CN103224550A - Corn WRKY transcription factor ZmWRKY58, and coding gene and application thereof - Google Patents

Abstract

The invention relates to the technical fields of the molecular biology and the gene engineering, and concretely relates to a ZmWRKY58 gene obtained through the amplification in the total cDNA of a corn inbred line B73 by utilizing a PCR technology according to a transcription factor ZmWRKY58 gene sequence design primer. The gene codes a protein having one of amino acid residue sequences comprising SEQ ID No:1 in a sequence table, and an amino acid residue sequence obtained through substituting and/or deleting and/or adding 1-11 amino acid residues to the amino acid residue sequence represented by SEQ ID No:1 and having an interaction with a W box (TTGACC/T) cis-element to improve the stress resistances of plants. Results of onion cuticle subcell localization experiments show that the ZmWRKY58 protein has the nuclear localization characteristic of the transcription factor. The corn ZmWRKY58 gene is used for rice transformation, and obtained transgenic rice has an improved sensitivity to ABA, and has obviously-enhanced salt and drought tolerances. The corn ZmWRKY58 gene provides an important gene resource for the plant stress resistance gene engineering, and is of great significance to the improvement of the output of crops.

Description

A kind of corn WRKY class transcription factor ZmWRKY58 and encoding gene and application

Technical field

The invention belongs to genetically engineered and field of crop genetic breeding, be specifically related to encoding gene and the application in cultivating the resistance of reverse plant thereof of a corn WRKY transcription factor ZmWRKY58.

Background technology

Plant often suffers from various disadvantageous physical environment in the process of growth, such as arid, high salt, low temperature, high temperature waterflooding etc., wherein arid, high salt are to influence growth and development of plants and output and of paramount importance two factors of restriction plant regional distribution.Arid can cause the vegetable cell dehydration, causes cell turgor to completely lose, even dead; High salt then can destroy the balance of the flow of water and the balance of ion distribution, causes plant to be subjected to molecule damage, delayed growth.In very long evolutionary process, plant has formed the complicated mechanism of a cover and has adapted to abiotic stress.Plant is to the response of various environment stresses multipath, polygene synergy often, from the response to adverse circumstance of different levels, different levels regulation and control.Wherein, the regulation and control on the transcriptional level more and more are subjected to people's attention, nowadays the research of transcription factor have been become an emphasis of plant gene function research.

Transcription factor is called trans-acting factor again, be directly or indirectly to combine with cis-acting elements generation specificity in the eukaryotic gene promoter region, thereby the regulation and control target protein is transcribed the rho factor of efficient, by reaching the interaction between other associated protein between them, activate or suppress and transcribe.From structural analysis of protein, transcription factor generally contains 4 functional zone, and promptly DNA is in conjunction with the territory, transcriptional regulatory domain (comprise activate and suppress territory), oligomerization site and nuclear localization signal.Along with deepening continuously of research, more and more experimental results show that transcription factor wide participation plant biological and abiotic stress responsing reaction, plant decline, plant skin and a series of physiological activities such as trichome growth and fruit development.

WRKY is a kind of transcription regulaton factor that mainly is present in the higher plant of discovered in recent years.The WRKY transcription factor family contains the WRKY structural domain of high conservative, amino-acid residue by 60 high conservatives is formed, also comprise zinc fingers at its N end, and the origin of this name of WRKY also is to contain one section more conservative aminoacid sequence WRKYGQK in the WRKY of this family structural domain.The WRKY transcription factor can with (T) in the promotor (T) TGAC (C/T) sequence be the W-box(W-box) specific combination, thereby the transcribing of promotor gene.

In recent years, the research of being devoted to the research of WRKY transcription factor both at home and abroad is very many, and has obtained great successes.The WRKY gene is subjected to various environmental factors inducing as arid, low temperature, wound etc. and signaling molecule, the fungal induction factor, pathogenic agent and the different developmental phases of plant own, the regulated and control network of directly or indirectly participating, thus patience or the resistance of plant improved to adverse circumstance.At present the research major part of relevant WRKY family transcription factor is from paddy rice and Arabidopis thaliana, and the research of other species report seldom.Therefore, the present invention's this family gene of separating clone and identify that it improving the function of being brought into play aspect the purpose stress resistance of plant, has crucial meaning for cultivating degeneration-resistant novel crop varieties from corn.

Summary of the invention

The purpose of this invention is to provide the sequence and the function of corn transcription factor ZmWRKY58 gene, and further disclose the application of this gene.

Corn WRKY class transcription factor provided by the present invention, ZmWRKY58 by name derives from Zea corn (Zea mays L.), is the protein with one of following amino acid residue sequences:

1) protein of forming by the SEQ ID N0:1 amino acid residue sequence in the sequence table;

2) with the SEQ ID N0:1 amino acid residue sequence in the sequence table through the replacement of one to ten amino-acid residue and/or disappearance and/or interpolation and have corn WRKY functional transcription factor by 1) deutero-protein;

3) with the SEQ ID N0:1 amino acid residue sequence in the sequence table through the replacement of one to ten amino-acid residue and/or disappearance and/or interpolation and have that (TTGACC/T) cis element interacts and improves the protein of plant stress-resistance function with the W box.

Wherein, the SEQ ID N0:1 in the sequence table is made up of 369 amino-acid residues; Above-mentioned corn WRKY transcription factor and W box cis element interaction energy improve the plant stress-resistance function, and itself and W box bonded DNA core sequence are TGAC.

The encoding gene of the above-mentioned anti-reverse transcription of corn factor (ZmWRKY58) is following 1) to 4) in each described nucleotide sequence:

1) has the nucleotide sequence of SEQ ID N0:2 in the sequence table;

2) have the polynucleotide of the protein sequence of SEQ ID N0:1 in the code sequence tabulation;

3) have with sequence table in the homology of dna sequence dna more than 90% of SEQ ID N0:2, and coding identical function protein DNA sequence;

4) have under the rigorous condition of height the nucleotide sequence of the dna sequence dna hybridization that can limit with SEQ ID N0:2 in the sequence table, the rigorous condition of described height can be with 0.1 * SSPE or 0.1 * SSC, and the solution of 0.1%SDS is hybridized under 65 ℃ and washed film.

Wherein, the SEQ ID N0:2 in the sequence table is by 1110 based compositions, the complete open reading frame of encoding, and coding has the protein of the amino acid residue sequence of sequence table SEQ ID N0:1.Above-mentioned encoding gene all has the nucleotide sequence of SEQ ID N0:2 in the sequence table.

The present invention simultaneously also comprises the application of above-mentioned corn WRKY transcription factor in cultivating resistance enhanced plant.And containing expression carrier of the present invention, transgenic cell line, reorganization bacterium and host bacterium all belong to protection scope of the present invention.

Arbitrary segmental primer is to also within protection scope of the present invention among the amplification ZmWRKY58.

Utilize plant expression vector, the gene transfered plant cell with ZmWRKY58 coding of the present invention can obtain environment stress tolerance enhanced transgenic cell line and transfer-gen plant.So the present invention also provides a kind of method of cultivating resistance enhanced plant, ZmWRKY58 encoding gene of the present invention is imported the purpose plant obtain transgenic plant, the resistance of gained transgenic plant is higher than the purpose plant.

The ZmWRKY58 gene that can adopt clone is as probe, and screening obtains gene of the present invention or homologous gene from cDNA and genomic library.Also can utilize the method for PCR, from genome, mRNA and cDNA amplification obtain gene of the present invention and any section of DNA or with its homologous section of DNA.When using ZmWRKY58 to make up plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or inducible promoter.

Carry ZmWRKY58 expression carrier of the present invention and can pass through Ti-plasmids, plant viral vector, directly DNA transforms, and biotechnological meanss such as electroporation import vegetable cell.By the purpose plant that transformed can be dicotyledons, also can or monocotyledons.

Beneficial effect

The present invention separates from corn, clone and obtain the ZmWRKY58 gene.By agriculture bacillus mediated conversion method it is imported paddy rice and obtains transfer-gen plant.Verified that then transgenic paddy rice improves ABA susceptibility,, thereby provide theoretical foundation and utility value for utilizing the application of this gene on other plant to improve resistance to the tolerance raising of high salt, arid.

Description of drawings

The amino acid sequence homology comparison of Fig. 1 ZmWRKY58 and other species WRKY family transcription factor conserved regions.Wherein, core conservative region WRKYGQK represents with solid line boxes, the box indicating of zinc fingers with dashed lines.

Evolutionary tree after Fig. 2 ZmWRKY58 and the comparison of other WRKY transcription factor aminoacid sequences.

Fig. 3 ZmWRKY58 protein subcellular location map.

A; Change the P1302-ZmWRKY58 fusion expression vector, no excitation light irradiation; B: change the P1302-ZmWRKY58 fusion expression vector, the irradiation of 445-490nm excitation light source; C: change the P1302 vector plasmid, no excitation light irradiation; D: change the P1302 vector plasmid, the irradiation of 445-490nm excitation light source.

The expression of Fig. 4 ZmWRKY58 gene when arid, the processing of high salt adverse circumstance.H group: arid (H 1:12h wherein, H2:24h, H3:48h); Y group: high salt (Y1:12h wherein, Y2:24h, Y3:48h).

Fig. 5 T1 detects for the PCR that changes ZmWRKY58 trans-genetic hybrid rice plant.M:DL2000 Marker; 1:L1-2; 2:L1-3; 3:L4-5; +: with the p1301 plasmid is template;-: with water is template.

Fig. 6 changes the ZmWRKY58 trans-genetic hybrid rice and has improved the tolerance of plant to arid.

Fig. 7 changes the ZmWRKY58 trans-genetic hybrid rice and has improved the tolerance of plant to high salt.

Fig. 8 changes the raising of ZmWRKY58 trans-genetic hybrid rice to ABA susceptibility.

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, and the primer is given birth to the biological company limited of worker by Shanghai and synthesized; Order-checking is undertaken by Invitrogen company; The various restriction enzymes of using in the experiment, ligase enzyme, pMD18-T, DNA Marker, Taq archaeal dna polymerase, dNTPs etc. are available from Takara company; The reverse transcription test kit is purchased the company in Promega; Plasmid extraction kit, glue reclaim test kit all and genome extract test kit and purchase Bioisystech Co., Ltd in full Shi Jin, method is all carried out with reference to specification sheets.

The acquisition of embodiment 1 corn WRKY family gene ZmWRKY58

1. coerce processing: vegetable material is a corn B73 self-mating system, and selected size is even, the seed of full grains is sowed in the flowerpot that sand is housed, and sprays distilled water in good time, to keep ground moistening.Treat that seedling grows to two leaves wholeheartedly the time, plant with normal irrigation compares, carry out 16%PEG-6000 respectively and 200mmol/L NaCl coerces processing, treatment time is respectively 12,24,48h, the different time sections of handling, with scissors respectively clip test group and control group corn seedling same area blade, each the treatment stage three parts of samplings.Sampling finishes, and sample is stored in-80 ℃ of refrigerators with liquid nitrogen freezing immediately.

2.RNA extract: the corn material of above-mentioned acquisition, after the adding liquid nitrogen grinding, transfer to rapidly in the centrifuge tube (liquid nitrogen precooling) of 1.5 ml.Ground material unification is added on the 0.5ml scale, adds 1ml Trizol, and room temperature is placed 10min, makes its abundant cracking; 4 ℃, 12000rpm, 5min abandons precipitation; Adds chloroform by 200 l chloroform/ml Trizol, covers tight centrifuge tube lid, with hand thermal agitation 15s, treat its fully emulsified after, room temperature placement 15min; 4 ℃, the centrifugal 15min of 12000rpm; The careful centrifuge tube that takes out is drawn the upper strata water, to another centrifuge tube from whizzer; Press 0.5ml Virahol/ml Trizol and add the Virahol mixing, room temperature is placed 10min; 4 ℃, the centrifugal 15min of 12000rpm; Supernatant discarded, RNA is sunken to the pipe end; Careful supernatant discarded adds 75% ethanol by 1ml75% ethanol/ml Trizol, and gentle vibration centrifuge tube suspends and precipitates, and 4 ℃, the centrifugal 5min of 12000rpm discards ethanol, is placed upside down on the paper, and room temperature is put dried; Add an amount of Rnase-free water dissolution precipitation, available in case of necessity liquid-transfering gun piping and druming precipitation is treated to get its concentration of an amount of detection and purity after RNA fully dissolves, and all the other put into-80 ℃ of preservations.

3. reverse transcription: operate according to the step that promega reverse transcription test kit provides, the reverse transcription system is as follows: total RNA 1 μ g, 25mM Mgcl2 4 μ l, Reverse Transcription 10 * Buffer 2 μ l, 10mM dNTP Mixture 2 μ l, RNase inhibitor (40u/ μ l) 0.5 μ l, Oligo (dT) 15Primer (500 μ g/ μ l) 1 μ l, AMV Reverse Transcriptase (25u/ μ l) 0.6 μ l adds Nuclease-Free Water to 20 μ l.Careful mixing, 42 ℃ of temperature are bathed 40min, and 95 ℃ of heating 5min place the 15min termination reaction, promptly obtain corresponding reverse transcription product cDNA for 4 ℃ then.

4. amplification: retrieval MAIZEGENOME and ncbi database, the supposition encoding sequence of acquisition ZmWRKY58, with Primer Premier 5.0 software design special primers, primer is synthetic by giving birth to worker biotech firm.Primer sequence is as follows:

WRKY1F：5’- AGATGAGGAAGTGGAGGAGGCGAACAG-3’

WRKY1R：5’- CACCTGTGCTGCTGCTGCTGCTGACT-3’

Total cDNA is a template with above-mentioned acquisition corn, obtains a coding region that includes complete open reading frame by RT-PCR, and length is 1110bp, reclaims, and is connected on the pMD18-T carrier, checks order.Sequencing result shows that the nucleotide sequence in the sequence 2 is consistent in ZmWRKY58 and the sequence table.Coding has the protein of the amino acid residue sequence of sequence 1 in the sequence table.

Sequence homology and the homology analysis of embodiment 2 corn ZmWRKY58

According to the sequence sequencing result, in ncbi database, carry out sequence alignment, find that the gene order and the WRKY family transcription factor homolog relation of being cloned into are nearest.This transcription factor and other WRKY transcription factor family member's protein sequence is compared, analyzing its zinc fingers type is the C2H2 type, according to the constitutional features of this DNA in conjunction with the territory, this ZmWRKY58 albumen belongs to II class WRKY transcription factor family (as Fig. 1).In order further to analyze the phyletic evolution relation of ZmWRKY58 and other WRKY class transcription factor, WRKY albumen and the ZmWRKY58 of different plants carried out the analysis (as Fig. 2) that phyletic evolution concerns.

The Subcellular Localization of embodiment 3 ZmWRKY58

With Primer Premier 5.0 software design special primers, and hold the recognition sequence and the corresponding protection base of adding restriction enzyme NcoI and SpeI respectively, transfer to living worker biotech firm at primer 5 ＇ end and 3 ＇.With the recombinant plasmid P-ZmWRKY58 that checks order correct is template amplification purpose fragment.Primer sequence is as follows:

RH-F 5’- ATATCCATGGTAGATGAGGAAGTGGAG -3’

RH-R 5’- GGACTAGTCACCTGTGCTGCTGCTGC -3’

The PCR product that amplification is obtained connects the pMD18-T carrier after reclaiming, and transform through thermal shock and import the intestinal bacteria competence, picking list bacterium colony, the upgrading grain is cut checking with NcoI and SpeI enzyme, verifies that correct plasmid sends to order-checking.

Cut above-mentioned recombinant plasmid and pCAMBIA1302 carrier with NcoI and SpeI enzyme, reclaim purpose fragment and the big fragment of pCAMBIA1302 carrier, again both are carried out ligation, through transforming and plasmid extraction evaluation the positive colony called after p1302-ZmWRKY58 that obtains.

The particle gun that p1302-ZmWRKY58 is used for onion (Allium cepa) epidermis transforms, and compares with p1302.Concrete steps are as described below:

1. the preparation of plasmid: extract purifying p1302-ZmWRKY58 and p1302(contrast with test kit) plasmid, concentration is 1mg/ml, is dissolved in H ₂O.

2. the preparation of onion: fresh onion is cut into the watermelon sheet, gets the comparatively smooth stem sheet of internal layer, strip the entocuticle cellular layer with tweezers, light is faced down, be tiled in MS(and contain 100mg/L Amp) on the flat board, it is stand-by to cultivate 4h in advance.

3. the preparation of little missile-borne body: take by weighing the 60mg bronze and place the 1.5mL centrifuge tube; Add the 1ml dehydrated alcohol, fully vortex is 3 minutes, 10000rpm centrifugal 10 seconds; Abandon supernatant, repeat once; Suspend with the 1ml sterilized water, shook 1 minute, 10000rpm centrifugal 10 seconds abandon supernatant, repeat once; Suspend with the 1ml sterilized water, be stored in-20 ℃ stand-by.

4. the embedding of bronze and DNA: get even bronze suspension that 50ul prepares in the 1.5mL centrifuge tube, add 10ulDNA (1mg/ml), 50ul 2.5M CaCl _2,20ul 0.1M spermidine whenever adds the same can the vibration several seconds; After centrifuge tube placed on the oscillator gentle concussion several minutes, room temperature left standstill 10 minutes, and 10000rpm centrifugal 10 seconds, abandons supernatant; Add 200ul dehydrated alcohol rinsing 3 times, 10000rpm, centrifugal 1 minute; Again with particle suspension in 30-45ul ethanol, inhale with rifle and to beat mixing, place on ice; Getting the 5ul uniform bronze that suspends places on the microcarrier.

5. particle gun transformation receptor material: before the operation super clean bench is opened uv sterilisation in advance, the ethanol wiping particle gun inner part with 75%, microcarrier, woven wire, can split film can be in advance with 75% alcohol disinfecting, treat that ethanol volatilizees totally can use; After treating that particle dries, be positioned over carrier film and carrier film support, get the mixture of plasmid DNA and bronze, draw a certain amount of microcarrier central authorities that are added on, dry several minutes with pipettor; Tweezers with the bacterium of going out take out rupture disk and gently dip in several sterilizations down in 70% isopropanol liquids, and rupture disk is placed in the locking cap, at last locking cap are connected the helium accelerator in the particle gun; Regulate the position between rupture disk and carrier film, place at last and stop screen; With valve open on the steel cylinder, adjust the preceding knob of tensimeter to convenient pressure; To bombard material and be placed on the interior specific position of particle gun body, close the door; Open particle gun panel left side power switch.When placing " VAC " gear that the particle gun cavity is evacuated to required vacuum tightness the middle air flow trip switch, fast switch is switched to " HOLD " gear; Push down emission key " FIRE " and keep motionless, till bombardment; The middle air flow trip switch is placed " VENT " gear, when pressure gauge reading reduces to zero, take out sample.The helium tank master switch is tightened, is made dry practice No. one time, treat that pointer makes zero after, be rotated counterclockwise helium pressure table variable valve to minimum, close the particle gun power supply, the result is as shown in Figure 3.

The expression analysis of embodiment 4 transcription factor gene ZmWRKY58 under environment stress

Press the treatment process among the embodiment 1, obtain different adverse circumstances and handle the material of different stepss, extract RNA after reverse transcription become cDNA, with corn GAPDH gene as interior source reference, by adjusting parameters such as annealing temperature, cycle index, template amount, set up suitable sxemiquantitative PCR reaction system.Determine that the best amplification cycles number of GAPDH gene is 28 circulations, the best amplification cycles number of ZmWRKY58 gene is 34 circulations.Annealing temperature all is 60 ℃.After selecting optimum condition,, carry out sxemiquantitative RT-PCR experiment, triplicate respectively with the GAPDH gene of design and the primer of ZmWRKY58 gene to be template through the corn seedling cDNA after the above-mentioned processing.The corn tri-leaf period leaf cDNA of negative control template for normally watering.ZmWRKY58 Gene RT-PCR primer: P1:5 '-AGG AAG TGG AGG AGG CGA ACA-3 '; P2:5 '-GGA TGG CTT GCG CTT GC-3 ' ZmWRKY58 Gene RT-PCR amplified fragments is 217bp.GAPDH Gene RT-PCR primer: P3:5 '-CAACGACCCCTTCATCACCAC-3 ';

P4：5’- ATACTCAGCGCCAGCCTCACC-3’

GAPDH Gene RT-PCR amplified fragments is 190bp, and the result as shown in Figure 4.

The detection of embodiment 5 ZmWRKY58 transgenic paddy rices

Make up plant expression vector p1301-ZmWRKY58, to spend in 11 in its importing rice varieties by agriculture bacillus mediated rice genetic method for transformation, through the callus of pre-cultivating, contaminating, cultivating altogether, screening having hygromycin resistance, break up, take root, hardening, transplanting, obtain transfer-gen plant.Extract rice genome DANA then, concrete grammar is as follows:

1. get fresh rice plant 100mg spire and put into mortar, add liquid nitrogen and fully grind.

2. add 250 μ lRB1 solution, put upside down mixing fast,

3. add 30 μ l10%SDS, 15 μ lRNaseA in lysate, mixing.

4. place temperature bath 15min in 60 ℃ of water-baths.

5.13000rpm centrifugal 5min is transferred to supernatant in the clean centrifuge tube.

6. add 100 μ l solution PB1, mixing places 5min on ice, 13000rpm, centrifugal 5min.

7. supernatant is changed over to a clean centrifuge tube, add 375 μ l solution B B1, mixing.

8. whole mixed solutions is poured on the adsorption column, 13000rpm, centrifugal 1min abandons filtrate.

9. add 500 μ l solution C B1,13000rpm, centrifugal 1min abandons filtrate.

10. add 500 μ l solution W B1,13000rpm, centrifugal 1min abandons filtrate, repeats once.

11.13000rpm centrifugal 2min thoroughly removes WB1.

12. change adsorption column over to a clean centrifuge tube, at the deionized water of post central authorities adding 70 μ l preheatings, room temperature leaves standstill 2min, 13000rpm, centrifugal 2min, eluted dna.

13. get 5ul sample point sample on the sepharose of 1 %, detect the quality of the DNA that puies forward.

As template, with hygromycin gene primer HygF:5 '-ACTCACCGCGACGTCTGT-3; HygR:5 '-TTTCTTTGCCCTCGGACG-3 ' amplification purpose fragment.The PCR reaction conditions is: pre-sex change: 94 ℃, and 5 min; Sex change: 94 ℃, 30s,, annealing: 55 ℃, 30s, extend: 72 ℃, 1min 30s, 30 circulations; 72 ℃, 10 min.After reaction finishes, the PCR product is carried out 1.0% agarose gel electrophoresis detect, the result as shown in Figure 5.

Embodiment 6 ZmWRKY58 transgenosis T2 identify for the plant drought tolerance

Is that the rice paddy seed that L1-2, L1-3, L4-5 and contrast strain are places culture dish with three T2 that isozygoty for changeing the strain of ZmWRKY58 trans-genetic hybrid rice, with the deionized water immersion its imbibition is sprouted, when treating seedling length to the 10cm left and right sides, the seedling that each strain system chooses the growing way unanimity is transferred in the plastic tank of nutrition soil: vermiculite=1:l, each plastic tank contains soil mixture and 15 rice seedlings of sowing of identical weight, and each strain system is provided with three repetitions.Carrying out arid after around cultivating in heliogreenhouse handles.With the transgenic paddy rice after around cultivating and in spend 11 paddy rice seedlings, pour into saturation water, be to handle 0 day with this moment, coerce 15 days dried morning after, recover to cultivate 7 days, the observation phenotype is also added up its survival rate (as Fig. 6).

Embodiment 7 ZmWRKY58 transgenosis T2 identify for the plant salt tolerance

Step is the same before the screening.With L1-2, L1-3 after around cultivating, L4-5 transgenic paddy rice and in spend 11 paddy rice seedlings, pour into the salts solution that contains 200mM NaCl and continue to handle after 14 days, recover to cultivate 7 days, observe phenotype and also add up its survival rate (as Fig. 7).

Embodiment 8 ZmWRKY58 transgenosis T3 are for the sensitivity analysis of plant to ABA

With T2 for changeing ZmWRKY58 gene L1-2, L1-3, L4-5 rice strain planting seed in containing different concns ABA (0 μ M, 1 μ M, 5 μ M) on the 1/2MS substratum, to spend 11 paddy rice in not genetically modified is contrast, under 28 ℃ of conditions, 16h illumination/8h dark makes its germination and growth, and it is long to cultivate its root of 2 weeks back measurement, and experiment repeats 3 times (as Fig. 8).

Fig. 6,7 and 8 observes the plant of three transgenic lines and contrast strain system respectively under the ABA of different concns handles, the variation that root is long.Can find out obviously that from figure along with the raising (during 5 μ M) of ABA concentration, the long contrast of the root of three transgenic lines has obvious shortening.

Sequence table

＜110〉Agricultural University Of Anhui

＜120〉a kind of corn WRKY class transcription factor ZmWRKY58 and encoding gene and application

<130>

<141> 2013-04-18

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 369

<212> PRT

＜213〉corn (Zea mays)

<400> 1

Met Glu Glu Val Glu Glu Ala Asn Arg Glu Ala Val Glu Ser Cys Arg

1 5 10 15

Arg Val Leu Ala Leu Leu Ser His Pro His Asp Pro Ala Gln Val Arg

20 25 30

Ser Ile Ala Leu Gly Thr Asp Glu Ala Cys Thr Lys Phe Arg Lys Val

35 40 45

Val Ser Leu Leu Ser Asn Gly Glu Val Gly Thr Gly Glu Ala Gly Pro

50 55 60

Ser Gly Thr Ser Ala Ser Ala Ser His Pro Arg Ala Lys Leu Val Ser

65 70 75 80

Arg Arg Gln Asn Pro Gly Phe Leu Thr Gln Lys Gly Phe Leu Asp Ser

85 90 95

Asn Thr Pro Val Val Val Leu Asn Ser Ala Ala His Pro Ser Pro Thr

100 105 110

Ser Ala Gln Val His Pro Arg Ala Gly Ala Leu Asp Thr Glu Gly Val

115 120 125

His Pro Leu Gly Val Gly Gly Pro Pro Lys Leu Val Gln Pro Leu Ser

130 135 140

Ala His Phe Gln Phe Gly Asn Val Ser Ser Arg Tyr Gln Gln Leu Pro

145 150 155 160

Ser His His His Arg His Gln Gln Gln Glu Lys Leu Gln Ala Ala Glu

165 170 175

Met Phe Lys Arg Ser Asn Ser Gly Ile Asn Leu Lys Phe Glu Ser Ala

180 185 190

Ser Gly Thr Gly Thr Met Ser Ser Ala Arg Ser Phe Leu Ser Ser Leu

195 200 205

Ser Met Asp Gly Ser Val Val Ala Ser Leu Asp Gly Lys Leu Pro Ser

210 215 220

Ser Ser Ser Ser Phe Arg Leu Ile Gly Ala Pro Ala Met Ser Asp Pro

225 230 235 240

Ala Asn Ala Ala Gln Gln Ala Pro Arg Arg Arg Cys Thr Gly Arg Gly

245 250 255

Lys Asp Gly Thr Gly Lys Cys Ala Leu Ala Gly Arg Cys His Cys Ser

260 265 270

Lys Arg Ser Lys Lys Leu Arg Val Lys Arg Ser Ile Lys Val Pro Ala

275 280 285

Val Ser Asn Lys Ile Ala Asp Ile Pro Pro Asp Glu Tyr Ser Trp Arg

290 295 300

Lys Tyr Gly Gln Lys Pro Ile Lys Gly Ser Pro His Pro Arg Gly Tyr

305 310 315 320

Tyr Lys Cys Ser Ser Val Arg Gly Cys Pro Ala Arg Lys His Val Glu

325 330 335

Arg Cys Val Asp Asp Ser Ala Met Leu Ile Val Thr Tyr Glu Gly Glu

340 345 350

His Asn His Thr Gly Met Pro Ala Gln Ser Ala Ala Ala Ala Ala Gln

355 360 365

Val

<210> 2

<211> 1110

<212> cDNA

＜213〉corn (Zea mays)

<400> 2

atggaggaag tggaggaggc gaacagggaa gccgtggaga gctgccgcag ggtgctagcc 60

ttgctctccc atccgcatga ccccgcgcag gtcaggagca tagctctggg gacggacgaa 120

gcatgcacca agtttaggaa ggtggtctcc ctgctcagca atggagaagt aggaacagga 180

gaagccggac catcaggcac aagcgcaagc gcaagccatc ctagagctaa gcttgttagc 240

agaagacaga atccagggtt cttgactcag aaaggcttcc tggacagtaa caccccggtc 300

gtggtgctga acagcgccgc ccatccttct ccgacctccg cgcaggtgca tccaagagcc 360

ggagcattgg atacggaggg cgtgcacccc ctcggagttg gaggacctcc caagctggtc 420

cagcctttgt ccgcgcattt tcagttcggc aatgtgtcgt cgaggtatca gcagttaccg 480

agtcatcatc atcgtcatca gcagcaggag aagctgcagg ccgccgagat gttcaagaga 540

agcaacagcg ggataaacct gaagttcgag agcgccagcg gcacgggtac aatgtcgtcg 600

gcgaggtcct tcctgtcgtc tctgagcatg gatggcagcg tggtggctag cctggatggc 660

aagctgccgt cgtcgtcgtc atcgttccgt ttgatcggtg cgcctgcaat gagcgatccg 720

gcgaacgccg cgcagcaggc cccgaggcgg cggtgcacgg gccgcgggaa ggacgggact 780

ggcaagtgcg ctttggcggg caggtgccat tgttcaaaga gaagtaagaa gttgcgggtg 840

aagaggtcga ttaaggttcc tgccgttagt aacaagatcg ctgatatacc tccggatgag 900

tactcgtgga ggaagtatgg gcagaagccg atcaagggtt cccctcatcc taggggctac 960

tacaaatgca gcagtgtgag gggctgtcca gctaggaagc acgtggaacg gtgtgtggat 1020

gattcggcga tgctcatcgt gacatacgag ggcgagcaca accacaccgg aatgccagct 1080

cagtcagcag cagcagcagc acaggtgtag 1110

<210> 3

<211> 27

<212> DNA

＜213〉artificial sequence

<400> 3

agatgaggaa gtggaggagg cgaacag 27

<210> 4

<211> 26

<212> DNA

＜213〉artificial sequence

<400> 4

cacctgtgct gctgctgctg ctgact 26

<210> 5

<211> 27

<212> DNA

＜213〉artificial sequence

<400> 5

atatccatgg tagatgagga agtggag 27

<210> 6

<211> 26

<212> DNA

＜213〉artificial sequence

<400> 6

ggactagtca cctgtgctgc tgctgc 26

<210> 7

<211> 21

<212> DNA

＜213〉artificial sequence

<400> 7

aggaagtgga ggaggcgaac a 21

<210> 8

<211> 17

<212> DNA

＜213〉artificial sequence

<400> 8

ggatggcttg cgcttgc 17

<210> 9

<211> 21

<212> DNA

＜213〉artificial sequence

<400> 9

caacgacccc ttcatcacca c 21

<210> 10

<211> 21

<212> DNA

＜213〉artificial sequence

<400> 10

atactcagcg ccagcctcac c 21

Claims (10)

1. a corn WRKY transcription factor is following 1) or 2) described protein:

1) protein of forming by the SEQ ID N0:1 amino acid residue sequence in the sequence table;

2) with the SEQ ID N0:1 amino acid residue sequence in the sequence table through the replacement of one to ten amino-acid residue and/or disappearance and/or interpolation and have corn WRKY functional transcription factor by 1) deutero-protein.

2. corn WRKY transcription factor according to claim 1 is characterized in that: described corn WRKY transcription factor and W box cis element interaction energy improve the plant stress-resistance function, and itself and W box bonded DNA core sequence are TGAC.

3. the encoding gene of the described corn WRKY of claim 1 transcription factor.

4. encoding gene according to claim 3 is characterized in that: described encoding gene is following 1) to 4) in each described nucleotide sequence:

1) has the nucleotide sequence of SEQ ID N0:2 in the sequence table;

2) have the polynucleotide of the protein sequence of SEQ ID N0:1 in the code sequence tabulation;

3) have with sequence table in the homology of dna sequence dna more than 90% of SEQ ID N0:2, and coding identical function protein DNA sequence;

4) have under the rigorous condition of height the nucleotide sequence of the dna sequence dna hybridization that can limit with SEQ ID N0:2 in the sequence table, the rigorous condition of described height can be with 0.1 * SSPE or 0.1 * SSC, and the solution of 0.1%SDS is hybridized under 65 ℃ and washed film.

5. encoding gene according to claim 4 is characterized in that: it has the nucleotide sequence of SEQ ID N0:2 in the sequence table.

6. as the application of encoding gene in cultivating the resistance plant as described in each in the claim 3 ~ 5; The application of the described corn WRKY of claim 1 transcription factor in cultivating resistance enhanced plant.

7. the recombinant vectors, reorganization bacterium, transgenic cell line or the expression cassette that contain each described encoding gene in the claim 3 ~ 5.

8. each described encoding gene total length or arbitrary segmental primer are right in the amplification claim 3 ~ 5.

9. method of cultivating resistance enhanced plant: each described encoding gene in the claim 3 ~ 5 is imported purpose plant obtain transgenic plant, the resistance of described transgenic plant is higher than described purpose plant.

10. method according to claim 9 is characterized in that: described purpose plant is dicotyledons or monocotyledons.

Images