CN111995668B - Corn WRKY transcription factor ZmWRKY112 and coding gene and application thereof - Google Patents

Abstract

The invention discloses a corn WRKY transcription factor ZmWRKY112, a coding gene and application thereof, and particularly relates to a ZmWRKY112 gene obtained by designing a primer according to a transcription factor ZmWRKY112 gene sequence and amplifying a corn inbred line B73 cDNA by using a PCR technology. The gene encodes a protein having one of the following amino acid residue sequences: 1) SEQ ID N0 in the sequence listing: 1; 2) the sequence of SEQ ID NO: 1 by substitution and/or deletion and/or addition of one to ten amino acid residues and has the function of improving the plant stress resistance by interacting with a cis-element of a W box (TTGACC/T). The subcellular localization experiment of the corn protoplast shows that the ZmWRKY112 protein has the nuclear localization characteristic of a transcription factor. The ZmWRKY112 gene is used for corn transformation, and the salt stress resistance of the obtained transgenic corn is obviously enhanced. The invention provides important gene resources for plant stress resistance gene engineering and has important significance for improving the crop yield.

Description

Corn WRKY transcription factor ZmWRKY112 and coding gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and crop genetic breeding, in particular to a corn WRKY transcription factor ZmWRKY112 and a coding gene and application thereof.

Background

Plants often encounter various adverse natural environments during their growth, such as drought, high salinity, low temperature, high temperature flooding, etc., wherein high salinity is one of the most important factors affecting plant growth and yield and limiting plant geographical distribution. High salt can disrupt the balance of water potential and ion distribution, resulting in molecular damage and delayed growth of plants. In the long course of evolution, plants have developed a complex set of mechanisms to adapt to abiotic stresses. The response of plants to various adversity stresses is usually the multi-path and multi-gene synergistic effect, and the response to the adversity is regulated and controlled from different levels. Among them, the regulation of transcription level is receiving more and more attention, and the research on transcription factors has become a key point of the research on plant gene function.

Transcription factors, also known as trans-acting factors, are protein factors capable of directly or indirectly and specifically binding with cis-acting elements in the promoter region of eukaryotic genes, thereby regulating the transcription efficiency of target proteins, and through the interaction between the protein factors and other related proteins, the transcription factors are activated or inhibited. From protein structural analysis, transcription factors typically contain 4 functional regions, namely a DNA binding domain, a transcriptional regulatory domain (including activation and repression domains), an oligomerization site, and a nuclear localization signal. With the continuous and intensive research, more and more experiments prove that the transcription factor is widely involved in a series of physiological activities such as plant biological and abiotic stress response, plant decay, seed coat and trichome development, fruit development and the like.

WRKY is a transcription regulator found in recent years to be mainly present in higher plants. The WRKY transcription factor family contains a highly conserved WRKY structural domain, which consists of 60 highly conserved amino acid residues, and also comprises a zinc finger structure at the N-terminal of the WRKY transcription factor family, and the WRKY transcription factor family also contains a more conserved amino acid sequence WRKYGQK in the WRKY structural domain of the family. The WRKY transcription factor can be specifically combined with a (T) (T) TGAC (C/T) sequence in a promoter, namely a W-box (W box), so as to start the transcription of the gene.

In recent years, research on WRKY transcription factors at home and abroad is very much, and fruitful results are obtained. The WRKY gene is induced by various environmental factors such as drought, low temperature, trauma and the like, signal molecules, fungal induction factors, pathogens and different development stages of the plant, and directly or indirectly participates in a regulation network, so that the tolerance or resistance of the plant to the adversity is improved. Most of the current research on WRKY family transcription factors comes from rice and Arabidopsis, while the research on other species is reported in a few ways. Therefore, the gene of the family is separated and cloned from corn and the functions of the gene in improving the stress resistance of target plants are identified, so that the gene has very important significance for cultivating novel stress-resistant crop varieties.

Disclosure of Invention

The invention aims to provide a sequence and a function of a corn transcription factor ZmWRKY112 gene and further discloses an application of the gene.

The invention achieves the above purpose through the following technical scheme:

the corn WRKY transcription factor provided by the invention is named ZmWRKY112, is derived from corn (Zea mays L), and is a protein with one of the following amino acid residue sequences:

1) consisting of SEQ ID N0 in the sequence listing: 1 amino acid residue sequence;

2) the sequence of SEQ ID N0: 1) protein which is derived from 1) and has the function of corn WRKY transcription factor, wherein the amino acid residue sequence of 1 is substituted and/or deleted and/or added by one to ten amino acid residues;

3) the sequence of SEQ ID N0: 1 through substitution and/or deletion and/or addition of one to ten amino acid residues and has the function of improving the plant stress resistance by interacting with a cis-element of a W box (TTGACC/T).

Further, SEQ ID N0: 1 consists of 324 amino acid residues; the interaction of the corn WRKY transcription factor and the cis-element of the W box can improve the stress resistance of plants, and the core sequence of the DNA combined with the W box is TGAC.

The invention also provides the coding gene (ZmWRKY112) of the corn anti-reverse transcription factor, which is any one of the following 1) to 4):

1) has the sequence table SEQ ID N0: 2;

2) has a sequence encoding SEQ ID N0: 1;

3) has a sequence similar to that of SEQ ID N0 in the sequence list: 2, and encodes a protein having the same function as the protein, wherein the homology of the DNA sequence of 2 is more than 90%;

4) has a sequence which can be matched with a sequence table SEQ ID N0: 2, and the high stringency conditions can be hybridization and membrane washing with a solution of 0.1 x SSPE or 0.1 x SSC, 0.1% SDS at 65 ℃.

Wherein, SEQ ID N0: 2 consists of 975 bases and encodes a complete open reading frame encoding a polypeptide having the sequence listing SEQ ID N0: 1, or a pharmaceutically acceptable salt thereof. The coding genes are all provided with a sequence table SEQ ID N0: 2.

Meanwhile, the invention also comprises the application of the corn WRKY transcription factor in cultivating plants with enhanced stress resistance. And expression vector, transgenic cell line, recombinant bacterium and host bacterium containing the gene of the invention all belong to the protection scope of the invention.

A primer pair for amplifying any fragment in the ZmWRKY112 is also within the protection scope of the invention.

By using a plant expression vector, the gene coded by ZmWRKY112 of the invention is introduced into plant cells, and a transgenic cell line and a transgenic plant with enhanced stress tolerance to adversity can be obtained. Therefore, the invention also provides a method for cultivating plants with enhanced stress resistance, wherein the ZmWRKY112 coding gene is introduced into target plants to obtain transgenic plants, and the stress resistance of the obtained transgenic plants is higher than that of the target plants.

The gene or homologous gene of the present invention can be screened from cDNA and genomic libraries using the cloned ZmWRKY112 gene as a probe. The gene of the present invention and any DNA or DNA homologous thereto can also be amplified from genome, mRNA and cDNA by PCR. When ZmWRKY112 is used to construct a plant expression vector, any one of an enhanced promoter and an inducible promoter may be added in front of its transcription initiation nucleotide.

The expression vector carrying the ZmWRKY112 gene can be introduced into plant cells by Ti plasmids, plant virus vectors, direct DNA transformation, electroporation and other biotechnology methods. The target plant to be transformed may be a dicotyledonous plant or a monocotyledonous plant.

The invention has the beneficial effects that: the ZmWRKY112 gene is obtained by separating and cloning from corn. It is introduced into corn by agrobacterium-mediated transformation and transgenic plants are obtained. And then, the improvement of the salt stress tolerance of the transgenic corn is verified, and a theoretical basis and a utilization value are provided for the application of the gene on other plants so as to improve the stress tolerance.

Drawings

FIG. 1 is a schematic diagram showing the homology alignment of amino acid sequences of ZmWRKY112 and conserved regions of WRKY family transcription factors of other species, wherein the core conserved region WRKYGQK is represented by a solid line box, and zinc finger structures are represented by a dashed line box;

FIG. 2 is an analysis diagram of the evolutionary tree of ZmWRKY112 after alignment with other WRKY transcription factor amino acid sequences.

FIG. 3 is a schematic diagram of a subcellular localization corn protoplast of ZmWRKY112 protein, which is used for subcellular localization of the ZmWRKY112 protein, localization of the subcellular corn protoplast ZmWRKY112 protein, and a nuclear localization signal mCherry as a nuclear marker;

FIG. 4 is a PCR detection result chart of ZmWRKY112 gene transferred from T1 generation corn plant, M: DL2000 Marker; 1: L1-2; 2: L1-3; +: taking a p1301 plasmid as a template; -: water is used as a template;

FIG. 5 is a diagram showing the results of PCR detection and bar test strip detection of ZmWRKY112 transgenic T2 generation plants;

FIG. 6 is an apparent shape chart of ZmWRKY112 transgenic maize in a high-salt environment;

FIG. 7 is a schematic diagram of the survival rate of ZmWRKY112 transgenic maize in a high-salt environment.

Detailed Description

The present application will now be described in further detail with reference to the drawings, it should be noted that the following detailed description is given for illustrative purposes only and is not to be construed as limiting the scope of the present application, as those skilled in the art will be able to make numerous insubstantial modifications and adaptations to the present application based on the above disclosure.

It should be noted that the methods used in the following examples are conventional methods unless otherwise specified, and the primers used are all synthesized by Shanghai Biometrics Ltd; sequencing was performed by general biology corporation; various restriction enzymes, ligase, pEASY-Blunt Simple, DNA Marker, Taq DNA polymerase, dNTPs and the like used in the experiment were purchased from Takara; the reverse transcription kit is purchased from Promega corporation; the plasmid extraction kit, the gel recovery kit and the genome extraction kit are purchased from the whole gold biotechnology limited company, and the methods are carried out according to the specifications.

Example 1 acquisition of maize WRKY family Gene ZmWRKY112

1. Stress treatment: the plant material is a maize B73 inbred line, seeds with uniform size and full grains are selected and sowed in a flowerpot filled with sandy soil, and distilled water is sprayed at proper time to keep the soil moist. When the seedlings grow to two leaves and one heart, the plants normally irrigated are used as a control, 300mmol/L NaCl stress treatment is carried out, the treatment time is 12 h, 24 h and 48h respectively, the leaves at the same positions of the corn seedlings of the test group and the control group are respectively sheared by scissors in different treatment time periods, and three parts are sampled in each treatment stage. After sampling, the samples were immediately frozen in liquid nitrogen and stored in a refrigerator at-80 ℃.

RNA extraction: the corn material obtained above was ground with liquid nitrogen and quickly transferred to a 1.5ml centrifuge tube (pre-cooled with liquid nitrogen). Uniformly adding the ground materials on a scale of 0.5ml, adding 1ml of Trizol, and standing at room temperature for 10min to fully crack the materials; 4 ℃, 12000rpm, 5min, and discarding the precipitate; adding chloroform into 200ml chloroform/ml Trizol, covering the centrifugal tube cover tightly, shaking vigorously by hand for 15s, and standing at room temperature for 15min after fully emulsifying; centrifuging at 12000rpm for 15min at 4 deg.C; carefully taking out the centrifuge tube from the centrifuge, sucking the upper-layer water phase, and transferring the upper-layer water phase into another centrifuge tube; adding 0.5ml of isopropanol/ml of Trizol into the isopropanol, uniformly mixing, and standing at room temperature for 10 min; centrifuging at 12000rpm for 15min at 4 deg.C; discarding the supernatant, and depositing RNA at the bottom of the tube; carefully discarding the supernatant, adding 75% ethanol into 1ml of 75% ethanol/ml Trizol, gently oscillating the centrifugal tube for suspension precipitation, centrifuging at 12000rpm for 5min at 4 ℃, discarding the ethanol, pouring on paper, and draining at room temperature; adding a proper amount of RNase-free water to dissolve the precipitate, blowing the precipitate by using a liquid transfer gun if necessary, taking a proper amount of RNA after the RNA is fully dissolved, detecting the concentration and the purity of the RNA, and storing the rest at the temperature of minus 80 ℃.

3. Reverse transcription: the procedure provided by the promega reverse transcription kit was followed, the reverse transcription system was as follows: mu.g of total RNA, 25mM MgCl 24. mu.l, Reverse Transcription 10 Xbuffer 2. mu.l, 10mM dNTP mix 2. mu.l, RNase inhibitor (40 u/. mu.l) 0.5. mu.l, oligo (dT)15Primer (500. mu.g/. mu.l) 1. mu.l, AMV Reverse Transcription (25 u/. mu.l) 0.6. mu.l, plus Nuclear-Free Water to 20. mu.l. Carefully mixing, bathing at 42 ℃ for 40min, heating at 95 ℃ for 5min, and standing at 4 ℃ for 15min to terminate the reaction, thus obtaining the corresponding reverse transcription product cDNA.

4. Amplification: the databases of MAIZeGENOME and NCBI were searched to obtain the presumed coding sequence of ZmWRKY112, and the Primer Premier 5.0 software was used to design specific primers, which were synthesized by Biotech. The primer sequences are as follows:

WRKY112F：ATGGCGCTAGTATTAGGGCGG

WRKY112R：CAACGGTCCAACCAGGCG

the obtained maize cDNA is used as a template, a coding region containing a complete open reading frame with the length of 975bp is obtained through RT-PCR, and the coding region is recovered and connected to a pEASY-Blunt Simple vector for sequencing. The sequencing result shows that ZmWRKY112 is consistent with the nucleotide sequence in the sequence 2 in the sequence table. Encoding protein with amino acid residue sequence of sequence 1 in the sequence table.

Example 2 sequence homology and homology analysis of maize ZmWRKY112

And according to the sequence sequencing result, carrying out sequence comparison in an NCBI database, and finding that the cloned gene sequence has the closest homologous relation with the WRKY family transcription factor. Comparing the transcription factor with protein sequences of other WRKY transcription factor family members, analyzing that the zinc finger structure type is C2HC type, and according to the structural characteristics of the DNA binding domain, the ZmWRKY112 protein belongs to the class III WRKY transcription factor family (as shown in figure 1). In order to further analyze the phylogenetic relationship between ZmWRKY112 and other WRKY transcription factors, the WRKY proteins of different plants and ZmWRKY112 are subjected to phylogenetic relationship analysis (as shown in FIG. 2).

Example 3 subcellular localization of ZmWRKY112

1. Subcellular localization vector for constructing ZmWRKY112

In order to understand the expression condition of the ZmWRKY112 protein, a subcellular localization fusion expression vector is constructed. The p1305-35S-ZmWRKY112-GFP fusion expression vector is constructed by using pCAMBIA1305(p1305) as a framework and GFP green fluorescent protein as a reporter gene. Note that in designing the primers for this gene, the stop codon of the gene was deleted. XbaI and BamHI were used as cleavage sites for the upstream and downstream primers. The primer sequences are as follows:

RH-F：GCTCTAGAATGGCGCTAGTATTAGGGCGGGA

RH-R：CGGGATCCACGGTCCAACCAGGCGCG

2. corn protoplast extraction

(1) When the length of the corn sprout is about 1cm to 1.5cm, selecting seeds with consistent sizes, sowing the seeds in nutrient soil, culturing the seeds in the light until the sprout grows out by 1cm, turning the seeds in a dark place at 25 ℃, and cutting a second leaf of the corn from the stem when the second leaf is 10-15cm higher than the first leaf.

PS: supplementing nutrient solution in the culture process; ② avoiding illumination, and when the total illumination time exceeds 10min, the color is easy to turn green.

(2) Cutting the cut leaves to a part 6cm to 8cm away from the leaf apex, cutting the cut leaves into small leaf strips with the width less than 0.5mm, and completely immersing the small leaf strips in the enzymolysis liquid, wherein 10ml of the enzymolysis liquid can carry out enzymolysis on 0.6g to 1.0g of corn leaves. After cutting, the mixture is dispersed by toothpicks to be uniform.

(3) And (4) carrying out enzymolysis for 5-6h in a dark condition of 40r/min (wrapped by tinfoil paper), taking out the enzymolysis liquid, and slightly shaking the culture dish to promote the release of the protoplast (manually and slightly shaking for 2-3 weeks).

(4) At this point, a pre-chilled-dosed amount of W5 solution (water bath) (W5 may be pipetted a given amount in advance and used alone) (50ml sterilized centrifuge tubes).

(5) The 100 mesh sieve was rinsed with W5, and the hydrolyzate containing protoplasts was filtered through the sieve.

(6) The undissolved leaves were removed by filtration, and the enzyme solution containing protoplasts was dissolved with an equal amount of W5.

(7) The supernatant was removed by centrifugation at 100g for 2min in a 30ml round-bottom centrifuge tube and gently resuspended in 5ml of ice-cold W5 solution (first with a large and then small gun, along the tube wall, add obliquely).

(8) Standing on ice for 30 min.

(9) Centrifuging for 2min at 100g to immerse the protoplast in the bottom of the tube, removing the W5 solution as much as possible without touching the precipitation of the protoplast, then resuspending the protoplast with an appropriate amount of MMG solution, and examining the number of protoplasts in the solution under a microscope.

(10) Add 10ul of DNA (10ug-20ug of plasmid DNA of about 5-10 kb) to a 2ml centrifuge tube.

(11) 100ul protoplasts (2X 104) were added and mixed gently.

(12) Add 110ul of PEG solution and gently tap the tube to mix thoroughly (sticky, tap the tube wall).

(13) The transformation mixture was induced for 15min (transformation time was determined experimentally, high expression was required and transformation time was higher).

(14) The reaction was stopped by diluting the conversion mixture with 440ul of W5 solution at room temperature and gently shaking the tube upside down to mix well.

(15) The supernatant was gently removed by a tabletop centrifuge at room temperature for 2min at 100g, and then 1ml of W5 solution was added to the supernatant to wash the suspension once at 100g for 2min, and the suspension was centrifuged to remove the supernatant (7 times of centrifugation).

(16) The protoplasts were gently resuspended in a multi-well tissue culture dish using 200. mu.l of WI solution.

(17) Protoplasts were induced at room temperature (dark) (20-25 ℃) for 12-18 hours and then observed by confocal laser microscopy (as shown in FIG. 3).

Example 5 detection of ZmWRKY112 transgenic maize

Constructing a plant expression vector pCAMBIA1301a-ZmWRKY112, introducing the plant expression vector into a corn variety KN5585 by an agrobacterium-mediated corn genetic transformation method, and obtaining a transgenic plant through preculture, dip dyeing, co-culture, screening of a hygromycin-resistant callus, differentiation, rooting, seedling hardening and transplanting. Then extracting the corn genome DNA, wherein the specific method comprises the following steps:

1. 100mg of young leaves of fresh corn plants are taken and put into a mortar, and liquid nitrogen is added for full grinding.

2. Adding 250 ul RB1 solution, quickly reversing and mixing evenly,

3. add 30. mu.l 10% SDS, 15. mu.l RNaseA to the lysate and mix well.

4. Placing in 60 deg.C water bath for 15 min.

5.13000rpm, for 5min, and the supernatant was transferred to a clean centrifuge tube.

6. Add 100. mu.l of PB1 solution, mix well, put on ice for 5min, 13000rpm, centrifuge for 5 min.

7. The supernatant was transferred to a clean centrifuge tube, 375. mu.l of BB1 was added, and mixed well.

8. The whole mixture was poured onto an adsorption column, centrifuged at 13000rpm for 1min, and the filtrate was discarded.

9. 500. mu.l of solution CB1 was added thereto, and the mixture was centrifuged at 13000rpm for 1min, and the filtrate was discarded.

10. Add 500. mu.l of WB1 solution, 13000rpm, centrifuge for 1min, discard the filtrate and repeat once.

11.13000rpm, and centrifuged for 2min to completely remove WB 1.

12. The adsorption column was transferred to a clean centrifuge tube, 70. mu.l of preheated deionized water was added to the center of the column, and the column was allowed to stand at room temperature for 2min, 13000rpm, centrifuged for 2min, and the DNA was eluted.

13. 5ul of the sample was spotted on a 1% agarose gel and the quality of the DNA extracted was determined.

Using the sequence as a template, and using a hygromycin gene primer to amplify a target fragment

HygR-F：ACTCACCGCGACGTCTGT

HygR-R：TTTCTTTGCCCTCGGACG

The PCR reaction conditions are as follows: pre-denaturation: 94 ℃ for 5 min; denaturation: 94 ℃, 30s, annealing: 55 ℃, 30s, extension: 30 cycles at 72 ℃ for 1min for 30 s; 72 ℃ for 10 min. After the reaction, the PCR product was detected by 1.0% agarose gel electrophoresis, and the results are shown in FIG. 4.

Example 6 PCR detection of ZmWRKY112 transgenic T2 plant and bar test strip PCR detection

Extracting genome DNA of leaves of the transgenic plants, and designing a specific primer according to a sequence of a screening marker gene bar:

bar-F：ATGAGCCCCAGAACGACGCC；

bar-R：TTAGATCTCGGTGACGGGC

and (3) carrying out PCR detection on the bar gene, wherein the amplification procedure comprises the following steps: pre-denaturation: 94 ℃ for 5 min; denaturation: 94 ℃, 30s, annealing: 55 ℃, 30s, extension: 30 cycles at 72 ℃ for 1min for 30 s; 72 ℃ for 10 min. As shown in the figure, the transgenic plants can amplify the target band (the bar gene amplification band is 552bp), while the negative control does not amplify the band, which indicates that the foreign gene has been successfully introduced into the maize genome, and the result is shown in figure 5.

Bar test strip detection

(1) Grinding a leaf sample treated by NaCl solution before detection, adding pure water according to the proportion in the specification for dilution, uniformly mixing the sample after grinding and dilution, standing or centrifuging, and taking supernatant as a detection sample;

(2) taking out the CP4 EPSPS transgenic detection test strip from the package, taking the end marked by the MAX arrow as a sample end, vertically downwards inserting the sample end into the prepared supernatant of the detection sample; the sample end of the test strip is immersed into the sample solution to a depth of about 0.5cm and does not exceed the black mark line at the upper end of the arrow;

(3) in the detection process, the CP4 EPSPS transgenic detection test paper is always immersed in the sample liquid until the detection sample moves to the upper end of the detection window; the strips were removed, laid flat on a non-absorbing surface, and the results read after 5-10 minutes (see FIG. 5).

Negative (no transgene): red stripes appear only at line C; positive (containing transgene): red bands appear at both line C and line T, with lighter red indicating less.

Example 7ZmWRKY112 transgenic T2 generation plant salt tolerance identification

Selecting a non-transgenic KN5585 inbred line with consistent plumpness and 4 parts of PCR positive plant T2 seeds, sowing the inbred line and the seeds in a flowerpot filled with vermiculite and black soil, watering a proper amount of water every day, and culturing in a greenhouse. When the seedlings grew to three-leaf one-heart stage, the seedlings were irrigated with 300mmol/L NaCl solution every day to keep the treatment concentration constant, and the treatment was repeated 3 times. After salt treatment, the plants were observed daily for apparent traits (as shown in FIG. 6) and their survival rates (as shown in FIG. 7) were counted.

And (4) conclusion: it can be obviously seen that the ZmWRKY112 transgenic corn obviously improves the tolerance of the corn to high salt.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention.

Sequence listing

<110> agriculture university of Anhui

<120> corn WRKY transcription factor ZmWRKY112 and coding gene and application thereof

<141> 2020-07-27

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 324

<212> PRT

<213> corn (Zea mays)

<400> 1

Met Ala Leu Val Leu Gly Arg Glu Glu Glu Leu Leu Ala Gln Leu Arg

1 5 10 15

Ala Leu Leu Thr Phe Leu Pro Pro Pro Ala Ser Pro Pro Ala Pro Ala

20 25 30

Ala Pro Val Lys Val Glu Ser Ile Met Gly Thr Ser Gly Gly Gly Arg

35 40 45

Arg Leu Gly Ser Lys Arg Asp Arg Asp Asp Asp Ser Glu Ala Glu Ala

50 55 60

Glu Gln His Gly Asp Glu Pro Ala Ala Ala Gln Pro His Tyr Cys Pro

65 70 75 80

His Pro Pro Pro Pro Cys Lys Arg Thr Arg Arg Arg Lys Asn Lys Lys

85 90 95

Lys Arg Gln Gln Ser Lys Cys Leu Val Thr Thr Val Pro Asp Phe Asp

100 105 110

Gly Tyr Gln Trp Arg Lys Tyr Gly Gln Lys Gln Ile Glu Gly Ala Met

115 120 125

Tyr Pro Arg Ser Tyr Tyr Arg Cys Ile Gln Ser Ala Lys Gln Gly Cys

130 135 140

Gln Ala Lys Arg Thr Val Gln Arg Asn Asp Asp Asp Gly Ala Thr Ala

145 150 155 160

Pro Pro Glu Tyr Thr Val Val Tyr Val Ala Glu His Thr Cys Thr Ala

165 170 175

Asn Asp Asp Ala Leu Glu Ala Pro Pro Val Ile Leu Glu Thr Thr Thr

180 185 190

Ser Val Val Val Arg Ala Pro Ala Ala His Thr Asp Pro Val Val Val

195 200 205

Val Val Pro Ala Thr Ala Thr Thr Ser Ala Ala Ala Ala Ala Ser Ala

210 215 220

Cys Ser Thr Thr Val Thr Thr Gly Thr Glu Ser Pro Ala Ile Ser Gly

225 230 235 240

Asp Asp Val Ala Cys Cys Trp Ser Ser Ser Gly Ser Ser Ser Ser Gly

245 250 255

Tyr Ser Tyr Ala Asp Asp Ser Cys Cys Cys Cys Cys Cys Asp Gly Leu

260 265 270

Leu Ala Ala Val Val His Gly Gly Cys Gly Gly Ser Trp Ala Pro Gly

275 280 285

Pro Ala Asp Ser Val Ser Val Pro Ser Phe Arg Leu Gln Glu Met Glu

290 295 300

Asp Leu Thr Gly Pro Ile Arg Ser Pro Val His Val Val Pro Arg Ala

305 310 315 320

Trp Leu Asp Arg

<210> 2

<211> 975

<212> DNA

<213> corn (Zea mays)

<400> 2

atggcgctag tattagggcg ggaggaggag ctcctggcgc agctccgcgc gctactgacg 60

ttcctaccac ctcctgcgtc gcccccggcg ccggcggctc ccgttaaggt ggagtccatc 120

atgggcacta gtggcggcgg acgacgactg gggagcaaga gagaccggga cgacgacagc 180

gaagccgagg ccgagcagca cggcgacgaa cctgcggctg cgcagcctca ctattgtcct 240

catcctcctc ctccctgcaa aaggacgagg aggaggaaga ataagaagaa gcggcagcag 300

agcaagtgcc ttgtgacgac agtgcccgac ttcgacgggt accagtggag gaagtacggg 360

cagaagcaga tcgaaggtgc catgtacccc aggagttact acaggtgcat acagagcgcc 420

aagcaaggct gccaggcaaa acggacggtg cagcgcaacg acgacgacgg cgccaccgca 480

cccccagagt acacggtggt gtacgtggcg gagcacacct gcacggccaa cgacgacgcg 540

ctggaggccc cgccggtcat cctggagacc accaccagcg tcgtcgtccg tgcacctgca 600

gcacacaccg atcccgtcgt cgtcgtcgtt ccggcaacgg caactacgtc agccgccgcc 660

gccgcctccg cttgttccac caccgtcacc acggggactg aatctccggc gatctccggc 720

gacgacgtgg cctgctgctg gagcagcagc ggcagtagca gcagcggtta cagctacgcc 780

gacgactcct gctgctgctg ctgctgcgac gggttgctcg ccgctgtcgt ccacggtggc 840

tgcggcggct cgtgggcccc cggaccggcg gattcggttt cggtgccgtc gttccggttg 900

caggagatgg aggacttgac cggaccgatc cggtcgccgg tgcacgttgt tccccgcgcc 960

tggttggacc gttga 975

Claims (2)

1. The application of the corn WRKY transcription factor in cultivating stress-resistance-enhanced plants is characterized in that the corn WRKY transcription factor is a plant with the stress-resistance-enhanced plant, wherein the stress-enhanced plant is a plant with the stress-enhanced plant, and the stress-enhanced plant is a plant with the stress-enhanced plant, wherein the stress-enhanced plant is a plant with the stress-enhanced plant of which is a plant with the plant of which has the stress-enhanced plant of which is a plant with the plant of which is a plant with the stress-enhanced plant of which is a plant with the plant of which is enhanced plant of which is a plant with the stress-enhanced plant of which is enhanced plant with the plant of which is enhanced plant with the stress-enhanced plant with the plant of the plant with the stress-enhanced plant with the stress-enhanced plant with the stress-enhanced plant with the plant: 1 amino acid residue sequence, wherein the plant is corn, and the stress resistance is salt resistance.

2. A method for cultivating plants with enhanced stress resistance is characterized in that encoding genes of corn WRKY transcription factors are introduced into target plants to obtain transgenic plants, wherein the corn WRKY transcription factors are expressed by SEQ ID NO: 1 amino acid residue sequence, the stress resistance of the transgenic plant is higher than that of the target plant, the target plant is corn, and the stress resistance is salt resistance.

Images