CN112251447A - Cloning and application of salt mustard salt induced expression gene TsHKT1 and 2 promoter - Google Patents

Abstract

The invention discloses a salt mustard induction expression gene TsHKT1;2 cloning and applying a promoter; the invention constructs a plant expression vector TsHKT1 of GUS driven by the promoter; GUS, transforming arabidopsis thaliana by an agrobacterium inflorescence infection method, and dyeing and observing the transgenic arabidopsis thaliana. The results indicate that TsHKT1;2, the gene is weakly expressed in leaf vascular bundle tissues in the seedling stage of arabidopsis thaliana, and the gene is mainly expressed in the lotus throne vascular bundle in the mature stage. In addition, the relative fluorescent quantitative PCR results of the tissues of Thellungiella halophila showed that TsHKT1;2 gene expression is up-regulated by salt induction and is expressed in higher amounts in each tissue. Therefore, the promoter is a stable salt mustard induction up-regulation promoter, can be used as a functional element in plant gene modification engineering to drive the expression of related functional genes, and is probably most critical in the salt stress process.

Description

Cloning and application of salt mustard salt induced expression gene TsHKT1 and 2 promoter

Technical Field

The invention belongs to the field of molecular biology and plant genetic engineering, and relates to a salt mustard induction expression gene TsHKT1;2 cloning and applying a promoter; in particular to a salt mustard induced expression up-regulated TsHKT1;2 cloning promoter nucleotide coding sequence of gene, constructing recombinant expression vector of the promoter, and transferring into dicotyledonous plant Arabidopsis thaliana to start downstream gene expression.

Background

Soil salinization is one of the most important environmental stresses borne by plants, and severely restricts the growth of the plants, so that the yield of crops is severely reduced, and the national food safety is harmed. In order to resist the stress of salt ions in soil, a series of salt stress regulation mechanisms are generated in plants to adapt to the environment. Therefore, it is important to understand how plants respond to the external salt stress. HKT1 type transporters play an important role during salt stress in plants. In the model plant Arabidopsis thaliana, only one gene of the type HKT1, AtHKT1, is present. In halophytes, also the close relative species of Arabidopsis thaliana, the three HKT1 genes, TsHKT1, exist; 1, TsHKT1;2, TsHKT1; 3. the research on the functions and expression profiles of the three genes is very important for analyzing the process of responding to salt stress of plants. The present invention is primarily directed to TsHKT1;2 was analyzed.

Common promoters can be classified into constitutive promoters, tissue-specific promoters and inducible promoters. In some cases, one type of promoter may have the characteristics of the other type of promoter. The inducible promoter has important functions in plant genetic engineering, and plants can adapt to the changes of environments such as light, temperature, water and the like within a certain range by starting the expression of different genes. The promoters of these genes usually contain relatively conserved cis-acting elements, which can be used to predict the possible functions of new genes, and also to fuse these promoters of environmentally responsive genes with stress-resistant genes, thereby making transgenic plants better adapted to stress.

Disclosure of Invention

The invention aims to provide a salt mustard induction expression gene TsHKT1 aiming at the current research situation; 2 cloning method and application of promoter.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention relates to a salt mustard induction expression gene TsHKT1;2, the nucleotide sequence of the gene is shown as SEQ.ID.NO. 1.

The invention also relates to a salt mustard induction expression gene TsHKT1;2 promoter, wherein the nucleotide sequence of the promoter is shown as SEQ.ID.NO. 2.

The invention also relates to a composition containing the TsHKT1;2 promoter.

Preferably, the recombinant expression vector is obtained by inserting the TsHKT1 into the enzyme cutting site of a plant GUS expression vector pCambia 1305.1; 2 promoter to obtain recombinant plasmid; in the recombinant expression plasmid, TsHKT1;2 promoter was ligated upstream of GUS gene.

Preferably, the enzyme cutting sites are BamHI and BglII.

Preferably, the insertion uses amplification primers that are:

FP2:TTCGAGCTCGGTACCCGGGGATCCGCGTTTGTCAAACTCGATTGG

RP2:AAATTTACCCTCAGATCTGGAGAGATTTAGCATGTTGCGA。

the invention also relates to the TsHKT1; the application of the 2 promoter as a salt mustard induction up-regulated promoter in driving target gene expression in plant gene modification engineering.

Preferably, the plant comprises arabidopsis thaliana.

Preferably, said TsHKT1 will be contained; 2, transforming agrobacterium tumefaciens competent GV3101 by the recombinant expression vector of the promoter, and performing genetic transformation of plants by an inflorescence infection method; the collected seeds are screened by multi-generation hygromycin to obtain pure transgenic plants.

The invention also relates to application of the recombinant expression vector in a plant salt resistance mechanism.

The invention also relates to a gene TsHKT1 induced and expressed by the salt of the Thellungiella halophila; 2 an expression analysis method in Thellungiella halophila, comprising:

A. the Thellungiella halophila is: (1) treating the salt mustard 4-10 days after germination for 2-30h by using 150-300mM NaCl; or (2) the Thellungiella halophila cultured under normal illumination for 10-20 days after the low-temperature vernalization is treated by 150-300mM NaCl for 20-40 days;

B. design for the TsHKT1;2 relative fluorescence quantitative PCR primers for gene, as follows:

an upstream primer: CTCTACTTCTCTCATTTCATTAACTTCAA

A downstream primer: GATCTGACTAGAAAGCTTGACATGATT, respectively;

C. b, performing fluorescent quantitative PCR reaction by using the RNA of each tissue of the thellungiella halophila obtained in the step A as a template, and analyzing TsHKT1;2 gene expression in various tissues of Thellungiella halophila.

Compared with the prior art, the invention has the beneficial effects that:

the invention clones a salt mustard induction expression gene TsHKT1;2 promoter, which can be used as element for constructing plant expression vector to drive specific gene to express in plant, so as to research or strengthen the function of the gene in salt stress, and lay foundation for improving crop agronomic character.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1: TsHKT1;2 prediction result diagram of cis-acting element of promoter;

FIG. 2: TsHKT1;2, a schematic construction diagram of a GUS reporter gene expression vector pCambia1305.1 driven by a promoter;

FIG. 3: TsHKT1;2 GUS staining pattern of transgenic Arabidopsis thaliana with GUS reporter gene expression vector pCambia1305.1 driven by promoter (wherein A, C is GUS staining pattern of control group, B, D is GUS staining pattern after 200mM NaCl treatment for 24 h; A, B is that I is Arabidopsis thaliana seedling stage, II, III and IV are enlarged images of cotyledon, hypocotyl and root in I, respectively; C, D is that I, II, III, IV, V and VI are root, stem, rosette leaf, cauline leaf, flower and horn fruit in mature period of Arabidopsis thaliana);

FIG. 4: TsHKT1 in Thellungiella halophila; 2 (wherein A is TsHKT1 from 7-day seedlings of Thellungiella halophila; 2 relative expression results, and B is TsHKT1 from mature Thellungiella halophila; 2 relative expression results).

Detailed Description

The present invention will be described in detail with reference to examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be apparent to those skilled in the art that several modifications and improvements can be made without departing from the inventive concept. All falling within the scope of the present invention.

A salt mustard induced expression gene TsHKT1;2 the bioinformatic analysis of the promoter,

1) obtaining TsHKT1 from the phytozome website (https:// phytozome.jgi.doe.gov/pz/portal.html); 2 gene promoter sequence information;

2) for TsHKT1;2 the possible presence of cis-acting elements in the promoter was predicted using the plantare on-line tool (http:// bioinformatics. psb. element. be/webtools/plantare/html /);

3) analyzing the function of the cis-acting element present;

a salt mustard induced expression gene TsHKT1;2, the promoter sequence is shown in SEQ ID No. 2 and comprises 3151bp in total. The cloning method specifically comprises the following steps:

(1) extracting the whole DNA of the Thellungiella halophila by a CTAB method;

(2) according to TsHKT1 provided on the phytozome website (https:// phytozome. jgi. doe. gov/pz/portal. html); 2, designing a pair of primers FP1 and RP1 of a promoter fragment of about 3200bp near the initiation codon of the gene:

FP1:GCGTTTGTCAAACTCGATTGG SEQ.ID.NO:3

RP1:GGAGAGATTTAGCATGTTGCGA SEQ.ID.NO:4

(3) carrying out PCR amplification by using high-fidelity enzyme; during this process TsHKT1;2, the promoter is longer and is difficult to amplify, so that the promoter can be subjected to multiple amplification processes;

(4) connecting the amplified fragment into pMD19-T (purchased from Takara), transforming Escherichia coli competent DH5 alpha, sending to platane sequencing company for sequencing, and confirming whether the construction result of the cloning vector is correct;

construction of a 'promoter-GUS reporter gene' fusion vector. The specific operation comprises the following steps:

(1) by checking TsHKT1;2, mapping the promoter and a plant GUS expression vector pCambia1305.1, and searching a proper double enzyme cutting site, wherein the double enzyme cutting effect is to ensure that the 35S promoter driving the GUS gene in the expression vector pCambia1305.1 is cut off without damaging the downstream GUS gene and is not existed in TsHKT1;2 promoter. The invention finally finds out enzyme cutting sites BamH I and Bgl II, and designs amplification primers FP2 and RP 2:

FP2:TTCGAGCTCGGTACCCGGGGATCCGCGTTTGTCAAACTCGATTGG SEQ.ID.NO:5

RP2:AAATTTACCCTCAGATCTGGAGAGATTTAGCATGTTGCGA SEQ.ID.NO:6

(2) to sequence the correct of the above-described TsHKT1;2, taking the promoter cloning vector as a template, and carrying out PCR amplification by using high-fidelity enzyme.

(3) The promoter amplified fragment and the vector pCambia1305.1 are subjected to enzyme digestion by BamHI and BglII, the vector and the fragment are connected by T4 ligase, escherichia coli competence DH5 alpha is transformed, and sequencing is performed to confirm whether the vector construction result is correct.

The promoter-GUS reporter gene fusion vector is used for transforming model plant Arabidopsis thaliana and subsequent GUS staining analysis. The specific operation steps are as follows:

(1) transferring the constructed recombinant plasmid of the promoter-GUS reporter gene into agrobacterium GV3101, and infecting an arabidopsis plant by an inflorescence infection method;

(2) the collected seeds are screened by multi-generation hygromycin, and finally, homozygous strains are obtained;

(3) detecting the expression characteristic of a GUS gene in transgenic arabidopsis thaliana by using a GUS histochemical staining method, and analyzing TsHKT1;2 expression profile of the promoter;

to confirm TsHKT1;2, performing tissue-specific expression of the promoter, and performing fluorescent quantitative PCR analysis on each tissue in the seedling stage and the mature stage of the thellungiella halophila. The specific operation steps are as follows:

(1) thellungiella halophila 7 days after germination, experimental group treated with 200mM NaCl, control group treated with equal amount of ddH₂And (4) O treatment. After 24h, respectively extracting RNA of leaves and roots of the experimental group and the control group;

(2) the low-temperature vernalized salt mustard started bolting after growing in soil for two weeks, the experimental group was treated with 200mM NaCl, and the control group was treated with an equal amount of deionized water. After 30 days, respectively extracting RNA of roots, stems, rosette leaves, cauline leaves, flowers and hornberries of the experimental group and the control group;

(3) design TsHKT1;2 gene FP3 and RP3, and analyzing TsHKT1 by performing relative fluorescence quantitative PCR reaction by using a light cycler 96 quantitative PCR instrument of Roche; 2 expression of the genes in the tissues of Thellungiella halophila:

FP3：CTCTACTTCTCTCATTTCATTAACTTCAA SEQ.ID.NO:7

RP3：GATCTGACTAGAAAGCTTGACATGATT SEQ.ID.NO:8

see in particular the following examples:

example 1: the salt mustard induces and expresses gene TsHKT1;2 prediction of promoter cis-acting element

1) TsHKT1;2 obtaining promoter sequence

2) Obtaining TsHKT1 from a phytozome website (https:// phytozome.jgi.doe.gov/pz/portal.html); 2:

3) TsHKT1;2 prediction of promoter cis-element

To study TsHKT1;2 cis-acting site of promoter region, using the plantare in-line tool (http:// bioinformatics. psb. agent. be/western tools/plantare/html /) on TsHKT1;2 promoter the possible presence of cis-acting elements was predicted.

TsHKT1;2 promoter as shown in fig. 1, TsHKT1;2 promoter contains 5 ABA response elements ABRE, several light response elements such as ACE, AE-bOX, G-BOX, G-bOX, GATA motif, GT1 motif, TCT motif and BOX 4, several anaerobic induced elements ARE, several Methyl jasmonates (MeJA) responding to related cis-acting elements CGTCA-motif and TGCG-motif, one Salicylic Acid (SA) responding to related elements TCA-element, one element HD-Zip 1 participating in the differentiation of palisade mesophyll cells, one cis-acting element O2-site participating in the regulation of zein metabolism, one circadian rhythm related cis-acting element circian, several injury response elements WUN-motif, some co-cis-acting elements CAAT-bOX of promoter and enhancer regions, some binding sites for transcription factors (especially possible binding sites for MYB type transcription factors, such as light-induced MYB binding site MRE, drought-induced MYB binding site MBS), etc.) as well as some other elements such as AAGAA-motif, etc.

TsHKT1; the 2 promoter contains some stress response-related cis-acting elements, and may be involved in the regulation of plant stress response. ABA response elements are contained, ABA is involved in the salt stress-related regulatory response process, thus TsHKT1; the 2 gene may be regulated by ABA-related signaling.

Example 2: the salt mustard induces and expresses gene TsHKT1; cloning of the promoter 2

1) TsHKT1;2 design of promoter cloning primers

According to TsHKT1 provided on the phytozome website (https:// phytozome. jgi. doe. gov/pz/portal. html); 2, designing a pair of primers FP1 and RP1 of a 3200bp promoter fragment near the initiation codon of the gene:

FP1:GCGTTTGTCAAACTCGATTGG SEQ.ID.NO:3

RP1:GGAGAGATTTAGCATGTTGCGA SEQ.ID.NO:4

2) extraction of Thellungiella halophila genomic DNA

The material used by the invention is Shandong ecological type salt mustard. The DNA of young salt mustard plants is extracted by a classical CTAB method. The specific operation steps are as follows: grinding Thellungiella halophila into powder under the condition of liquid nitrogen, adding 700 μ L of 1.5 × CTAB preheated at 65 ℃, carrying out water bath at 65 ℃ for 20min, and reversing and mixing evenly for several times in the water bath process; then adding 700 mu L of trichloromethane, evenly mixing, and centrifuging at 12000rpm for 10 min; sucking the supernatant into a new centrifuge tube, adding equivalent isopropanol, slightly reversing, uniformly mixing, and centrifuging at 12000rpm for 10 min; removing supernatant, washing twice with 70% ethanol, and adding a proper amount of deionized water to dissolve DNA after air drying.

3) TsHKT1 was PCR amplified; 2 promoter fragment

PCR amplification was carried out using the designed primers FP1 and RP1 and the Thellungiella halophila genomic DNA as a template and the high fidelity enzyme TransStart Fastpfu Fly DNA Polymerase (purchased from Transgene).

The reaction system is as follows:

the PCR reaction procedure was as follows:

during this process TsHKT1;2, the promoter is longer, and the content of the sequence CG is not high, so that the amplification is difficult, and the amplified band is light, so that the amplification process can be carried out for many times;

4) the amplified fragment was ligated with the cloning vector PMD19-T (purchased from Takara Co., Ltd.)

After the PCR product was recovered by cutting the gel after agarose gel electrophoresis, 3. mu.L of the recovered product was ligated with a cloning vector PMD19-T (purchased from Takara Co., Ltd.) in the following system: recovery of 3. mu.L, Solution I5. mu.L, PMD19-T vector 1. mu.L, ddH₂O1. mu.L. The system is mixed evenly and put into a metal bath for reaction for 12 to 16 hours at the temperature of 16 ℃.

5) The ligation product was transformed into E.coli competent cell DH5 alpha

mu.L of the ligation product obtained above was added to 100. mu.L of E.coli competent cell DH 5. alpha. and left on ice for 30 minutes; then, after heat shock is carried out for 90s on a metal bath at 42 ℃, the mixture is quickly placed on ice for 2 minutes, about 1mL of LB liquid culture medium is added, and the mixture is placed into a shaking table at 37 ℃ and cultured for about 1 hour at 200 rpm; then, centrifuging at 5000rpm for 5 minutes, removing part of the culture medium, suspending the bottom thallus by using the residual about 100-200 mu L of the culture medium, and coating the bottom thallus on an LB solid plate containing 50mg/L of carbenicillin; putting the plate into a constant temperature incubator at 37 ℃, and performing inverted culture for 12-16 h. Several single colonies were picked up and inoculated into LB liquid medium containing 50mg/L carbenicillin, and cultured in a shaker at 37 ℃ for 3-5 h. After PCR identification, a part of LB liquid medium containing positive colonies was sent to Shanghai platinum sequencing company for sequencing. Sequencing correctly to obtain cloned TsHKT1;2 promoter.

Example 3: TsHKT1;2 construction of promoter plant expression vector and its genetic transformation in arabidopsis thaliana and screening of positive transgenic plant

1) TsHKT1;2 construction of promoter plant expression vector

By checking TsHKT1;2, mapping the promoter and a plant GUS expression vector pCambia1305.1, and searching a proper double enzyme cutting site, wherein the double enzyme cutting effect is to ensure that the 35S promoter driving the GUS gene in the expression vector pCambia1305.1 is cut off without damaging the downstream GUS gene and is not existed in TsHKT1;2 promoter. The invention finally finds out enzyme cutting sites BamH I and Bgl II, and designs amplification primers FP2 and RP 2:

FP2:TTCGAGCTCGGTACCCGGGGATCCGCGTTTGTCAAACTCGATTGG SEQ.ID.NO:5

RP2:AAATTTACCCTCAGATCTGGAGAGATTTAGCATGTTGCGA SEQ.ID.NO:6

at the correct TsHKT1;2, taking a promoter cloning vector as a template to amplify to obtain a fragment containing an enzyme cutting site; the amplified fragment and the plant GUS expression vector pCambia1305.1 were then digested with the restriction enzymes BamHI and BglII (from Thermo). After agarose gel electrophoresis and gel cutting recovery, the fragments after enzyme cutting are connected with a carrier by utilizing T4 ligase (purchased from Thermo company); the ligation products were subsequently transformed into E.coli competent cells DH5 α and subjected to colony PCR validation and sequencing validation.

TsHKT1;2 promoter the construction of the plant expression vector is shown in figure 2.

2) Agrobacterium-infected competent GV3101 transformed by recombinant plasmid

Adding 10 μ L of the above recombinant plasmid into 50 μ L of Agrobacterium-infected GV3101, standing on ice for 30 min, treating with liquid nitrogen for 5 min, thermally shocking at 37 deg.C for 5 min, rapidly standing on ice for 5 min, adding about 0.5 mL of LB liquid medium, placing in a shaker at 28 deg.C, and culturing at 220rpm for about 1 h; then, centrifuging at 5000rpm for 5 minutes, removing part of the culture medium, suspending the bottom thallus by using the residual about 100-200 μ L of the culture medium, and coating the bottom thallus on an LB solid plate containing 50mg/L kanamycin, 100mg/L gentamicin and 50mg/L rifampicin; putting the plate into a constant temperature incubator at 28 ℃, and carrying out inverted culture for 36-48 h. Several single colonies were picked up and inoculated into LB liquid medium containing carbenicillin 50mg/L, gentamicin 100mg/L, rifampicin 50mg/L, and cultured in a shaker at 28 ℃ for 3-5 h. And obtaining positive colonies after PCR identification.

3) Cultivation and genetic transformation of Arabidopsis thaliana

Seeds of Columbia ecotype Arabidopsis thaliana (Col-0) were sterilized with 70% ethanol and 10% sodium hypochlorite and then spread on 1/2MS medium. After 3 days of assimilation treatment in a refrigerator at 4 ℃, placing the seeds in a photoperiod of 16 h/8 h in darkness, culturing in a light incubator under the condition of 2000Lux light and the environment of 22 ℃ and 70% humidity, transplanting the seeds into culture soil after 7 days, and performing genetic transformation on arabidopsis thaliana by using an inflorescence infection method when blooming is vigorous. The method comprises the following specific steps: inoculating the successfully transformed recombinant plasmid into 200mL LB liquid medium containing 50mg/L kanamycin, 100mg/L gentamicin and 50mg/L rifampicin, and culturing in a shaker at 28 ℃ until OD₆₀₀The arabidopsis thaliana inflorescence is 1.0-2.0, after centrifugation is carried out at 5000rpm for 10 minutes, the arabidopsis thaliana inflorescence is resuspended by using an infection liquid (1/2MS, 50% of cane sugar and 0.04% of silwet L-77) for about 30s, a preservative film is covered, the infected arabidopsis thaliana is cultured for 24 hours in the dark condition, and then the arabidopsis thaliana is placed back to an artificial climate chamber for normal illumination and is continuously cultured.

4) Screening and identification of transgenic Arabidopsis plants

The Arabidopsis plants that completed the infection were scored as T0 generation. And screening the collected seeds by using 30mg/L hygromycin, transplanting and culturing the obtained positive plants, and recording as T1 generation, and recording as T2 generation for collecting seeds of single plants. And continuously sowing T2 generations, and harvesting seeds of the single plant to obtain T3 generations. And randomly taking tens of T3 generation seeds of the same strain, and screening by utilizing hygromycin, wherein if all positive plants are positive plants, the strain is a pure transgenic plant.

5) Treatment and GUS staining of transgenic Arabidopsis plants

The pure line of transgenic Arabidopsis seeds were sterilized with 70% ethanol and 10% sodium hypochlorite and then spread on 1/2MS medium. After 3 days of assimilation treatment in a refrigerator at 4 ℃, the cells were placed in a photoperiod of 16 h/8 h of darkness, a light incubator under 2000Lux light conditions and an environment of 22 ℃ and 70% humidity for cultivation, and after 7 days, the experimental group was treated with 200mM NaCl for 24h, and the control group was treated with an equal amount of ddH₂And O treatment is carried out for 24 hours. The experimental group and the control group were sampled simultaneously for GUS staining. After about 12h of dyeing, gradient decolorization was performed using ethanol at different concentrations.

GUS staining results of T2 generation pure line transgenic plants are shown in FIG. 3. Wherein, the A, C picture is a GUS staining picture of a control group, and the B, D picture is a GUS staining picture after 200mM NaCl treatment for 24 h; A. the C picture is the seedling stage, and the B, D picture is the mature stage. From this, it can be found that TsHKT1;2 is expressed weakly in seedlings, mainly concentrated in the vascular bundle tissue. In mature plants, TsHKT1;2 is expressed mainly in the liensinine leaf vascular bundle and a small amount in the cauline leaf vascular bundle and silique. The experimental group showed increased staining compared to the control group, indicating that TsHKT1;2 the expression of the promoter in the transgenic plant is induced by salt.

Example 4: TsHKT1 in Thellungiella halophila; 2 analysis of transcript level of Gene

1) TsHKT1 in Arabidopsis seedlings; 2 analysis of transcript level of Gene

Seeds of Shandong type Thellungiella halophila were sterilized with 70% ethanol and 10% sodium hypochlorite and then spread on 1/2MS medium. After 3 days of assimilation treatment in a refrigerator at 4 ℃, the cells were placed in a photoperiod of 16 h/8 h of darkness, a light incubator under 2000Lux light conditions and an environment of 22 ℃ and 70% humidity for cultivation, and after 7 days, the experimental group was treated with 300mM NaCl for 24h, and the control group was treated with an equal amount of ddH₂And O treatment is carried out for 24 hours. The experimental group and the control group were sampled simultaneously using polysaccharideExtracting sample RNA by using a polyphenol plant total RNA extraction kit (purchased from Transgene company), and designing TsHKT1;2, performing relative fluorescence quantitative PCR reaction by using quantitative PCR instruments of Roche for quantitative primers FP3 and RP3 of the gene 2 and quantitative primers FP4 and RP4 of the reference gene Actin, and analyzing TsHKT1 in the salt mustard seedlings; 2 relative gene expression level of the gene.

FP3：CTCTACTTCTCTCATTTCATTAACTTCAA SEQ.ID.NO:7

RP3：GATCTGACTAGAAAGCTTGACATGATT SEQ.ID.NO:8

FP4：CAAGCAGCATGAAGATTAAGGTCGTT SEQ.ID.NO:9

RP4：CTTGGAGATCCACATCTGCTGGAAT SEQ.ID.NO:10

2) TsHKT1 in each tissue of mature Thellungiella halophila; 2 analysis of transcript level of Gene

Seeds of Shandong type Thellungiella halophila were sterilized with 70% ethanol and 10% sodium hypochlorite and then spread on 1/2MS medium. After 3 days of assimilation treatment in a refrigerator at 4 ℃, the mixture is placed in a photoperiod of 16 h/8 h of darkness, a light incubator under the condition of 2000Lux light and an environment with the humidity of 22 ℃ and 70 percent for culture, and after 14 days, the salt mustard is placed in the incubator at 4 ℃ for low-temperature vernalization. One and a half month later, the Thellungiella halophila was transplanted into soil, cultured in a phytotron at 22 ℃ for 2 weeks, and the experimental group was treated with 200mM NaCl and the control group was treated with an equal amount of deionized water. After 30 days, the experimental group and the control group are simultaneously sampled by using liquid nitrogen, and the sample RNA is extracted by using a polysaccharide polyphenol plant total RNA extraction kit (purchased from Transgene company) to design TsHKT1;2, performing relative fluorescence quantitative PCR reaction by using quantitative PCR instruments of Roche for quantitative primers FP3 and RP3 of the gene 2 and quantitative primers FP4 and RP4 of the reference gene Actin, and analyzing TsHKT1 in the salt mustard seedlings; 2 relative gene expression level of the gene.

TsHKT1 in Thellungiella halophila; the relative fluorescent quantitative PCR results of the 2 genes are shown in FIG. 4. Wherein a is shown as TsHKT1 of 7-day seedlings of Thellungiella halophila; 2 relative expression results, panel b shows TsHKT1 from mature salt mustard; 2 relative expression results. As can be seen from panel a, in the Arabidopsis seedlings, TsHKT1;2 in the plants and its expression in the respective tissues was up-regulated under the salt-treated condition and its expression level in the aerial parts was slightly higher than that in the roots. In mature Thellungiella, TsHKT1;2 in each tissue, wherein the expression level in the stem, the cauline leaves and the flowers is higher, and the expression in each tissue is up-regulated under the salt treatment condition, wherein the up-regulation in the stem and the cauline leaves is most obvious. Thus, TsHKT1 can be illustrated; the 2 gene has higher expression level in the seedling stage and the mature stage of the Thellungiella halophila, the overground part is obviously up-regulated by salt induction, and the expression of the gene is induced by salt stress.

The above is only a preferred embodiment of the present invention and is not intended to limit the present invention. It should be noted that the protection scope of the present invention is only satisfied by the requirements of the present invention.

Sequence listing

<110> Shanghai university of transportation

<120> cloning and application of salt mustard induction expression gene TsHKT1; (2) promoter

<130> KAG43907

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1065

<212> DNA

<213> Thellungiella salsuginea (Pall.) O.E. Schulz)

<400> 1

atggagagag ttgtggacaa gttagctaaa atcttttcgc aacatgctaa atctctcccc 60

cttttcttcc tttacttctt ctacttcttg ttcttctcct tcttggggtt cttggcactc 120

aagatctcaa agccaagaac cacttcacgt cctcatgact tggatctgtt cttcacttct 180

gtctccgcca tcactgtctc ctccatgtca accatcgaca tggaagtctt ctcaaacacc 240

caacttatca tcattactat cctcatgttt ctaggcggcg agatcttcac ttctttcgtg 300

aatctctact tctctcattt cattaacttc aaaatcaaac atcttgtggg ctctttcaac 360

ttcgaccgtc ctatcaatga tccgggtagt gatcttgaga atgttactaa tcatgtcaag 420

ctttctagtc agatcaatga aagggcctct aagtgtttgt actcggtggt tcttggttac 480

ctttttgtaa ccaacatagc tggttccacg ttgcttcttc tgtacgtaaa ttttgttaaa 540

acggcgagag atgttcttag ttccaaaaaa atctcacctc tcactttctc ggtcttcaca 600

gctgtctcta cgttatcaga ctgtggattt gtccccacga atgagaacat gatcatcttc 660

cgaaagaact ctggcctcct ctggctctta atccctcaag tattcatggg agacactttg 720

tttccttgct tcttggtttt ggccatatgg ggacttcata agatcacaaa tcgagaagaa 780

ttgggttaca ttctcaagaa tcacaagaag atgggatact ctcatttact ctccgttcgt 840

ctttgtgttc ttcttgcttt gacggtgtta gggcttgtga tgatacagtt tcttctattc 900

tgcacctttg aatggaactc tgagtctctt gaaggaatga attcctacga gaagttggtt 960

ggatcgttgt ttcaagttgt caactcgaga cacactggag aaaccgttgt cgacctctct 1020

acactttctc cagcaatctt ggtactcttc atcctcatga tgtaa 1065

<210> 2

<211> 3151

<212> DNA

<213> Thellungiella salsuginea (Pall.) O.E. Schulz)

<400> 2

gcgtttgtca aactcgattg gatggaaatt aggcttaggg cgtttctcag aaaatcaatg 60

aatgcagatc aatcgattag tcggggttca ggtttaagca cagttcttga actccacaaa 120

attataatta accaacttcc attgtgagaa ttatctaagt tgaaatccta gaattccaaa 180

ttcctttgca aaccctaaag atttaaacca gctttaatgc tcatattcga tatgttcaca 240

aagcatctaa accaaattcc tttgcgaata gctactttgc tcaccctagg ttctttccag 300

ttattcaatt acacttctgc gtcaattaag caacctaagg tctaagttct aggtgatcag 360

tccagaatta gctttaaaaa caacatatgg tgaagaacaa atcagattat gaaccctaac 420

taaatcaatt aatcaaacat ccagtgaaaa ccttaatgag aaccctaaac ctaacaagct 480

aactactcag acatgaatat tgaaacaata aacatgattg aatagattgc aaaaataaga 540

tgaatagaat aaataaaagg gttcgaaatc ttctctttaa acgaacagag ttcagacttg 600

tcttcccaag ctctcaaaat cgcaaaaagc ctaaagcaaa agattttttg ttcgaaaatt 660

taaggtgtcg atgaaaagag actaaaaacc ctatttatat cttaaaaaca cgtattggac 720

ttctttggaa acttctgcgc ccaactcttt cttcaaatag gaaacaaaat catgttttcc 780

ttatttcctt gacaagcgtc gagcgtcact ctccatggtg tcgagcgaca ccaatgcaca 840

tgatttgtcc ttcgcgaatt tgatcctgat ttagctctaa agtgctccaa aattaccaat 900

taagctctaa acatacctaa aacctgtaaa gactccaaaa gactagaaaa acattagaaa 960

gactctataa ataagacata tattatggtc aaaaactaga aaaaccatga tatatcagag 1020

tccaagtgct aggacccatg aagagtggag attgagtctg tgagacctag gacagagatg 1080

tttgggatgt gagagtccat gaaggctaga acctcactct agagacctaa gtgtgagaat 1140

ccgggaagtg gatttgcctg agtccagaga cctgtcctat gagcctaacg tattgataat 1200

cagattatag acataatgga gttggaccaa ggccttgatc atgttttgtc aaattgcatc 1260

ctttcctttt ttgtgcaatt tgaaaactac tccaatttag atgaaacgta ttgttgtgga 1320

aacgcctctt gcattttctc cttgcctatt tacaaagaat atttggtata gatccactca 1380

tcactctaca tttgtattgg attcctcagt agacagctta atcttggctt ctatgtttgc 1440

aatggtgtca tacatttgac ttaacatact catgagagta tcgctcctct atgaacattt 1500

tttaaaaaag ttctagattt ctcaagcatt aaactgatca tgaatagtca aagtttgtag 1560

ataatcattt ttgaaacaaa catccctaac acggttctat acttcttaaa atatctagac 1620

tttgagttat acgtattaaa tgtaataaca atcatcaatg tgagagtatg caaactagaa 1680

gctacatctt caatgtaaaa agatgtcact atcctcaaga tgaattttaa aggttgtcat 1740

atatactttc tagttgacat ggaggaatct aaagtagtag ttcttcaagt gcatgagttc 1800

atccatggtg tgtgttcaaa ccgaatcata acctctaggg tcactccttg cctgtgttgg 1860

attttttttt tttttggtaa ggctcttcca actccacttt ttttttgttt ctggtgtgaa 1920

cattctctca tcaaatggca gttgctcata tgacttatct tgaatatatt ggtcaaattt 1980

gtcttcctac tcttgtgccc aatcattctt gtgcccaatc attgtaaacc atagccatta 2040

actactttac tttttttttt tgtatttcta caagcaaaaa tatgaaagaa atacaattgg 2100

cagattatgc attgacatca agaatcttat tttctttctt ttattatttt atctaatttg 2160

aaaaaagctt ttatacgtca aagtataatc gactgactaa cacgtgtggc catttatgtc 2220

aaatataaag tttgagataa caaacttaat ataataaaat atatctgtat gtatatcaag 2280

catacacata aagtcagtgt acttgtatct atttttatta aaaggtaaag tttctttatt 2340

ttctctattt taattttacg acttatttat tttttctttt ttattatttt aaattttttt 2400

tagactattg gaagttttta attttttgga ggttgtttga atttttttat tagttttcca 2460

tttatatttc tatttattaa tgatttatat catttgttta tctgttattt ttatcatctt 2520

taagaaataa ataacaaaaa acagaaaatt gattataatg aaattgacat ctaaaatatc 2580

tttgatgaaa atatttattt atcttttcta taactgaaat attattataa tattgtgctt 2640

aatataaatg tgacacgtaa gataattcgt aggctaattt tagagagaaa aaactcgttt 2700

taaaattttt aatattttaa tgaaatattt tggttgtttc caataatttg taggctaatt 2760

aaggaaatct ctctatttct agagtcgaga aaggaaaata ttcggggaaa acaaaagttc 2820

atatagaaaa tactttcatg ttggtcctca tacacttatg tggctgagaa tgttcttatg 2880

cgtatatata aacacaaggg ccaataatat aattcgtaga ccgacccaag aaataaaatg 2940

gagagttttt cttttttctt gaaatcctag aaatttcgta ttccacaatc tcctcggata 3000

agagcaggtt taaaacccct acccgtttcc cgcactcgaa ccttcgacct ctgtctctcc 3060

ggtcaaaggg ttctctggta agatatatac aaaatggaga gagttgtgga caagttagct 3120

aaaatctttt cgcaacatgc taaatctctc c 3151

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcgtttgtca aactcgattg g 21

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggagagattt agcatgttgc ga 22

<210> 5

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttcgagctcg gtacccgggg atccgcgttt gtcaaactcg attgg 45

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaatttaccc tcagatctgg agagatttag catgttgcga 40

<210> 7

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctctacttct ctcatttcat taacttcaa 29

<210> 8

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gatctgacta gaaagcttga catgatt 27

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caagcagcat gaagattaag gtcgtt 26

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cttggagatc cacatctgct ggaat 25

Claims (10)

1. A salt mustard induced expression gene TsHKT1;2, and is characterized in that the nucleotide sequence of the gene is shown as SEQ.ID.NO. 1.

2. A salt mustard induced expression gene TsHKT1;2, and is characterized in that the nucleotide sequence of the promoter is shown as SEQ.ID.NO. 2.

3. A composition comprising TsHKT1 according to claim 2; 2 promoter.

4. The recombinant expression vector of claim 3, wherein the recombinant expression vector is obtained by inserting the TsHKT1 at the enzyme cutting site of a plant GUS expression vector pCambia 1305.1; 2 promoter to obtain recombinant plasmid; in the recombinant expression plasmid, TsHKT1;2 promoter was ligated upstream of GUS gene.

5. The recombinant expression vector of claim 4, wherein the cleavage sites are BamHI and BglII.

6. The recombinant expression vector of claim 4 or 5, wherein the insertion uses amplification primers that are:

FP2:TTCGAGCTCGGTACCCGGGGATCCGCGTTTGTCAAACTCGATTGG

RP2:AAATTTACCCTCAGATCTGGAGAGATTTAGCATGTTGCGA。

7. a TsHKT1 according to claim 2; the application of the 2 promoter as a salt mustard induction up-regulated promoter in driving target gene expression in plant gene modification engineering.

8. The use of claim 7, wherein said TsHKT1 is to be contained; 2, transforming agrobacterium tumefaciens competent GV3101 by the recombinant expression vector of the promoter, and performing genetic transformation of plants by an inflorescence infection method; the collected seeds are screened by multi-generation hygromycin to obtain pure transgenic plants.

9. Use of the recombinant expression vector of claim 3 in a plant salt tolerance mechanism.

10. A salt mustard inducible expression gene of claim 1, TsHKT1; 2-method for analyzing the expression in thellungiella halophila, characterized in that:

A. the Thellungiella halophila is: (1) treating the salt mustard 4-10 days after germination for 2-30h by using 150-300mM NaCl; or (2) the Thellungiella halophila cultured under normal illumination for 10-20 days after the low-temperature vernalization is treated by 150-300mM NaCl for 20-40 days;

B. design for the TsHKT1;2 relative fluorescence quantitative PCR primers for gene are as follows:

an upstream primer: CTCTACTTCTCTCATTTCATTAACTTCAA

A downstream primer: GATCTGACTAGAAAGCTTGACATGATT, respectively;

C. b, performing fluorescent quantitative PCR reaction by using the RNA of each tissue of the thellungiella halophila obtained in the step A as a template, and analyzing TsHKT1;2 gene expression in various tissues of Thellungiella halophila.

Images