CN111793681B

CN111793681B - HLA-B locus allele typing kit and detection method thereof

Info

Publication number: CN111793681B
Application number: CN202010758304.XA
Authority: CN
Inventors: 何军; 邱桥成
Original assignee: First Affiliated Hospital of Suzhou University
Current assignee: First Affiliated Hospital of Suzhou University
Priority date: 2020-07-31
Filing date: 2020-07-31
Publication date: 2023-08-25
Anticipated expiration: 2040-07-31
Also published as: AU2021205090A1; CN111793681A

Abstract

The invention discloses an HLA-B locus allelic genotyping kit and a detection method thereof, wherein the kit comprises amplification primers for amplifying 2,3,4 exons covering the HLA-B locus, and specific sequencing primers respectively aiming at the 2,3,4 exons. The detection method comprises the steps of amplifying a DNA sample by using an amplification primer, then respectively sequencing 2,3,4 exons in an amplified product by using sequencing primers aiming at 2,3,4 exons of an HLA-B locus, and comparing the obtained sequencing result with a database to obtain the HLA-B locus allelic type. According to the method, amplification primers can be used for directly amplifying HLA-B loci and sequencing primers are used for sequencing 2,3 and 4 exons, so that various allelic types on the B loci are obtained, interference of HLA-A and C locus gene sequences with extremely high homology is avoided, and accuracy of typing results is improved.

Description

HLA-B locus allele typing kit and detection method thereof

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to an HLA-B locus allele typing kit and a detection method thereof.

Background

Human Leukocyte Antigens (HLA) are produced by encoding genes located on the short arm of human chromosome 6, classical HLA-class I molecules include A, B, C sites, HLA-class II molecules include DR, DQ, DP sites, genes on each site of HLA are inherited in a haploid form, and HLA-B sites are the most complex sites for which allelic polymorphism has been found so far. The WHO reported 7255 HLA-B site alleles, 485B site alleles for chinese demographics, with 54 common alleles.

In addition to playing an important role in allogeneic hematopoietic stem cell transplantation and organ transplantation, HLA-B sites are closely related to hereditary diseases, pathogenesis and disease progression, toxicity or adverse reaction of drugs, reproductive health, infertility and the like. In particular, HLA-B locus allelic typing is more accurate in diagnosis and prognosis of diseases than traditional serotypes. The clinical application field is: clinical value of HLA-B27 allele typing in predicting and diagnosing ankylosing spondylitis; clinical value in predicting adverse drug reactions of patients, such as antiepileptic drug detection B.15:02 gene, antiviral drug Abacavir detection B.57:01 gene, anti-gout drug uric acid lowering allopurinol detection B.58:01 gene and the like; and HLA has a correlation with immune infertility and habitual abortion. Therefore, the kit for accurately carrying out HLA-B locus allele typing by applying the gene sequencing method has very important clinical application prospect and has diagnostic and therapeutic values for diseases.

The gene sequencing (sequence basis test, SBT) technology is a 'gold standard' of HLA genotyping, and the HLA-B locus allelic typing method is carried out by adopting the SBT technology, and full-length sequencing is carried out on the 2 nd, 3 rd and 4 th exons with T cell important antigen presenting function on the B locus, so that not only can 2 alleles on the HLA-B locus of a patient be accurately sequenced, but also the expression of serotypes, allelic homozygotes or heterozygotes can be determined, and the HLA haplotypes of pathogenic genes can be further analyzed. The method has the advantages of high accuracy, high specificity, high precision, small sample size, large-scale detection, short reporting time and the like.

Disclosure of Invention

The invention aims to provide an HLA-B locus allelic typing kit and a detection method for HLA-B locus allelic typing by using the kit, and by designing primer sequences which cover the characteristics of various allelic genotypes of HLA-B loci, further designing primer sequences for 2,3, 4-th exon sequencing reaction of the HLA-B loci, and simultaneously establishing and optimizing an experimental reaction system and conditions for HLA-B locus allelic typing detection.

In order to achieve the above object, the present invention provides the following technical solutions:

an HLA-B site allelic typing kit comprises an amplification primer for amplifying a 2,3,4 exon region covering the HLA-B site, and a specific sequencing primer for the 2,3,4 exon regions respectively;

the nucleotide sequence of the amplification primer is as follows:

the upstream primer BF: TCTCAGGGTCTCAGGGTCCG, as shown in SEQ ID NO. 1;

downstream primer BR: CAGCCAGGCCAGCAACAATG, as shown in SEQ ID NO. 2;

sequencing primers for exon 2 are as follows:

upstream primer B2F: CCCAGGCTCCCACTCCAT, as shown in SEQ ID NO. 3;

downstream primer B2R: GGGGAGTCGTGACCTGC, as shown in SEQ ID NO. 4;

sequencing primers for exon 3 are as follows:

upstream primer B3F: GGCCAGGGTCTCACA, as shown in SEQ ID NO. 5;

downstream primer B3R: GGCGACATTCTAGCGC, as shown in SEQ ID NO. 6;

sequencing primers for exon 4 are described below:

upstream primer B4F: AGATGCAAAGCGCCTGAA, as shown in SEQ ID NO. 7;

downstream primer B4R: GGCTCCTGCTTTCCCTGA as shown in SEQ ID NO. 8.

Further, an amplification system covering the 2,3,4 exon regions of HLA-B site comprises: an upstream primer BF, a downstream primer BR, 10X buffer, dNTP, taq enzyme and a DNA sample.

Further, the sequencing system for the 2,3,4 exon regions includes: PCR amplification products, B2F/B2R, B3F/B3R, B4F/B4R sequencing primers and Bigdyne.

The detection method for HLA-B locus allelic typing by using the kit comprises the following steps:

(1) Extracting DNA;

(2) Amplifying the DNA sample extracted in the step (1) by using the amplification sequences shown in SEQ ID NO.1 and SEQ ID NO.2 to obtain a DNA sequence covering the 2,3 and 4 exon areas of the HLA-B locus;

(3) Electrophoresis is carried out on the PCR product amplified in the step (2) by agarose gel, a target strip is separated according to the size and the position of the target strip, and sequencing reactions are respectively carried out after the target strip is added into the shrimp alkaline enzyme for digestion;

(4) Sequencing the digested PCR product in the step (3) by using sequencing primers shown in SEQ ID NO. 3-8 to sequence exons 2,3 and 4 respectively to obtain a sequencing product;

(5) Purifying and denaturing the sequencing product obtained in the step (4), and then sequencing the purified and denatured sequencing product on a sequencer; and comparing the sequenced sequence with an HLA-IMGT database and analyzing to obtain the HLA-B locus allelic type.

Further, the amplification conditions of step (2): 95 ℃ for 5min;95 ℃ 30s, 63 ℃ 25 s and 72 ℃ 2min 30s, and 40 cycles total; 72 ℃ for 5min; ending at 10 ℃.

Further, the sequencing conditions of step (4): 96℃for 20min, 50℃for 30s,60℃for 1min for 45s, 25 cycles in total.

The beneficial effects are that: the invention provides an HLA-B locus allelic typing kit and a detection method thereof, wherein the kit is prepared for the first time based on a gene sequencing method, and comprises amplification primers for covering HLA-B loci and sequencing primers for 2 nd, 3 rd and 4 th exons, so that various allelic types of the HLA-B loci can be directly analyzed, interference of HLA-A and C locus gene sequences with extremely high homology is avoided, and the accuracy of typing results is improved. Drawings

FIG. 1 is an electrophoretogram of products of DNA amplification reaction of HLA-B sites.

FIG. 2 is an HLA-B site exon 2 sequencing map showing B site allele-typing results: HLA-B15:01, B51:01, arrows indicate the 2 nd exon region within the black bar.

FIG. 3 is an HLA-B site exon 3 sequencing map showing B site allele-typing results: HLA-B46:01, arrows indicate the 3 rd exon region within the black bar.

FIG. 4 is an HLA-B site exon 4 sequencing map showing B site allele-typing results: HLA-B46:01, B51:01, arrows indicate the 4 th exon region within the black bar.

Fig. 5 is a schematic diagram of the WHO's HLA naming principle.

Detailed Description

The invention is further described below in connection with specific embodiments, which are exemplary only and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.

Example 1

An HLA-B site allele typing kit comprising amplification primers for amplifying the 2,3,4 th exon region covering the HLA-B site, and specific sequencing primers respectively aiming at the 2,3,4 th exon region;

the nucleotide sequence of the amplification primer is as follows:

the upstream primer BF: TCTCAGGGTCTCAGGGTCCG, as shown in SEQ ID NO. 1;

downstream primer BR: CAGCCAGGCCAGCAACAATG, as shown in SEQ ID NO. 2;

sequencing primers for exon 2 are as follows:

upstream primer B2F: CCCAGGCTCCCACTCCAT, as shown in SEQ ID NO. 3;

downstream primer B2R: GGGGAGTCGTGACCTGC, as shown in SEQ ID NO. 4;

sequencing primers for exon 3 are as follows:

upstream primer B3F: GGCCAGGGTCTCACA, as shown in SEQ ID NO. 5;

downstream primer B3R: GGCGACATTCTAGCGC, as shown in SEQ ID NO. 6;

sequencing primers for exon 4 are described below:

upstream primer B4F: AGATGCAAAGCGCCTGAA, as shown in SEQ ID NO. 7;

downstream primer B4R: GGCTCCTGCTTTCCCTGA as shown in SEQ ID NO. 8.

The amplification system of the kit covering the 2,3,4 exon areas of the HLA-B locus comprises the following components: 10. Mu.M BF primer 0.6. Mu.L, 10. Mu.M BR primer 0.6. Mu.L, 10 Xbuffer 2. Mu. L, dNTP 0.4. Mu.L, hot start Taq enzyme 0.2. Mu. L, DNA 2. Mu. L, H ₂ O14.2. Mu.L, total volume 20. Mu.L;

the sequencing system of the kit aiming at the 2,3,4 exon areas comprises: forward and reverse sequencing primers for exon 2 (B2F/B2R), exon 3 (B3F/B3R), and exon 4 (B4F/B4R), respectively, were 10. Mu.M 0.7. Mu. L, bigdye 4. Mu. L, H ₂ O3.3. Mu.L, 2. Mu.L of product, total 10. Mu.L.

Example 2

(1) Extraction of DNA: DNA was extracted according to the instructions of the instrument and the kit, and the concentration of DNA was not less than 10 ng/. Mu.L.

(2) Amplifying the DNA sample extracted in the step (1) by using the amplification sequences shown in SEQ ID NO.1 and SEQ ID NO.2 to obtain a DNA sequence covering the 2,3 and 4 exon areas of the HLA-B locus; amplification was performed using a Perkin Elmer GeneAmp 9700 PCR amplification instrument, PCR reaction conditions: 95 ℃ for 5min;95 ℃ 30s, 63 ℃ 25 s and 72 ℃ 2min 30s, and 40 cycles total; 72℃for 5min and 10℃for forever.

(3) Electrophoresis: preparing agarose gel with concentration of 1.0-1.5%, adding PCR product and 1 Xgel sample buffer solution, mixing, and electrophoresis for 10-15 min to obtain electrophoresis chart shown in figure 1; and (3) imaging by an ultraviolet imager, judging the specificity of a target band by judging the result of image shooting, analyzing the specificity and brightness of a product by using a PCR amplification product of 2KB, and judging whether a nonspecific band or primer dimer exists.

(4) Product digestion: 2.5 mu L of the astaxanthin enzyme is added into 18 mu L of the product, and the mixture is placed in a PCR instrument, and the reaction conditions are as follows: 37℃for 20min, 80℃for 20min, and 10℃for forever.

(5) Sequencing the digested PCR product in the step (4) by using sequencing primers shown in SEQ ID NO. 3-8 to sequence exons 2,3 and 4 respectively to obtain a sequencing product; sequencing PCR reaction conditions: 96℃for 20min, 50℃for 30s,60℃for 1min for 45s, 25 cycles in total.

(6) And (3) purifying a product: adding 2 mu L of sodium acetate and EDTA into 10 mu L of the product, mixing, centrifuging, adding 25 mu L of absolute ethyl alcohol, uniformly mixing for 2min at 2000r/min in an oscillator, centrifuging for 12min at 2000g in a horizontal centrifuge, and reversely buckling a flighting plate after centrifuging; adding 45 mu L of 80% absolute ethyl alcohol, centrifuging for 5min by using a centrifuge at 2000g, and reversely buckling a flighting plate after centrifuging; hiDi 10. Mu.L was added and the mixture was denatured by PCR at 37℃for 2 min.

(7) Sequencing: sequencing plate number is programmed, sequencing is carried out by using an ABI 3730XL type sequencer, the sample injection amount is 5-8 mu L, the sample injection time is 10-20 seconds, and figures 2-4 are respectively the measured 2 nd, 3 rd and 4 th exons of HLA-B sites.

(8) And (3) data acquisition: reading the sequencing data, comparing the base sequence with HLA data, and analyzing the result to obtain HLA-B

Site allele type. Table 1 shows HLA-B site allele typing results for 100 unrelated individuals.

TABLE 1 HLA-B site genotyping (n=50)

The advantages and innovation points of the invention are as follows:

the allele of HLA-B site was increased with updating IMGT database, and found to be 7431 in HLA-B site published 6 in 2020, which has a protein function of 4739 (www

Intro. According to WHO's naming convention for HLA, functional alleles of the HLA-B locus need to be clearly distinguished, see schematic 5 showing HLA-a 02:101, i.e. functionally different alleles have to be distinguished.

1. The technical characteristics are as follows: the invention realizes the highest definition and highest resolution allele typing method for HLA-B locus,

compared with the conventional HLA high-resolution typing method, the method can clearly distinguish two alleles on two chromosomes inherited by parents by one detection, and overcomes the defect that the conventional high-resolution typing method can combine the ambiguities and cannot distinguish the alleles. The analysis and judgment of HLA-B locus allele typing results are realized by a base sequence comparison method, so that whether the obtained base sequence is consistent with a database sequence or wrong or not is determined, and whether unimodal, bimodal or kurtosis is high or low can be distinguished, and some new alleles are found. Therefore, the invention has the functions of intuitionistic, definitely and automatically comparing the analysis of the experimental result. See fig. 2,3, 4.

2. Clinical advantage: illustrating: HLA-B27 subtype common to Chinese population in autoimmune ankylosing spondylitis disease characterized by inflammatory lesions of the axial and sacral hip joints and their collateral tissues as HLA-B27:04 and HLA-B27:0, 6: b.27:04, b.27:05, b.27:07, b.27:27 are pathogenic genes, and b.27:06, b.27:09 are protective genes. Therefore, by using the kit and the detection method thereof, more than 4 thousand HLA-B locus alleles can be accurately distinguished, and the purposes of accurate and rapid disease diagnosis and large-scale detection are realized.

Sequence listing

<110> university of Suzhou affiliated first hospital

<120> HLA-B site allele typing kit and detection method thereof

<141> 2020-07-31

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 1

tctcagggtc tcagggtccg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 2

cagccaggcc agcaacaatg 20

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 3

cccaggctcc cactccat 18

<210> 4

<211> 17

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 4

ggggagtcgt gacctgc 17

<210> 5

<211> 15

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 5

ggccagggtc tcaca 15

<210> 6

<211> 16

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 6

ggcgacattc tagcgc 16

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 7

agatgcaaag cgcctgaa 18

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence (chemical Synthesis)

<400> 8

ggctcctgct ttccctga 18

Claims

1. An HLA-B locus allele typing kit, characterized in that: comprising amplification primers for amplifying the 2,3,4 exon regions covering the HLA-B site, and specific sequencing primers for the 2,3,4 exon regions, respectively;

the nucleotide sequence of the amplification primer is as follows:

the upstream primer BF: TCTCAGGGTCTCAGGGTCCG, as shown in SEQ ID NO. 1;

downstream primer BR: CAGCCAGGCCAGCAACAATG, as shown in SEQ ID NO. 2;

sequencing primers for exon 2 are as follows:

upstream primer B2F: CCCAGGCTCCCACTCCAT, as shown in SEQ ID NO. 3;

downstream primer B2R: GGGGAGTCGTGACCTGC, as shown in SEQ ID NO. 4;

sequencing primers for exon 3 are as follows:

upstream primer B3F: GGCCAGGGTCTCACA, as shown in SEQ ID NO. 5;

downstream primer B3R: GGCGACATTCTAGCGC, as shown in SEQ ID NO. 6;

sequencing primers for exon 4 are described below:

upstream primer B4F: AGATGCAAAGCGCCTGAA, as shown in SEQ ID NO. 7;

downstream primer B4R: GGCTCCTGCTTTCCCTGA as shown in SEQ ID NO. 8.

2. An HLA-B locus allele typing kit according to claim 1, wherein: the amplification system covering the 2,3,4 exon regions of HLA-B site comprises: an upstream primer BF, a downstream primer BR, 10X buffer, dNTP, taq enzyme and a DNA sample.

3. An HLA-B locus allele typing kit according to claim 1, wherein: the sequencing system for the 2,3,4 exon regions included: PCR amplification products, B2F/B2R, B3F/B3R, B4F/B4R sequencing primers and Bigdyne.