CN111909940A - Application of rice gene LJS4-1 in controlling growth of leaf pillow and leaf angle of rice - Google Patents

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice geneLJS4‑1The application in controlling the development of the leaf pillow and the leaf angle of the rice. The present invention obtains a geneLJS4‑1（GENE ID：Os03g0182800). Knock-out by gene knock-out techniqueLJS4‑1The mutant shows that the included angle is obviously smaller than that of the wild type, and the plant type is upright. The phloroglucinol staining of the cross section sclerenchyma cells of the leaf pillows of the mutant is found to be redder than that of the wild type through bare-handed slicing and phloroglucinol staining observation of the leaf pillows of the sword leaves in the heading period, which indicates lignin accumulationThe mechanical strength of the leaf pillow is increased compared with the wild type (Nipponbare). Thus knocking out by genetic engineering techniquesLJS4‑1The gene can change the mechanical strength of the plant leaf pillow and the formation of leaf included angle, thereby improving the plant type and planting density of the plant and increasing the yield.

Description

Application of rice gene LJS4-1 in controlling growth of leaf pillow and leaf angle of rice

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice geneLJS4-1The application in controlling the development of the leaf pillow and the leaf angle of the rice.

Background

Rice leaves are divided into three categories, including coleoptiles, incomplete leaves and complete leaves. Coleoptiles are the first white coleoptiles to appear during germination, are leaf deformations, and have no chlorophyll. Incomplete leaves are the first green leaves that grow from the coleoptile, only the coleoptile, without leaf and leaf pillow structures. The complete leaf is from the second green leaf, with leaf, leaf sheath, and leaf pillow. The main function of the leaves is as an organ for photosynthesis. The leaf sheath wraps the main stem to enhance the supporting effect of the stem. The leaf pillow is a kind of mechanical tissue specific to monocotyledon gramineous plants, and is a mechanical tissue for connecting leaves and leaf sheaths, and comprises a leaf pillow belt, leaf ears and leaf tongues. The occipital bands act as mechanical tissue that can angle leaves away from the main stem after they have grown to the sheath (Hoshikawa and Ichii, 1989). Therefore, the existence and development degree of the leaf pillow directly determine the size of the leaf angle, thereby influencing the plant type and yield of the rice.

The growing population also has an increasing demand for food. The improvement of the rice yield is always a hotspot and a key point of rice breeding research and gene function research. In 1968, Donald proposed the concept of breeding of ideal plant types of crops, i.e. selection of traits related to influence plant photosynthesis, growth and seed yield (Donald, 1968). The traits affecting the plant type of rice mainly include plant height, tillering number, panicle type, grain type, leaf shape, leaf angle, tillering angle and the like, wherein the size of the leaf angle is an important agronomic trait determining the uprightness of the leaf blade (Feng Rong Kun, 2006). The upright leaves can enhance the light capturing ability of photosynthesis, serve as a nitrogen source for grain filling, and can also increase planting density, thereby improving leaf area index and rice yield (Sakamoto, et al, 2006).

Disclosure of Invention

The invention aims to obtain a gene for regulating and controlling the development of a rice leaf pillow and the leaf angleLJS4-1。

Another object of the present invention is to provideFor supplying toLJS4-1The gene is applied to controlling the development of the leaf pillow and the size of the leaf angle of rice.

In order to achieve the purpose, the invention clones genes for regulating and controlling the development of leaf pillows from rice leaf pillows tissues by a reverse genetics methodLJS4-1。

In particular, for cloningLJS4-1The primer sequences of the genes are as follows:

LJS4-1-F CGGGATCCATGTGCGGCGGTGCAATCCTC

LJS4-1-R GCGTCGACGTCGAGCAGAAGAGAGGCCTG

in particular, for cloningLJS4-1The PCR conditions for the genes were: denaturation at 94 ℃ for 3 min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min for 35cycles, and elongation at 68 ℃ for 10 min.

In particular, for cloningLJS4-1The total volume of the PCR reaction system for the gene was 50. mu.l, the template was Nipponbare cDNA 1ul (about 50ng), 10 XKOD enzyme reaction buffer 5. mu.l, and MgCl 25mM₂Mu.l, 5mM dNTP 5. mu.l, 5 uM primers 5. mu.l (2.5. mu.l each), 1. mu.l KOD enzyme, ddH2O (sterile deionized water) to 50. mu.l.

The invention obtains the nucleotide containing SEQ ID NO.1 by the methodLJS4-1A gene sequence.

The invention also obtainsLJS4-1The amino acid sequence of the gene code is shown as SEQ ID NO. 2.

The gene obtained by the method of bioinformatics is identified as the gene for regulating the development of the leaf occiput, and the RNA-seq data of the leaf occiput at different periods are utilized to verifyLJS4-1The expression specificity of the gene in the development process of the leaf pillow.

LJS4-1The application of the gene in the improvement of gramineous crops.

LJS4-1The gene is applied to improving the rice plant type and increasing the rice yield.

LJS4-1Application of gene in regulating and controlling development of leaf pillow and leaf angle of rice, and during application, the gene is constructed to containLJS4- 1CRISPR/CAS9 vector for gene and transfer to Nipponbare, knock-outLJS4-1Genes, the resulting transgenic lines exhibitingThe leaf angle is smaller than that of a wild type (Nipponbare), so that the method can increase the lignin accumulation of thick-wall tissues of the leaf pillows, improve the mechanical strength of the leaf pillows, reduce the leaf angle, improve the plant type and planting density of plants, improve the yield and realize the regulation and control of the growth of the leaf pillows of rice and the size of the leaf angle.

Compared with the prior art, the invention has the beneficial effects that:

1. LJS4-1the gene is specifically expressed in the late development stage of rice leaf pillow, and this makes it possible to change crop angle without affecting other characteristics.

2. LJS4-1The gene is an effective gene for changing the leaf angle, and can change the lignin accumulation and the mechanical strength of thick-wall tissues of the leaf pillow, thereby changing the leaf angle of crops.

3. At present, the gene for regulating and controlling the leaf angle by changing the mechanical strength of the leaf pillow is few, and the gene discloses that the gene participates in the regulation and control of the leaf angle by controlling the lignin accumulation and the mechanical strength of the thick-wall tissue of the leaf pillow.

4. At present, the mechanism research of improving the yield of the plant with the upright plant type is less,LJS4-1after the genes are successfully knocked out by using CRISPR/Cas9, the yield of rice is increased by increasing the number of fertile ears per unit area under high density (as shown in figure 6).

Drawings

FIG. 1 shows the result of RNA-seq sequencing, in which FIG. 1a showsLJS1-1Specific expression in early development stage of rice leaf pillow, FIG. 1b isLJS4-1Specific expression in late development stage of rice leaf pillow, FIG. 1c isLJS3-1And homologous genes thereofLJS3-1LSpecific expression in the S3 and S4 phases of rice leaf pillow development, respectively, FIG. 1dLJS5-1Specific expression in late development stage of rice leaf pillow, FIG. 1e isLJS1S2-1Specific expression in early development stage of rice leaf pillow, FIG. 1f isLJS4-2Specific expression in late development stage of rice leaf pillow, FIG. 1g isLJS5-2And homologous genes thereofLJS5-2LSpecific expression is carried out in S4 and S5 stages of rice leaf pillow development;

FIG. 2 shows leaf angle phenotype and heading stage plant phenotype of CRISPR/CAS9 target gene-knocked transgenic rice seedlings and knocked transgenic riceStatistics of leaf angle between the seedlings of the transgenic rice and the wild type (Nipponbare), wherein the target gene in FIG. 2a is shown asLJS1-1And homologous genes thereofLJS1-1L(ii) a FIG. 2b target genes areLJS4-1(ii) a FIG. 2c target genes areLJS3-1And homologous genes thereofLJS3-1L(ii) a FIG. 2d target genes areLJS5-1(ii) a FIG. 2e target genes areLJS1S2-1And homologous genes thereofLJS1S2-1L(ii) a FIG. 2f the target genes areLJS4-2(ii) a FIG. 2g target genes areLJS5-2And homologous genes thereofLJS5-2L；

FIG. 3 is a diagram showing the changes of the cytological structures of the leaf pillows of the young leaves of the heading stage of CRISPR/CAS9 target gene-knocked transgenic rice and wild type (Nipponbare), wherein FIG. 3a shows that the target gene isLJS1-1And homologous genes thereofLJS1-1L(ii) a FIG. 3b target geneLJS4-1(ii) a FIG. 3c target geneLJS3-1And homologous genes thereofLJS3-1L(ii) a FIG. 3d target genesLJS5-1(ii) a FIG. 3e target geneLJS1S2-1And homologous genes thereofLJS1S2-1L(ii) a FIG. 3f target genesLJS4-2(ii) a FIG. 3g target geneLJS5-2And homologous genes thereofLJS5-2L；

FIG. 4a is a graph showing the expression level change of target genes regulated by Real-time PCR (polymerase chain reaction) in transgenic rice after the target genes are knocked out by CRISPR/CAS9 for the target genes promoting and inhibiting lignin synthesis, wherein the target genes in FIG. 4a areLJS4-1FIG. 4b target geneLJS3-1And homologous genes thereofLJS3-1LFIG. 4c target geneLJS1S2-1And homologous genes thereofLJS1S2-1LFIG. 4d target geneLJS4-2；

FIG. 5 is a drawing showingpLJS1S2-1::LJS1S2-1Analyzing the seedling phenotype and expression quantity of the transgenic rice line;

FIG. 6 shows the effect of CRISPR/CAS9 on yield of transgenic rice with target gene knocked out, wherein the target gene in FIG. 6a is LJS1-1 and its homologous gene LJS1-1L, and the target gene in FIG. 6b is LJS1-1LLJS4-1FIG. 6c target geneLJS3-1And homologous genes thereofLJS3-1LFIG. 6d target geneLJS5-1FIG. 6e target geneLJS1S2-1And homologous genes thereofLJS1S2-1LFIG. 6f target genesLJS4-2FIG. 6g target geneLJS5-2And their isogenyGeneLJS5-2L。

Detailed Description

The invention clones gene from rice leaf pillow tissue by reverse genetics methodLJS1-1 (GENE ID：Os01g0922800) And homologous genes thereofLJS1-1L (GENE ID：Os08g0531900Homology of 45.83%), geneLJS4-1（GENE ID：Os03g0182800) Genes, genesLJS3-1（GENE ID：Os04g0549700) And homologous genes thereofLJS3-1L（GENE ID：Os02g0656600，57.58% homology), geneLJS5-1（GENE ID：Os06g0166400) Genes, genesLJS1S2-1（GENE ID：Os06g0181700) And homologous genes thereofLJS1S2-1L（GENE ID：Os02g0797100，71.59% homology), geneLJS4-2（GENE ID：Os07g0674800) Genes, genesLJS5-2（GENE ID：Os10g0536100) And homologous genes thereofLJS5-2L（GENE ID：Os03g0122600And the homology is 63.88%), identifying the obtained genes by a bioinformatics method to be all genes for regulating the development of the leaf occiput, and verifying the expression specificity of the obtained genes in the development process of the leaf occiput by using RNA-seq data of the leaf occiput at different periods. The gene is transferred into Nipponbare through a transgenic method, and the target gene is found to be capable of regulating and controlling the leaf angle of rice, so that the plant type and the planting density of plants are improved, the yield is increased, and the regulation and control of the leaf pillow development and the leaf angle of the rice are realized.

The specific implementation method is as follows, and it should be noted that the following gene synthesis process or rice application test, if not specifically mentioned, are all routine test methods and technical means in the field; the reagents or biomaterials referred to, if not specifically indicated, are either disclosed or are commercially available products which can be purchased directly.

Examples

(A)LJS1-1Gene and homologous gene thereofLJS1-1LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice comprises the following specific steps:

1. gene for regulating and controlling development of rice leaf pillow and leaf angleLJS1-1And homologous genes thereofLJS1-1LObtained by

1.1 the total volume of the reaction system was 50. mu.l, the template was Nipponbare cDNA 1. mu.l (about 50ng), 10 XKOD enzyme reaction buffer 5. mu.l, 25mM MgCl₂Mu.l of 5mM dNTP, 5. mu.l of 5. mu.M primer (using stepwise PCR with primers LJS1-1-F and LJS1-1-R or LJS1-1L-F and LJS1-1L-R (each primer being 2.5. mu.l), 1. mu.l of KOD enzyme, plus ddH₂O (sterile deionized water) to 50. mu.l.

1.2 the reaction sequence is: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min for 35cycles, and elongation at 68 ℃ for 10 min.

1.3 the primers used were as follows:

LJS1-1-F CGGGATCCATGGCGCGGAGGGGGAGA

LJS1-1-R GCGTCGACTGCACTTCCTTCCTCCTGCC

LJS1-1L-F CGGGATCCATGGAGGGAGGAGGGAGGAGG

LJS1-1L-R GCGTCGACAGAGCTCACTCCTGATCTTGGCT

2. gene validation Using RNA-seq dataLJS1-1And homologous genes thereofLJS1-1LSpecific expression in rice leaf pillow

Under normal conditions, seedlings of Nipponbare rice growing 4, 5, 6, 7 and 9 days from seed soaking are defined as the first stage (S1), the second stage (S2), the third stage (S3), the fourth stage (S4) and the fifth stage (S5) of leaf pillow development, respectively. The leaf and leaf pillow of the first full leaf were taken separately, total RNA was extracted using the Tiangen RNAprep pure Plant Kit (Tiangen), and then RNA-seq sequencing was performed.

Obtaining a differential gene set specifically expressed in five periods and corresponding GO terms subjected to function enrichment analysis through bioinformatics analysis, selecting the differential gene set comprising a single-period specific expression gene set M01-M05 and a GO terms gene set related to leaf occipital development, extracting a promoter sequence, analyzing enriched motifs (motifs) on the promoter by using MEME software, and selecting the first 10 genes which meet the condition that E-value is less than or equal to 10^-6As possible transcription factor binding sites (pTFBSs); then, the pTFBSs are compared with the known TFBSs by using TOMTOM software and JASPAR CORE database, and the selection conforms to q-value less than or equal to 0.05 and p-value ≤ 10^-4Known TFBSs under the conditions, thereby obtaining known TFs corresponding to the pTFBSs; then, BLASTP (e-value ≦ 10)^-10) Searching for homologous genes of the known TFs in rice; the definition of the candidate TFs meets two conditions, the first is that the plantaTFDB is determined to belong to a corresponding transcription factor family, and the second is that the TFs and the corresponding target genes specifically expressed at the same period have high correlation of expression trend (PCC is more than or equal to 0.9). The invention obtains the genes by analyzing the differential gene set M01 specifically expressed in the S1 stageLJS1-1And homologous genes thereofLJS1- 1L。Finally, the gene was obtainedLJS1-1And homologous genes thereofLJS1-1LExpression levels in leaves and leaf pillows at five stages. Discovery of genesLJS1-1S1 was specifically expressed in leaf occipital development (FIG. 1 a).

3. LJS1-1Gene and homologous gene thereofLJS1-1LRegulation and control of rice leaf pillow

3.1 construction of CRISPR/Cas9 vector

Using genes containingLJS1-1And homologous genes thereofLJS1-1LThe fragment of CRISPR target site sequence of (1) is cloned into pCXUN-CAS9 vector by using KpnI enzyme cleavage site, and the specific method is described in the literature He, Y., Zhang, T., Yang, N., Xu, M., Yan, L., Wang, R., and Zhao, Y. (2017), Self-cleaning ribozymes enabling the expression of guide RNAs from unlimited restriction microorganisms for CRISPR/Cas9 mediated genome editing, Journal of genetics and genetics = Yi chon xue bao 44, 469-472.

Wherein the gene is obtainedLJS1-1And homologous genes thereofLJS1-1LThe total volume of the reaction system of the CRISPR target site fragment of (3) is 50 μ l,LJS1-1the gene adopts 1 μ l (about 50ng) of U6 vector as a template;LJS1-1Lthe template used for the gene was 1. mu.l (about 50ng) of U3 vector, 5. mu.l of 1 XKOD enzyme reaction buffer, and 25mM MgCL₂Mu.l, 5mM dNTP 5. mu.l, 5 uM primer 5. mu.l (forward and reverse primers 2.5. mu.l, respectively), 1. mu.l KOD enzyme, ddH2O (sterile deionized water) to 50. mu.l.

The reaction procedure is as follows: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min for 35cycles, and elongation at 68 ℃ for 10 min.

The primers used were:

LJS1-1-U6F GGTGCGGTTCTCCAAGAGGAgttttagagctagaaatagcaagtta

LJS1-1-U6R TCCTCTTGGAGAACCGCACCAACCTGAGCCTCAGCGCAGC

LJS1-1L-U3F ATCGCACCTGCCGGCTCGTCgttttagagctagaaatagcaagtta

LJS1-1L-U3F GACGAGCCGGCAGGTGCGATgccacggatcatctgcacaactc

to obtainLJS1-1Sequence fragment sequence of target site andLJS1-1Lthe sequence fragment of the target site, and the fragment was cloned into pCXUN-CAS9 vector using KpnI enzyme cleavage site.

Taking 2 μ l of the extract containingLJS1-1AndLJS1-1Lthe target pCXUN-CAS9 vector was added to 50. mu.l of EHA105 competent cells and mixed well. Adding into a pre-cooled electric shock cup for electric shock conversion. Setting parameters of an electric laser: voltage 2.45 kV, resistance 200 omega, capacitance 200 muF.

3.2 genetic transformation of Rice

The rice transformation in the following method adopts agrobacterium EHA105 mediated genetic transformation method, and the specific steps are as follows:

3.2.1 callus Induction

Removing hull from rice seed, soaking plump and clear seed in 70% ethanol for 1min, and washing with sterile water for 1-2 times; then adding NaClO solution containing 2% active chlorine (40 ml NaClO solution containing >5.2% active chlorine and 60 ml water), adding 1-3 drops of Tween 20, and soaking for more than 30 min (generally 40 min, the maximum can be 1 h). Shaking occasionally, and then rinsing with sterile water 4-5 times. Pouring on a sterilized flat plate and filter paper, and sucking for about 1 h; placing the seeds on an N6D solid medium (10 grains/25 ml/bottle), placing the seeds on the medium or contacting the seeds with the medium, and culturing at 28 ℃ in the dark for 25-30 days. N6D medium: n6 salt and vitamins, 0.5g/l casein hydrolysate, 30g/l sucrose, 2mg/l 2, 4-D, 2.5g/l Phytagel (Sigma), pH 5.8.

3.2.2 culture of Agrobacterium and Co-culture with Rice callus

Scraping Agrobacterium with a small sterilized spoon, sticking the thallus on the wall of the tube with the back of the spoon, and gently patting to obtain OD₆₀₀= 0.8-1.0; airing the pre-cultured calluses on sterile filter paper, then concentrating the calluses into a plate, transferring the calluses into bacteria liquid at one time, slightly rotating a centrifugal tube to uniformly distribute the bacteria liquid, and standing for about 15-20 min; pouring out the bacterial liquid, placing the callus on sterile filter paper for about 1.5 h to ensure that the bacterial liquid is sucked dry, inoculating the bacterial liquid into 1/2N 6D AS, culturing in dark at 20 ℃ for 2-3 days, and sterilizing when bacterial film is seen on the contact part of the callus and the culture medium; 1/2N 6D AS Medium: N6D2, 10g/l glucose, 100-400 mu mol/l acetosyringone (added when used), pH5.2.

3.2.3 removal of Agrobacterium

Putting the co-cultured callus into 50 ml centrifuge tube, cleaning with sterile water for more than 3 times, pouring out sterile water, N6D + Cn 500 mg/L (or AP500ml/L), 100 rpm, 15-20 min, 2-3 times; pouring the callus on sterile filter paper, and sucking for about 2h as the case may be; transferring the dried callus into N6D-AS, adding 250 mg/L of cefamycin Cn, and culturing at 28 ℃ in dark for 7-10 days.

3.2.4 selection of callus

Picking out the callus which is not polluted by the agrobacterium, adding Cn250 mg/L and Hn (50 mg/L) for the first time for 15-20 days; the second time is the same as above, Cn is not added, hygromycin Hn is added, all calluses are completely transferred again for 15-20 days. Selecting new callus for the third time, and screening by Hn for 15-20 days; the frequency part is arranged according to the above, but the callus screening time on Hn is ensured to be at least 45 d, and the newly grown callus picked out for the third time is preferably screened for 20 d; N6D screening medium: N6D + Cn250 mg/L + Hn50 mg/L, pH = 5.8-5.9.

3.2.5 differentiation and rooting

Transferring all callus tissues screened for the fourth time into MS, culturing in dark with Hn50 mg/L, and pre-differentiating (pH 5.9) for 12-15 days. Selecting fresh callus with good growth vigor, transferring the callus into MS (PH 6.0), culturing for 15-20 days by light, and changing a culture medium for 15 days generally; selecting green bud with length of more than 1cm, removing peripheral redundant callus, cutting off root (about 0.5cm long can be left), transferring into test tube, and 1/2MS rooting culture. MS differentiation medium: MS salts and vitamins, 2g/L casein hydrolysate, 30g/L sucrose, 25g/L sorbitol, 2 mg/L6-BA, 0.5mg/L NAA, 0.2mg/L Zeatin (Zeatin), 0.5mg/L KT, 3.0g/L Phytagel, pH5.8, 50mg/L hygromycin B, 200mg/L cefuroxime. 1/2MS rooting culture medium: 1/2MS salt, MS vitamins, 30g/l sucrose, 1mg/l paclobutrazol, 0.5mg/l NAA, 50mg/l hygromycin, 2.5g/l Phytagel, pH 5.8.

4. Transplantation, expression level identification and phenotypic analysis

Genetically constructing 20 lines of each rooted transgenic plant, transplanting in greenhouse, and genetically constructingLJS1-1And homologous genes thereofLJS1- 1LThe CRISPR transgenic plant adopts leaves to extract DNA, and amplified and edited segments identify mutant single plants.

The primers used were as follows:

LJS1-1-genomeF CATCCGCCTCGTCAAATGC

LJS1-1-genomeR CGGGATAGCAGAACGAAATGG

LJS1-1L-genomeF GGATTCCCTCACCACCACATTA

LJS1-1L-genomeR CGCAGTGGAGTGGAGTACAT

5. determination of the yield

In the field toLJS1-1-cri/LJS1-1L-criAnd carrying out yield measurement under different planting densities with wild type Ni. Normal density (Normal, N) was planted at 30cm row spacing and 15cm plant spacing, with an average of 22.2 rice plants per square meter. High density (Dense, D) was planted at 15cm row spacing and 15cm plant spacing, with an average of 44.4 rice plants per square meter. Each treatment was repeated three times in random blocks. Each cell is 2m long and 2m wide. And (4) character investigation, namely selecting intermediate plants except peripheral plants for statistics. Data processing was performed using SPSS 17.0. Multiple comparisons were performed using Tukey's Home Significant Differencetest (P < 0.05).

(II) LJS4-1The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS4-1-F CGGGATCCATGTGCGGCGGTGCAATCCTC

LJS4-1-R GCGTCGACGTCGAGCAGAAGAGAGGCCTG

obtaining a peptide comprising SEQ ID NO.1Of said nucleotideLJS4-1The gene sequence, and the amino acid sequence coded by the gene is shown in SEQ ID NO. 2.

Step 2. the cell wall related GO term gene set of the S4 stage specific expression differential gene is analyzed as above to obtainLJS4-1。Finally, obtainLJS4-1Expression level in leaf pillows in five stages. Discovery of genesLJS4-1S4 was specifically expressed in leaf occipital development (FIG. 1 b).

Gene in step 3.1LJS4-1The template is a U6 carrier, and the primers are as follows:

LJS4-1-U6F GGGGGACGACACACATGACAgttttagagctagaaatagcaagtta

LJS4-1-U6R TGTCATGTGTGTCGTCCCCCAACCTGAGCCTCAGCGCAGC

to obtainLJS4-1Sequence fragment of target sitetgtc atgtgtgtcgtccccc。

The primers used in step 4 are:

LJS4-1-genomeF CAATCCTCGCCGATTTCACC

LJS4-1-genomeR GCTCTTCTTGCTCGCCTTC

(III)LJS3-1Gene and homologous gene thereofLJS3-1LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS3-1-F CGGGATCCATGGAAGCAGACGCGAGCCATA

LJS3-1-R GCGTCGACCTCGGCCCACAAGAGTGGCTCA

LJS3-1L-F CGGGATCCATGGAAGCTGCCGCGATCC

LJS3-1L-R GCGTCGACGTCAGGCTGCACGGGCGC

step 2. the differential gene sets M03 and M04 specifically expressed at S3 and S4 were analyzed as above to obtainLJS3-1AndLJS3-1L。finally, obtainLJS3-1And homologous genes thereofLJS3-1LExpression level in leaf pillows in five stages. Discovery of genesLJS3-1And homologous genes thereofLJS3-1LS3 and S4, which are expressed specifically in leaf occipital development, respectively (FIG. 1 c).

Step 3.1LJS3-1The gene being adoptedTemplate is U6 vector 1ul (about 50 ng);LJS3-1Lthe gene used a template of U3 vector 1ul (about 50ng), and the primers used were:

LJS3-1-U6F GGCCGCTCTCTTGCGCTTCTgttttagagctagaaatagcaagtta

LJS3-1-U6R AGAAGCGCAAGAGAGCGGCCAACCTGAGCCTCAGCGCAGC

LJS3-1L-U3F ACAAGCAGCTCAAGCGGAAGgttttagagctagaaatagcaagtta

LJS3-1L-U3R CTTCCGCTTGAGCTGCTTGTgccacggatcatctgcacaactc

the primers used in step 4 are:

LJS3-1-genomeF CAGACCGCACTTCCATCGA

LJS3-1-genomeR GATCTCCGACACCCACTTCC

LJS3-1L-genomeF CATCTCCTTCCTGCGGTATTCT

LJS3-1L-genomeR AGCCAGATGCGCGACTTCT

(IV)LJS5-1The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS5-1-F CGGGATCCATGGATAGGAGGGAGGCCACC

LJS5-1-R GCGTCGACCTCGTCGTCGGAGGTGTCCG

step 2. the differential gene set M05 specifically expressed in S5 was analyzed as described above to obtainLJS5-1。To obtainLJS5-1Expression level in leaf pillows in five stages. Discovery of genesLJS5-1S5 was specifically expressed in leaf occipital development (FIG. 1 d).

The primers used in step 3.1 are:

LJS5-1-U6F GCGAGCCGAACAAGCGGTCGgttttagagctagaaatagcaagtta

LJS5-1-U6R CGACCGCTTGTTCGGCTCGCAACCTGAGCCTCAGCGCAGC

the primers used in step 4 are:

LJS5-1-genomeF GCGAGGATGGATAGGAGGGA

LJS5-1-genomeR TAGAACACGGCGGTGTCGTA

(V)LJS1S2-1Gene and homologous gene thereofLJS1S2L-1LIn control ofThe application test in the development of the leaf pillow of the rice and the size of the leaf included angle is the same as the test method.

The primers used in step 1.3 were:

LJS1S2-1-F CGGGATCCATGGCGCGGCCGCAGCA

LJS1S2-1-R GCGTCGACGCAGGAGATCTCCATGGAGAAGT

LJS1S2-1L-F CGGGATCCATGGCGAGGCCGCAGCAACGAT

LJS1S2-1L-R GCGTCGACGTAGCAGATCTCCATGGAGAAG

step 2. the differential gene set M06 expressed specifically in both S1 and S2 phases was analyzed as above to obtainLJS1S2-1 and LJS1S 2L-1L.Finally, obtainLJS1S2-1AndLJS1S2L-1Lexpression levels in leaves and leaf pillows at five stages. Discovery of genesLJS1S2-1 and LJS1S2L-1LS1 and S2 were specifically expressed in leaf occipital development (FIG. 1 e).

Gene in step 3.1LJS1S2-1Adopts a template of U6 vector and geneLJS1S2L-1The template is a U3 carrier, and the primers are as follows:

LJS1S2-1-U6F GGCACGCGCGTACGACGAGGgttttagagctagaaatagcaagtta

LJS1S2-1-U6R CCTCGTCGTACGCGCGTGCCAACCTGAGCCTCAGCGCAGC

LJS1S2-1L-U3F AGGCCGCAGCAACGATACCGgttttagagctagaaatagcaagtta

LJS1S2-1L-U3R CGGTATCGTTGCTGCGGCCTgccacggatcatctgcacaactc

step 3, also includes plant expression vectorpLJS1S2-1::LJS1S2-1The method comprises the following specific steps:

firstly, by using a step-by-step methodLJS1S2-1Promoter (A)LJS1S2-1Promoter sequence obtained as above) linked to the fusion FLAG tag engineered in this laboratorypCAMBIA1300On the carrier backbone (LJS 1S2-1-proF and LJS1S 2-1-proR) to obtainpCAMBIA1300-pLJS1S2-1Then will beLJS1S2-1full-Length cDNA was cloned using BamHI/SalIpCAMBIA1300- pLJS1S2-1Plant expression vectors were obtained in the above (LJS 1S2-1-OE-F and LJS1S 2-1-OE-R)pLJS1S2-1::LJS1S2-1And transferring to Nipponbare. The primers used were as follows:

LJS1S2-1-OE-F CGGGATCCATGGCGCGGCCGCAGCA

LJS1S2-1-OE-R GCGTCGACGCAGGAGATCTCCATGGAGAAGT

LJS1S2-1-proF CTATGACATGATTACgaattcTGGTTGGCTTGGCTGTGAT

LJS1S2-1-proR CCGCTGCGTGGGGTTggtaccTGCCGACGTCCTCGAGCTCG

and 4, genetically constructing 20 lines of each rooted transgenic plant, transplanting the transgenic plant into a greenhouse, extracting DNA (deoxyribonucleic acid) from the CRISPR transgenic plant of LJS1S2-1 by adopting leaves, and amplifying and editing fragments to identify a homozygous single plant (LJS 1S2-1-genome F and LJS1S2-1-genome R). The pLJS1S2-1 is characterized in that LJS1S2-1 transgenosis plants are extracted by taking leaves, and expression quantity identification is carried out by using western blot. The primers used were as follows:

LJS1S2-1-genomeF GCTCATGGGTCTCCGAGAT

LJS1S2-1-genomeR GAGCTCTGGTCCACGTACTGCTCCT

LJS1S2-1L-genomeF TCGGCGAAGTGCTCGATCA

LJS1S2-1L-genomeR CGAACGTGCCCAGCCATAT

(VI)LJS4-2The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS4-2-F CGGGATCCATGTGTGGCGGCGCGATCATTT

LJS4-2-R GCGTCGACCATCGGCACGGCCGTGTGGAT

step 2. the cell wall related GO term gene set of the S4 stage specific expression differential gene is analyzed as above to obtainLJS4-2。Finally, obtainLJS4-2Expression level in leaf pillows in five stages. Discovery of genesLJS4-2Specific expression in leaf pillow development S4 (FIG. 1 f)

Gene in step 3.1LJS4-2The template is a U3 carrier, and the primers are as follows:

LJS4-2-U3F ACGGCCGCCGCCTGATGCCAgttttagagctagaaatagcaagtta

LJS4-2-U3R TGGCATCAGGCGGCGGCCGTgccacggatcatctgcacaactc

the primers used in step 4 are:

LJS4-2-genomeF CAGAGGAGCCGACCAAGAAG

LJS4-2-genomeR GGCGTCGTAGTCCATGAACT

(seven)LJS5-2Gene and homologous gene thereofLJS5-2LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS5-2-F CGGGATCCATGGTGCGGGGGAGGACGGA

LJS5-2-R GCGTCGACACCTGTCTCCGACCGGTTGGA

LJS5-2L-F CGGGATCCATGGTGCGGGGGAAGACGCAGA

LJS5-2L-R GCGTCGACAGAATGGGGCATCGCTTGGCTA

step 2. the differential gene set M05 specifically expressed in S5 was analyzed as described above to obtainLJS5-2AndLJS5-2L。in the end of this process,LJS5-2expression level in leaf pillows in five stages. Discovery of genesLJS5-2It is specifically expressed in S5 stage of leaf occipital development (FIG. 1 g).

Gene in step 3.1LJS5-2The template adopted by the gene is a U6 vector,LJS5-2Lthe gene adopts a template U3 vector, and the primers are as follows:

LJS5-2-U6F GGATTGAGAACCCGACGAGCgttttagagctagaaatagcaagtta

LJS5-2-U6R GCTCGTCGGGTTCTCAATCCAACCTGAGCCTCAGCGCAGC

LJS5-2L-U3F ATTCGTAGAGCTTGCCGCGCgttttagagctagaaatagcaagtta

LJS5-2L-U3R GCGCGGCAAGCTCTACGAATgccacggatcatctgcacaactc

the primers used in step 4 are:

LJS5-2-genomeF CCTCGTCTCGTCTCGTCTCT

LJS5-2-genomeR TGCTTTATAGCGGTCGATGGT

LJS5-2L-genomeF CGTGTGGTTGGTTGGTTCA

LJS5-2L-genomeR CTGATGCTAATGAGGCTTCTCT。

as referred to in (a) aboveLJS1-1Gene and homologous gene thereofLJS1-1LThe test methods of (2) to (seventy) correlating the genesThe results of the application tests are shown in figures 1 to 6.

Test results and conclusions

1. From FIG. 1a, it can be seen thatLJS1-1Specific expression in early development stage of leaf pillow; from FIG. 1b it can be seen thatLJS4-1Specific expression in S4 stage of leaf pillow development; from FIG. 1c it can be seen thatLJS3-1And homologous genes thereofLJS3-1LSpecific expression in S3 and S4 phases of leaf pillow development respectively; from FIG. 1d, it can be seen thatLJS5-1Specific expression in late development of leaf pillow; from FIG. 1e, it can be seen thatLJS1S2-1Specific expression in early development stage of leaf pillow; from FIG. 1f, it can be seen thatLJS4-2Specific expression in S4 stage of leaf pillow development; from FIG. 1g, it can be seen thatLJS5-2And homologous genes thereofLJS5-2LIs specifically expressed in S4 and S5 stages of leaf pillow development.

2. From fig. 2a, it can be seen that after successful knockout, the included angle of the homozygous mutant plant at the seedling stage becomes smaller, the plant type at the heading stage is upright, and the leaf included angle of the homozygous mutant plant at the seedling stage is significantly reduced compared with the wild type (nipponica); as can be seen from FIG. 2b, after successful knockout, the included angle of the homozygous mutant plant at the heading stage becomes smaller, and the plant type is upright; as can be seen from FIG. 2c, after successful knockout, the included angle of the homozygous mutant plant at the heading stage becomes smaller, and the plant type is upright; it can be seen from FIG. 2d that the included angle of the homozygous mutant plant becomes smaller after successful knockout; it can be seen from FIG. 2e that after successful knockout, the leaf angle of the homozygous mutant plant is smaller than that of the wild type (Nipponbare); as can be seen from FIG. 2f, after successful knockout, the included angle of the homozygous mutant plant at heading stage becomes smaller, and the plant type is upright; as can be seen from FIG. 2g, after successful knockout, the included angle of the homozygous mutant plant becomes smaller and the plant type is upright.

3. As can be seen from FIG. 3a, after successful knockout, the leaf occipital structure of homozygous mutant plant at the seedling stage changes, and the number of leaf occipital cell layers is increased compared with that of wild type (Nipponbare); as can be seen from FIG. 3b, after successful knockout, accumulation of the lignin in the sclerenchyma tissue of the folium xipholi of the homozygous mutant plant at heading stage is increased compared with that of the wild type (Nipponbare), and the mechanical strength is increased; from FIG. 3c, it can be seen that after successful knockout, accumulation of sclerenchyma lignin of the folium xipholi of homozygous mutant plants at heading stage is increased compared with wild type (Nipponbare), and mechanical strength of the folium xipholi is increased; from FIG. 3d, it can be seen that after successful knockout, the leaf occipital structure of homozygous mutant plant at seedling stage is changed, and the leaf occipital paraxial surface parenchyma cell is smaller than that of wild type (Nipponbare); from FIG. 3e, it can be seen that after successful knockout, the leaf-pillow structure of homozygous mutant plant at seedling stage changes, and abaxial sclerenchyma cells are increased compared with wild type (Nipponbare); as can be seen from FIG. 3f, after successful knockout, accumulation of the lignin in the sclerenchyma tissue of the folium xipholi of the homozygous mutant plant at heading stage is increased compared with that of the wild type (Nipponbare), and the mechanical strength is increased; it can be seen from FIG. 3g that after successful knockout, the paraxial parenchyma cells of the leaf pillows of the homozygous mutant plants are smaller than those of the wild type (Nipponbare).

4. From FIG. 4a, it can be seen that qRT-PCR detects that the target gene LJS4-1 promoting and inhibiting lignin accumulation is atLJS4-1-criThe change of expression amount in the transgenic line indicatesLJS4-1Expression in leaf pillow development S4, associated with lignin accumulation in leaf pillow sclerenchyma; from FIG. 4b, it can be seen that qRT-PCR detects the target gene promoting and inhibiting lignin accumulation inLJS3-1And homologous genes thereofLJS3-1LThe expression amount of the CRISPR transgenic line is changed, which shows thatLJS3-1And homologous genes thereofLJS3-1LExpression of S3 and S4 in leaf pillow development, correlated with lignin accumulation in leaf pillow sclerenchyma; from FIG. 4c, it can be seen that the cell cycle-associated genes were detected by qRT-PCRLJS1S2-1-cri/LJS1S2-1L-criAnalysis of expression level in transgenic lines revealed thatLJS1S2-1Expression in early development of leaf occipital, associated with proliferation of leaf occipital cells; from FIG. 4d, it can be seen that qRT-PCR detects that the target gene of LJS4-2 promoting and inhibiting lignin accumulation is inLJS4-2-criThe change of expression amount in the transgenic line indicatesLJS4-2Expression in leaf pillow development S4 correlated with lignin accumulation in leaf pillow sclerenchyma.

5. From fig. 5 it can be seen thatLJS1S2-1The promoter and the full-length CDS are cloned on pCAMBIA1300 and transferred into Nipponbare, and the leaf angle of the obtained transgenic line is larger than that of the wild type (Nipponbare), which indicates thatLJS1S2-1Has the function of controlling the development of the leaf pillow of the rice and the size of the leaf angle.

6. As can be seen from FIG. 6, after the target gene is successfully knocked out, the yield of rice is increased by increasing the fertile ear number per unit area under high density.

Sequence listing

<110> university of Henan

Application of rice gene LJS4-1 in controlling development of rice leaf pillow and leaf angle

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 981

<212> DNA

<213> Rice (Oryza sativa)

<400> 1

atgtgcggcg gtgcaatcct cgccgatttc accccggcga gggtgccccg gcggctgacc 60

gccgccgagc tcctgccggt gaccccgact ccccccgccg ccgagaggag aaccacccgg 120

aagcgcaagt ccgacgtcga cttcgaggcg gagttcgagc ttttcgagga cgacgacgac 180

gacgatgagt tcgagctttc cgacgatggc gacgagagtt tggccgtgtc atgtgtgtcg 240

tcccccaagt cgaaggcagt accttcgttt tctttttcgt cggatgtctc ctcgagctcc 300

aggccgcggc ggcgcgtggc ggcggcggcg gccggtcgtc ggaaggcgag caagaagagc 360

aagtacaggg gcgtccggcg ccggccgtcg gggaggttcg cggcggagat cagggacccc 420

aagaaggggc ggcgcgtgtg gctcggcacg tacggcagcg ccgaggaggc cgccatggcc 480

tacgaccgcg aggcccgccg catccgcggc aagggcgcga ggctcaactt cccccgcgac 540

ggcgatggct cccctcgccg gagtaacgac cggccctgct ggaccatcga cctcaacctc 600

cccgcggcgg ccgtctccgg tgacgacgac gacgccatgg ccgtcgacgc cgcagacgca 660

gacgcaggca gtgctggccg tgcagcagcc tatgcagatc aagaagcact gagcgcggca 720

aagtgcaaga tcaagcagtg tcctcgcgac gaacagatgg cgagcgccac acctgagctc 780

atggaggagg acgcgagcag cagcagaaac atggtgcccc tgtccatggc gctgcagctg 840

cagtatgcgg cgatgatcgc cgaatgcgac cgcgagatgg aggagatcgc cgccgtggag 900

agggacctcg agaggcgcag gaggcaggtg ttcgagcgca gaggccacct ggtcaggcag 960

gcctctcttc tgctcgactg a 981

<210> 2

<211> 326

<212> PRT

<213> Rice (Oryza sativa)

<400> 2

Met Cys Gly Gly Ala Ile Leu Ala Asp Phe Thr Pro Ala Arg Val Pro

1 5 10 15

Arg Arg Leu Thr Ala Ala Glu Leu Leu Pro Val Thr Pro Thr Pro Pro

20 25 30

Ala Ala Glu Arg Arg Thr Thr Arg Lys Arg Lys Ser Asp Val Asp Phe

35 40 45

Glu Ala Glu Phe Glu Leu Phe Glu Asp Asp Asp Asp Asp Asp Glu Phe

50 55 60

Glu Leu Ser Asp Asp Gly Asp Glu Ser Leu Ala Val Ser Cys Val Ser

65 70 75 80

Ser Pro Lys Ser Lys Ala Val Pro Ser Phe Ser Phe Ser Ser Asp Val

85 90 95

Ser Ser Ser Ser Arg Pro Arg Arg Arg Val Ala Ala Ala Ala Ala Gly

100 105 110

Arg Arg Lys Ala Ser Lys Lys Ser Lys Tyr Arg Gly Val Arg Arg Arg

115 120 125

Pro Ser Gly Arg Phe Ala Ala Glu Ile Arg Asp Pro Lys Lys Gly Arg

130 135 140

Arg Val Trp Leu Gly Thr Tyr Gly Ser Ala Glu Glu Ala Ala Met Ala

145 150 155 160

Tyr Asp Arg Glu Ala Arg Arg Ile Arg Gly Lys Gly Ala Arg Leu Asn

165 170 175

Phe Pro Arg Asp Gly Asp Gly Ser Pro Arg Arg Ser Asn Asp Arg Pro

180 185 190

Cys Trp Thr Ile Asp Leu Asn Leu Pro Ala Ala Ala Val Ser Gly Asp

195 200 205

Asp Asp Asp Ala Met Ala Val Asp Ala Ala Asp Ala Asp Ala Gly Ser

210 215 220

Ala Gly Arg Ala Ala Ala Tyr Ala Asp Gln Glu Ala Leu Ser Ala Ala

225 230 235 240

Lys Cys Lys Ile Lys Gln Cys Pro Arg Asp Glu Gln Met Ala Ser Ala

245 250 255

Thr Pro Glu Leu Met Glu Glu Asp Ala Ser Ser Ser Arg Asn Met Val

260 265 270

Pro Leu Ser Met Ala Leu Gln Leu Gln Tyr Ala Ala Met Ile Ala Glu

275 280 285

Cys Asp Arg Glu Met Glu Glu Ile Ala Ala Val Glu Arg Asp Leu Glu

290 295 300

Arg Arg Arg Arg Gln Val Phe Glu Arg Arg Gly His Leu Val Arg Gln

305 310 315 320

Ala Ser Leu Leu Leu Asp

325

Claims (5)

1. The application of the rice gene or the coding protein thereof in the improvement of gramineous crops is characterized in that the rice gene isLJS4-1。

2. The use of claim 1, wherein the rice gene is used for improving the plant type and increasing the yield of rice.

3. The use of claim 1, wherein the rice gene is used for regulating leaf bolster development and leaf angle.

4. Use according to any one of claims 1 to 3, wherein the rice gene is a rice geneLJS4-1The nucleotide sequence of (A) is shown as SEQ ID NO.1, the rice geneLJS4-1The amino acid sequence of the coded protein is shown as SEQ ID NO. 2.

5. The use of claim 3, wherein the rice gene or the encoded protein thereof is used for controlling the leaf angle by controlling the lignin accumulation and mechanical strength of the sclerenchyma tissue of the leaf occipital.

Images