter 0.25 μ m, carried out the HPLC analysis, (the HPLC analysis chart as shown in Figure 1 not detect the absorption peak of the Polyoxin that occurs as cocoa streptomycete Ah rope mutation in mutant strain, A is the HPLC analysis collection of illustrative plates of cocoa streptomycete Ah rope mutation among Fig. 1, B is the HPLC analysis collection of illustrative plates of polR gene disruption mutant strain among Fig. 1, shown in the arrow is the absorption peak of Polyoxin), the result shows that the polR gene is that the Polyoxin biosynthesizing is necessary.

3, the complementation analysis of polR deletion mutantion strain

For the phenotype of getting rid of polR deletion mutantion strain is because the possibility that other gene point mutation caused on the karyomit(e) has been carried out the genetic complementation experiment of mutant strain.Be about to the polR deletion mutantion strain that polR gene transformation step 1 of the present invention obtains, with complete polR gene with polR deletion mutantion strain destructive polR gene substitution, if polR deletion mutantion strain has recovered the generation ability of Polyoxin, proved further that then the polR gene is the synthetic regulatory gene of Polyoxin; Concrete grammar is as described below:

1) the complementary structure that transforms plasmid

With cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis strain; AS4.1602) total DNA designs primer P3 and P4 as template; With P3:5 ' GCCGGTGGACGATGTTCG3 ' P4:5 ' GAACGCTCCTGGTCGCTCATC 3 ' is primer, carries out pcr amplification, and the PCR system is H ₂O 27ul, DMSO 2.5ul, 10 * KOD buffer 5ul, dNTP 5ul, MgCl ₂2ul (2mmol/L), each 3ul of P3/P4 concentration 5pmol/ul, total dna profiling 1.5ul (containing the about 50ng of total DNA), (cumulative volume 50ul mixing carries out PCR to KOD plus for TOYOBO CO., LTD.Japan) 1ul, and the PCR program is 95 ℃ of 2min of elder generation; 94 ℃ of 30s then, 55 ℃ of 30s, 68 ℃ of 3.5min, totally 30 circulations; Last 68 ℃ are extended 10min, the result obtains the fragment of 3809bp, to check order after this fragment recovery, the result shows that this fragment has the nucleotide sequence of sequence 2 in the sequence table, it is the polR gene fragment, 5 of sequence 2 ' end 420-3758 position Nucleotide is encoding sequence in sequence table, and 5 of sequence 2 ' end 304-381 position Nucleotide is promoter sequence in sequence table.

The dna fragmentation that above-mentioned amplification is obtained, flush end is inserted into pSET152 (Bierman M, Logan R, OBrien K, Seno ET, Rao RN, Schoner BE (1992) Plasmid cloning vectors forthe conjugal transfer of DNA from Escherichia coli to Streptomyces spp.Gene 116:43-49) on the EcoRV site, obtain recombinant vectors, recombinant vectors is carried out enzyme cut and identify and order-checking is identified, enzyme is cut and checked order and identify and show the correct recombinant plasmid called after pSET152::polR (structural representation as shown in Figure 2) that contains complete polR gene and upstream promoter thereof.

2) the complementation conversion of polR deletion mutantion strain and transformant Polyoxin generation ability thereof detect

PSET152 is a streptomyces gene group integrative plasmid, after changing streptomycete over to, the method for the pSET152::polR plasmid that builds by protoplast transformation can be incorporated on the streptomyces gene group, because plasmid itself has carried the polR gene of a complete copy, after in the mutant strain of its importing polR gene function disappearance, can substitute the function of destroyed polR gene, thereby deletion mutantion strain Polyoxin generation ability is recovered.

Change pSET152::polR over to E.coli ET12567 to remove possible restriction and modification, mediate the described method of method (method of protoplast transformation is with the step 2 in the step 1) of streptomycete protoplast transformation then by PEG1000), protoplastis after transforming is inoculated into the enterprising row filter of the MM substratum that contains the 5ug/ml apramycin to be cultivated, the pSET152 carrier self has the apramycin resistant gene, guarantee that again substratum contains under the apramycin resistance pressure, the transformant that conversion polR afunction mutant strain obtains has the general resistance of peace, thereby has guaranteed that pSET152::polR correctly has been incorporated on the genome.The transformant that screening obtains is and changes the pSET152::polR positive transformant over to.

The 6 strain transformants that the above-mentioned screening of picked at random obtains ferment in the SP substratum, carry out the Polyoxin biological activity assay according to the method for step 2 then, find that the polR deletion mutant that changes pSET152::polE over to that obtains behind the polR gene complementation has recovered the generation ability of Polyoxin.

Embodiment 3, the application of the synthetic regulatory gene polR of Polyoxin of the present invention in improving Polyoxin output

1, changes the acquisition of the engineering strain (changeing the pSET152::polR engineering strain) of polR gene over to

Complementary plasmid pSET152::polR promptly can be used for increasing copy of polR on cocoa streptomycete Ah rope mutation (AS4.1602) genome, because pSET152::polR can be incorporated on cocoa streptomycete Ah rope mutation (AS4.1602) genome, duplicate with homologous chromosomes, so the Polyoxin high-yielding engineering bacterial strain (changeing the pSET152::polR engineering strain) that becomes with this plasmid construction has genetic stability.Concrete grammar is as described below:

Change pSET152::polR over to E.coliET12567 to remove restriction modification, by the described method of method (method of protoplast transformation is with the step 2 in the step 1 of embodiment 2)) with PEG1000 mediation streptomycete protoplast transformation, protoplastis after transforming is inoculated into the enterprising row filter of the MM substratum that contains the 5ug/ml apramycin to be cultivated, the anti-apramycin transformant that screening obtains is and changes the pSET152::polR positive transformant over to, promptly obtains changeing the pSET152::polR engineering strain.

2, the Polyoxin output that changes the engineering strain of pSET152::polR plasmid over to detects

According to the described method of step 1, change pSET152 over to E.coli ET12567 to remove restriction modification, by the method with PEG1000 mediation streptomycete protoplast transformation is selection markers with the apramycin, pSET152 is changed in the cocoa streptomycete Ah rope mutation (AS4.1602) obtain changeing the pSET152 engineering strain.

The 3 strains commentaries on classics pSET152::polR engineering strain that step 1 screening is obtained fermented 120 hours in the SP substratum, carried out the Polyoxin biological activity assay according to the described method of the step 2 of embodiment 2.

The result as shown in Figure 3, the result shows that the fermented liquid of finding 3 strain engineering bacterias is to indicator strain--the inhibition zone of red star grey mold is all greater than the bacterial strain that changes pSET152 and the fermented liquid of cocoa streptomycete Ah rope mutation (AS4.1602); A is cocoa streptomycete Ah rope mutation (AS4.1602) among Fig. 3; B is for changeing the control strain of pSET152; C, D, E are respectively 3 strains changes pSET152::polR engineering strain engineering strain.

Choose one of them superior strain and measure Polyoxin output, all be higher than cocoa streptomycete Ah rope mutation (AS4.1602) and contain the control strain of empty carrier in different time points.To change single copy pSET152 plasmid cocoa streptomycete Ah rope's mutation (AS4.1602) Polyoxin yield effect in order getting rid of, to have made up commentaries on classics pSET152 engineering strain.With cocoa streptomycete Ah rope mutation (AS4.1602), change the control strain of pSET152, changeing the pSET152::polR engineering strain ferments with the SP substratum respectively, different time points is taken out fermented liquid and is carried out biological activity assay, dilute as the testing standard product with 10% Polyoxin dry powder (available from Beijing Green Agrosino Corporation) different concns, with the long handle alternaric bacteria be indicator with cup-plate method (Bai Xiufeng. clock is put 1998 " biopharmaceutical analysis " 93-114 greatly) measure the inhibition zone size that different time points different strains fermented liquid produces, and be converted into Polyoxin concentration, with time is X-coordinate, every milliliter of antibiotic concentration is the ordinate zou mapping, and the result as shown in Figure 4.The result shows changes the control strain that the pSET152::polR engineering strain all is higher than cocoa streptomycete Ah rope mutation (AS4.1602) in each time point Polyoxin output, changes pSET152, and explanation is because the increase of polR gene copy number has caused the increase of Polyoxin output.Wherein, among Fig. 4 ▲ be cocoa streptomycete Ah rope mutation (AS4.1602); ● for changeing the control strain of pSET152; ■ is for changeing the pSET152::polR engineering strain.

Analyze the output of changeing pSET152::polR engineering strain Polyoxin with HPLC, and with CGMCC (China General Microbiological Culture Collection Centre); AS4.1602) be contrast, behind the filtering with microporous membrane of fermented liquid supernatant liquid through diameter 0.25 μ m, carried out the HPLC analysis, stationary phase is the 20cm SB-C18 of an Agilent company reversed-phase column, and moving phase is that 95%A. water 10mmol tetra-n-butyl aqua ammonia (sigama) is regulated PH to 4.55%B.100% acetonitrile with Glacial acetic acid; Flow velocity 1ml/min, retention time is that 10min is the corresponding absorption peak of Polyoxin (among Fig. 5 shown in the arrow), the 10minHPLC absorption peak improves and shows that Polyoxin output significantly increases.The result as shown in Figure 5, the result shows, the Polyoxin output of finding commentaries on classics pSET152::polR engineering strain is more than 2 times of cocoa streptomycete Ah rope mutation (AS4.1602) output 150 μ g/mL, promptly reaches 340 μ g/mL, and the analytical results of HPLC is consistent with the biological activity assay result.A is cocoa streptomycete Ah rope mutation (AS4.1602) among Fig. 5; B is for changeing the pSET152::polR engineering strain.

Sequence table

<160>3

<210>1

<211>1112

<212>PRT

＜213〉cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis strain)

<400>1

Met Met Tyr Ala Thr Glu Val His Gln Pro Arg Thr Leu Thr Ala Asp

1 5 10 15

Leu Ser Leu Glu Ala Phe Gly Val Met Thr Ala Arg Arg Gly Ser Glu

20 25 30

Pro Val His Leu Gly Pro Pro Arg His Arg Ala Val Leu Gly Leu Leu

35 40 45

Met Leu Arg Leu Gly Gln Val Val Arg Val Asp Gln Leu Val Asp Glu

50 55 60

Leu Trp Gly Asp Lys Pro Pro Arg Arg Pro His Ala Thr Leu Gln Thr

65 70 75 80

Tyr Met Ser His Leu Arg Arg Ala Leu Thr Ser Gly His Gly Lys Asp

85 90 95

Ala Gly Val Ala Pro Leu His Tyr Arg Ala Pro Gly Tyr Val Leu Ala

100 105 110

Leu Asp Pro Gln Ala Ile Asp Val Cys Arg Phe Asp Glu Met Val Ser

115 120 125

Arg Gly Gln Gln His Ala Ala Glu Gly Arg Phe Gly Glu Ala Arg Glu

130 135 140

Ala Leu Asp Ser Ala Leu His Leu Trp Arg Ala Asp Pro Phe Leu Asp

145 150 155 160

Leu Thr Ser Tyr Glu Pro Leu Ala Glu Glu Ser Ala Arg Leu Gln His

165 170 175

Leu Arg Thr Ala Ala Val Thr Ile Arg Ala Glu Ala Leu Leu Ala Leu

180 185 190

Gly Asp Ala Arg Thr Thr Val Glu Ser Leu Arg Arg Glu Val Ile Arg

195 200 205

Phe Pro Ser Asp Glu Arg Ile Val Ala Ala Leu Met Thr Gly Leu Tyr

210 215 220

Arg Leu Gly Gln Gln Thr Glu Ala Leu Arg Leu Tyr Glu Arg Thr Arg

225 230 235 240

Thr Gln Leu Ser Glu Glu Leu Gly Val Ala Pro Gly Asp Asp Leu Arg

245 250 255

Arg Val His Leu Ala Ile Leu Arg His Glu Leu Gly Gly Ala Ala Pro

260 265 270

Ala Gly Gln Arg Ala Glu Val Arg Ala Arg Pro Asp Arg Glu Pro Arg

275 280 285

Ser Glu Glu Ser Arg Pro Pro Ala Asp Ala Val His Gly Arg Ala Ala

290 295 300

Asp Pro Ala Thr Thr Gly Thr Gly Pro Gly Gly His Thr Gly Ala Arg

305 310 315 320

Pro Val Asp Asp Ala Ala Gly Ser Gly Arg Thr Pro Ala His Ala Ser

325 330 335

Pro Leu Pro Leu Phe Glu Gly Arg Glu His Ala Leu Ala Ser Leu Arg

340 345 350

Arg Ser Ile Thr Ala Ala Leu Glu Gly Ser Gly His Leu Thr Ala Val

355 360 365

Val Gly Gln Ala Gly Val Gly Lys Thr Glu Leu Leu Ala Gln Ala Thr

370 375 380

Ala His Ala Ala Gly Trp Val Ala Gly Thr Arg Val Val Arg Val Ser

385 390 395 400

Cys Arg Thr Ala Glu Gly Met Pro Ala Cys Trp Val Trp Gln Gln Ala

405 410 415

Leu Arg Met Leu Gly Gly Pro Asp Ala Leu Pro Gly Asp Asn Ala Pro

420 425 430

Arg Leu Cys Pro Asp Pro Thr Val Thr Thr Leu Ser Asp Ser Pro Glu

435 440 445

Gly Ala Asp Ala Asp Arg Arg Glu Gln Thr Gln Gln Arg Phe Leu Ala

450 455 460

His Asp Ala Leu Ser Glu Thr Ile Leu Arg His Ala Asp Asp Ala Pro

465 470 475 480

Leu Leu Leu Val Leu Glu Asn Val His Leu Ala Asp Arg Pro Thr Leu

485 490 495

Asp Val Leu Ala Leu Leu Ser Asp Gly Thr Gln Gly Arg Ala Val Ser

500 505 510

Val Val Ile Ser Val Arg Glu Ser Gly Val Gly Ala Gly Ala Glu Pro

515 520 525

Asp Gly Pro Leu Gln Glu Leu Leu Ala Asp Ser Arg Thr Asp Val Val

530 535 540

His Leu Asp Asp Leu Ser Glu Glu Gln Val Gln Thr Leu Leu Ala Ala

545 550 555 560

Gln Gly Gly Pro Gly Pro Ala Thr Pro Val Val Arg Gly Leu Tyr Glu

565 570 575

Arg Ser Gly Gly Asn Pro Tyr Leu Leu Gly Gln Leu Leu Ala His Ala

580 585 590

Gly Gly Ala Arg Ser Leu His Ala Ala Arg Ala Ala Arg Gln Val Leu

595 600 605

Thr Glu Ile Pro Thr Gly Val Ser Ser Met Leu Arg Arg Arg Leu Ala

610 615 620

Gly Leu Ala Pro Glu Val Leu Arg Val Leu Arg Gly Cys Ala Val Leu

625 630 635 640

Gly Thr Glu Ala Asp Leu Thr Leu Leu Thr Thr Val Leu Gly Asp Thr

645 650 655

Thr Pro Gly Val Arg Ala Val Glu Glu Ala Leu Arg Thr Gly Leu Leu

660 665 670

Arg Arg Asp His Asp His Ala Arg Thr Leu Val Phe Arg Tyr Gly Leu

675 680 685

Val Arg Asp Val Leu Leu Ala Glu Met Ser Asp Gln Glu Arg Ser Asp

690 695 700

Leu His Ala Trp Ala Val Asp Val Leu Gly Arg Gln Ala Asp Gly His

705 710 715 720

Pro Ala Ala Ala Ser Arg Leu Ala His His Ala Trp Gln Ala Ser Leu

725 730 735

Thr Leu Pro Pro Asp Gln Val Leu Pro Tyr Leu Val Arg Ala Gly Glu

740 745 750

Gln Ala Ala Leu Glu Ser Arg Tyr Asp Arg Ala Gln Thr Trp Phe Arg

755 760 765

Arg Ala His Ala Leu Leu Thr Ser Gly Pro Ser Ala Ser Gly Ala Ala

770 775 780

Ala Gln Ala Leu Gln Leu Arg Lys Arg Ile Leu Gln Ile Ala Thr Val

785 790 795 800

Thr Arg Gly Tyr Gly Asp Arg Glu Val Val Ala Glu Ser Gln Arg Val

805 810 815

Leu Ser Met Ser Pro Ala Ala Val Gln Glu Pro Ala Leu Val Phe Ser

820 825 830

Gln Cys Ile Ala Gln Leu Val Thr Gly His Arg Glu Glu Ser Ala Arg

835 840 845

Arg Ala His Gln Leu Arg Val Met Ala Gln Asn Gly Asp Ala Pro Glu

850 855 860

Ala Arg Leu His Glu Arg Leu Ala His Gly Ile Leu His Leu Pro Asp

865 870 875 880

Arg Thr Ala Glu Ala Leu Ala Ala Leu Thr Glu Ala Glu Gln Thr Ala

885 890 895

Gly Asn Leu Ser Ala Ala Arg Leu Arg Gln Leu Ala His His Thr Gln

900 905 910

His Asp Pro Arg Phe Leu Ala Met Asn His Arg Thr Leu Ala Leu Ser

915 920 925

Leu Leu Gly Ala Gln Asp Asp Ala Leu Ala Leu Ala Gln Glu Leu Leu

930 935 940

Ala Leu Thr Gly Cys Glu Gly Thr Pro Val Asp Arg Ala Ser Ala His

945 950 955 960

Tyr Ser His Ala Leu Val Ala Ala Leu Ala Glu Asp Ala Asp Ala Thr

965 970 975

Ala Ser Ser Ala Ala Glu Gly Leu Arg Ile Ala Asp Ala His Gly Leu

980 985 990

Leu His Trp Ala Ala Leu Leu Lys Val Cys Arg Gly Trp Ala Gln His

995 1000 1005

Arg Leu Gly Thr Pro Gly Ala Leu Asp Ala Leu Lys Ala Ala Val Thr

1010 1015 1020

Asp Leu Ser Val Arg His Leu Arg Ile Arg Leu Pro Leu His Leu Gly

1025 1030 1035 1040

Leu Leu Ala His Ala Gln Tyr Asp Ala Gly Ala Val Glu Ala Ala Arg

1045 1050 1055

Ala Thr Leu Arg Arg Ala Ala Arg Glu Ile Arg Ala Ala Gly Glu Asp

1060 1065 1070

Ala Tyr Leu Ser Pro Asp Leu Pro Phe Asn Arg Leu Pro Arg Leu Gln

1075 1080 1085

Pro Pro Leu Pro Pro Arg Gly Cys Ser Asp Pro Thr Glu His Leu Ala

1090 1095 1100

Gly Leu Pro Arg Arg Ser Gly His

1105 1110

<210>2

<211>3809

<212>DNA

＜213〉cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis strain)

<400>2

gccggtggac gatgttcgcc gcgctgctgg gcgccccggc gggccacagg gcgtccacga 60

tcctggacag gctcacgggc tgtccggcct cgagcaggag cagggccagc accgcccgct 120

gcttgggcgg ccccgggggc agttccgcac cgtcccgcca gatcctgatg ggtcccagga 180

ccccgaaggc gatgtgtcga tccatgtctt cccacaagcc cggccctgcg gccgacgaaa 240

ctgaaatgcg ctgatcagag tgtatgtggc aggctctccg gcaggccgtg gccgccaagt 300

ggagggagac gttccttggc ttgttctcac cgtcagtgca acgtcactct ttccgcacag 360

gggcatgtgt agcctgctcg ccgcacgtac tgagcgagtg gaaggcatat gcaccaggca 420

tgatgtatgc aacggaagta caccagcccc ggactctgac ggcggacctc tcactcgaag 480

catttggcgt gatgacggca cggcggggca gcgagccggt gcacctcgga cctccgaggc 540

accgggcggt cctcgggctg ctgatgctgc gcctcggaca ggtggtccgc gtcgaccagc 600

tcgtcgacga gttatggggc gacaaaccgc cgcgccggcc ccacgccacc ctccagacct 660

acatgtctca tcttcgacgg gccctgacgt cgggtcacgg caaggacgcc ggggtggctc 720

ccctgcacta ccgggcgccc ggatacgtcc tcgcgctgga tccgcaggcc atcgacgtgt 780

gccggttcga cgagatggtc tcccgcggac aacagcacgc cgccgagggc cggttcggtg 840

aggcgcgcga ggcgctcgac tccgcgctgc acctgtggcg ggccgacccc ttcctggatc 900

tcacgtccta cgagccgctg gccgaggaga gcgcacgcct ccagcacctg cgcacggcgg 960

ccgtgacgat ccgcgccgag gccctgctcg ccctcggcga cgcgcggacc acggtggagt 1020

ccctgcggcg cgaggtgatc cgcttcccct cggacgaacg catcgtggcc gccctgatga 1080

ccggcctgta ccggctcggc cagcagaccg aggcgctccg cctgtacgaa cgtacgcgca 1140

cgcagctgtc ggaggagctg ggcgtggcac cgggcgacga cctgcggcgc gtccatctgg 1200

ccatcctgcg gcacgaactg ggcggcgccg caccggccgg gcagcgggcc gaggtgcggg 1260

cccggccgga ccgcgagccc cggagcgagg agagccgtcc gccggccgac gccgtccacg 1320

gccgcgccgc cgaccccgcg acgaccggca ccggacccgg cgggcacacc ggcgcgcggc 1380

ctgtggacga cgccgccggg tccggcagga ccccggccca cgcgtcgccg cttccgctct 1440

tcgaagggcg cgaacacgcc ctggcctcgc tgcgccgctc catcacggcc gccctggagg 1500

gcagcggaca tctcaccgcg gtcgtgggtc aggccggggt gggcaagacc gaactgctgg 1560

cccaggccac ggcgcacgcc gccggatggg tcgccggaac ccgggtggtc cgggtgagct 1620

gccggaccgc ggagggcatg ccggcctgct gggtgtggca gcaggcgctg cggatgctcg 1680

gcggccccga cgcgctgccg ggcgacaatg cgccccggct ctgtccggac cctacggtga 1740

caacgctgtc agactcaccg gagggagcgg acgccgaccg ccgggagcag acccagcagc 1800

gcttcctggc ccacgacgcc ctgagtgaaa cgattctgcg ccacgcggac gacgctcccc 1860

tcctgctcgt cctcgagaac gtgcacctgg cggaccgccc cacgctcgac gtcctcgcac 1920

tgctcagcga cggcacacag ggccgcgcgg tgagcgtggt gatcagcgtc cgggagtccg 1980

gtgtgggagc cggagccgaa cccgacggcc cgctccagga gttgctggcc gactcccgca 2040

cggacgtcgt ccacctcgac gacctgtccg aggaacaggt ccagaccctc ctcgcggccc 2100

agggcgggcc cggcccggcc acgcccgtgg tgcgcggact ctacgaacgc agcggcggga 2160

acccctacct gctcggccag ctactggcac acgcgggtgg tgcccgctcc ctgcacgccg 2220

cgcgcgcggc acgccaggtc ctcaccgaga tccccaccgg cgtgtccagc atgctgcgcc 2280

gccgtctggc cggactggcc ccggaggtcc tgcgcgtgct caggggatgc gcggtactcg 2340

ggaccgaggc cgacctgacc ctgctgacca ccgtgctcgg cgacaccacc cccggcgtcc 2400

gcgccgtgga ggaggcgctg cgcaccggtc tgctgcgccg cgaccacgat cacgcccgca 2460

ccctggtgtt ccgctacggc ctggtacgcg acgtactgct cgccgagatg agcgaccagg 2520

agcgttccga cctgcacgcc tgggcggtgg acgtgctcgg ccgccaggcc gacggccacc 2580

ccgcggcggc ctcgcgcctg gcgcaccacg cctggcaggc ctcgctgacc ctgcccccgg 2640

accaggtgct gccgtacctc gtgcgggccg gcgagcaggc cgccctggag agccggtacg 2700

accgcgcgca gacctggttc cggcgcgccc acgcgctgct cacctccggc ccctcggcga 2760

gcggtgcggc cgcgcaggcg ctgcaactgc gcaagcgcat cctccagatc gccaccgtca 2820

cccgcggata cggcgaccgg gaggtcgtgg ccgagtccca gcgggtgctg agcatgtcac 2880

ccgccgcggt ccaggagccg gcactggtgt tctcccagtg catcgcccaa ctggtcaccg 2940

gacaccggga ggagagcgcc cgccgcgccc atcagctgcg cgtcatggcg cagaacggcg 3000

acgcgcccga agcccgcctg cacgaacggc tcgcccacgg catcctgcac ctgcccgacc 3060

gcaccgccga ggcgctggcc gccctgacgg aggccgagca gacggccggg aacctctccg 3120

ccgcccggct ccggcagctc gcgcaccaca cccagcacga cccccgattc ctggccatga 3180

accaccggac cctcgctctg tcgctgctcg gcgcccagga cgacgcgctc gccctggccc 3240

aggaactcct ggcgctcacc ggctgcgagg gcacaccggt cgaccgggcc agcgcccact 3300

actcccacgc gctggtcgcc gccctcgccg aggacgccga cgccaccgcc tcctccgccg 3360

ccgagggcct gcgcatcgcc gacgcgcacg gcctgctgca ctgggcggcc ctgctcaagg 3420

tctgccgcgg ctgggcgcag caccggctcg ggacacctgg cgcactcgac gccctcaaag 3480

cggccgtgac cgacctgagc gtccgccacc tgcggatccg cctcccgctg cacctggggc 3540

tgctggcaca cgcccagtac gacgcgggcg ccgtcgaggc cgcccgggcg accctgcggc 3600

gggcggcccg ggagatcagg gccgcgggcg aggacgccta cctcagcccc gacctgccct 3660

tcaaccggct gccgcgcctc cagccgccgc tgccgccccg cgggtgcagc gatccgacgg 3720

agcatctggc cggcctgccc aggcgttccg gccactgacc ggtccaggcc gctgacgagt 3780

cccggctcgc gacaagcccc gtcctccca 3809

<210>3

<211>466

<212>DNA

＜213〉cocoa streptomycete Ah rope mutation (Streptomyces cacaoi var.asoensis strain)

<400>3

gcaccgcggc cgcccgcagg tcggtcgccg tgaggtcctg gcccgtccgg tgcggggtcc 60

tgacgccgtc gaccctcagc gcgtagtcgt cctggacggc gtccatgccg agggcggtca 120

gacccgggac gtagccgtag cggtgctccc acacggcctc gctgatgagc gtcgccccct 180

cggcccaccc ggccatcagc gcgaagaagg gctggctgtc gctgaacacg ccccgggagg 240

cggcgaggac ctcgacggga gccaggggcc gttcggccgg gtgggccgtg accgagtccg 300

cctcgtggtc ggtcaccacg cccatccggc gcagcacgtc gaactcgggt gccagcgccg 360

ccaccgcccg gtccatgccg gggcccgtga tgtgcaccgg cccgtcgccc acggtcacgg 420

ccgcgcagat ccaggtgacg acctcgatca ggtccggcgg cagggt 466

Claims (8)

1. a Polyoxin synthesizes modulin, is following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through replacement, disappearance and/or the interpolation of one or several amino-acid residue and have the Polyoxin complex functionality by (a) deutero-protein.

2. the described Polyoxin of claim 1 synthesizes the encoding gene of modulin.

3. encoding gene according to claim 2 is characterized in that: the nucleotides sequence of the encoding gene of the synthetic modulin of described Polyoxin is classified one of following sequence as:

1) nucleotide sequence of sequence 2 in the sequence table;

2) 5 of sequence 2 ' end 420-3758 position nucleotide sequence in sequence table.

4. the recombinant expression vector that contains claim 2 or 3 described encoding genes.

5. the engineering bacteria that contains claim 2 or 3 described encoding genes.

6. the transgenic cell line that contains claim 2 or 3 described encoding genes.

7. the application of the synthetic modulin of the described Polyoxin of claim 1 in Polyoxin is produced.

8. the application of encoding gene in Polyoxin is produced of the synthetic modulin of claim 2 or 3 described Polyoxins.

Images