CN113186193A - HSCB mutant gene, primer, kit and method for detecting HSCB mutant gene, and application of HSCB mutant gene - Google Patents

Abstract

The invention relates to an HSCB mutant gene related to LIMD, a primer, a kit and a method for detecting the HSCB mutant gene and application thereof, wherein the mutant HSCB gene has one of the following mutations compared with a human genome reference sequence GRCh 37: the base with the physical position of No. 22 chromosome 29139904 is mutated from C to T, and the base with the physical position of No. 22 chromosome 29139916 is mutated from C to T; the cDNA sequence of the mutant HSCB gene has one of the following mutations compared with the sequence of SEQ ID NO. 1: c.271C > T, c.283C > T; the sequence of the mutant HSCB protein has one of the following mutations compared with the sequence of SEQ ID NO. 2: p.Gln91Ter, p.Gln95Ter. The invention provides important basis for early molecular screening and family genetic research of LIMD.

Description

HSCB mutant gene, primer, kit and method for detecting HSCB mutant gene, and application of HSCB mutant gene

Technical Field

The invention relates to disease-related mutant genes, in particular to HSCB mutant genes, primers, a kit and a method for detecting the HSCB mutant genes and application of the HSCB mutant genes.

Background

The incidence of mitochondrial disease is highest among all inherited metabolic diseases. Mitochondria are primarily responsible for oxidative phosphorylation to produce adenosine triphosphate. The pathogenesis of mitochondrial diseases involves two distinct genomes: nuclear genome and maternal inherited 16.6kb mitochondrial genome. Mitochondrial diseases can be caused by mutations in any of these genomes. Defects in nuclear dna (ndna) can lead to problems such as respiratory chain complex structure, translation, and mitochondrial dna (mtdna) repair defects. Of the mitochondrial diseases diagnosed in childhood, about 25% are due to mitochondrial DNA abnormalities, while the remaining 75% are due to nDNA defects. Severe neonatal or infant onset mitochondrial disease usually leads to death within one year of birth, and infant lethal mitochondrial disease (LIMD) accounts for about 8.5% of cases with childhood onset mitochondrial disease, but LIMD has a low molecular genetic diagnosis rate, and most LIMD cases are diagnosed by biochemical and genetic methods after death of the subject. Thus, when parents become pregnant again, such neonatal onset of severe mitochondrial disease may reoccur due to a diagnosis that is not timely. Although nearly thousands of nuclear genomic genes have been found to be involved in mitochondrial function, only a small proportion have been implicated in the development of LIMD, suggesting that there are new LIMD virulence genes to be exploited.

Disclosure of Invention

The invention aims to provide an HSCB mutant gene related to infantile lethal mitochondrial diseases, a primer, a kit and a method for detecting the HSCB mutant gene, and application of the HSCB mutant gene.

The purpose of the invention is realized by the following technical scheme:

a mutant HSCB gene or mutant HSCB protein, having at least one of the following mutations compared to the human genomic reference sequence GRCh 37:

the base with the physical position of No. 22 chromosome 29139904 is mutated from C to T, and the base with the physical position of No. 22 chromosome 29139916 is mutated from C to T;

the cDNA sequence of the mutant HSCB gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.271C>T、c.283C>T；

the sequence of the mutant HSCB protein has at least one of the following mutations compared with the sequence of SEQ ID NO. 2:

p.Gln91Ter (glutamine at position 91 is mutated to a stop codon), p.Gln95Ter (glutamine at position 95 is mutated to a stop codon).

The HSCB mitochondral IRON-SULFUR CLUSTER chaperone (HSCB) gene is located on chromosome 22q12.1 and contains 6 exons and encodes an HSCB protein of 235 amino acids with a molecular weight of about 26 kDa. HSCB acts as a common partner molecule for iron-sulfur cluster assembly in the mitochondria and cytoplasm. HSCB mediates the assembly of iron-sulfur clusters of SDHB, the iron-sulfur protein subunit of succinate dehydrogenase, involved in the formation of complex II of the mitochondrial electron transport chain. At present, the correlation between HSCB and diseases is not reported.

The gene of the wild-type HSCB gene in the Ensemble database (www.ensembl.org) is encoded as ENSG00000100209, and the gene is located on chromosome 22. The inventor utilizes genetic research screening in a large number of normal people and LIMD patient families to find that the genetic mutation of the HSCB gene can cause lethal mitochondrial diseases of infants. The invention provides a new pathogenic mutation site of a pathogenic gene and provides a new molecular biology basis for early molecular screening of the disease.

The first mutation and the second mutation are both positioned in a translation region, wherein the physical position of the first mutation is 29139904, and the base C is mutated into T; RNA level: the 271 th base of the cDNA sequence of the HSCB gene is mutated from C to T; protein level: the 91 st amino acid of the protein coded by the HSCB gene is mutated into a stop codon from glutamine.

The physical position of the second mutation is 29139916, the base is mutated from C to T, the RNA level: the 283 th base of the cDNA sequence of the HSCB gene is mutated from C to T; protein level: the 95 th amino acid of the protein coded by the HSCB gene is mutated into a stop codon from glutamine.

A method of detecting a mutant HSCB gene or mutant HSCB protein for non-diagnostic purposes, the method comprising detecting the presence or absence of a mutation site in the HSCB gene or HSCB protein;

the mutation site is at least one of the following:

chr22(GRCh37) g.29139904C > T, cDNA sequence generation c.271C > T, p.Gln91Ter (glutamine mutation at position 91 to stop codon);

chr22(GRCh37) g.29139916C > T, cDNA sequence generation c.283C > T, p.Gln95Ter (glutamine at 95 is mutated to stop codon).

In some embodiments, the purpose of the non-diagnostic diseases described in the present invention includes, but is not limited to, studying SNP distribution and polypeptidases for family evolution studies. Such applications will be understood by those skilled in the art.

Some individuals carry the mutant HSCB genes of the invention but do not suffer from LIMD, e.g., heterozygous genotypes with only one chromosome carrying the mutation. The detection of this portion of the population may not be relevant for any purpose of diagnosing the disease, since these individuals are not themselves diseased. But the results of their detection can be used as useful information, for example as important indicators for pre-natal examinations, to guide fertility, or for mutation carrier screening, or as a tool for SNP distribution and polymorphism studies or to follow gene mutations or family evolution. Such applications are also understood by those skilled in the art. Thus, the methods of detecting mutant HSCB genes or mutant HSCB proteins provided by the present invention involve detecting heterozygous mutations.

However, the method of detecting a mutant HSCB gene or a mutant HSCB protein provided by the present invention also includes detecting a homozygous mutation.

In a preferred embodiment of the present invention, the method for detecting mutant HSCB gene or mutant HSCB protein comprises a step of PCR amplification using at least one set of primers as follows:

HSCB _ E2F: GGTCCCTTCATAGGACTTACCA (SEQ ID NO:3) and

HSCB_E2R:GCATAACCACAAGGCTACTGC(SEQ ID NO:4)。

in a preferred embodiment of the present invention, the PCR reaction procedure using the primers for amplification comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

The method for detecting the mutant HSCB gene comprises the following steps:

(1) establishing a family clinical and genetic resource library of LIMD patients, collecting clinical information and blood samples of LIMD families, and extracting genome DNA;

(2) designing amplification and sequencing primers covering the whole exon sequences of the HSCB genes for sequencing;

(3) and comparing the sequencing results of the family samples of the normal person and the LIMD patient.

In one embodiment, the sequencing is a Sanger sequencing.

In another embodiment, the method for detecting a mutant HSCB gene described above can also be performed by a technique selected from the group consisting of:

electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.

In other embodiments, methods of detecting exon and exon/intron boundary mutations in the HSCB gene are also contemplated, comprising the steps of:

(1) extracting a DNA sample from a subject;

(2) sequencing the exome and all exon/intron boundary sequences of the DNA sample to obtain sequencing fragments;

(3) and comparing the sequencing fragment with a reference sequence to obtain the exon and exon/intron boundary mutation of the gene.

A reagent for detecting a mutant HSCB gene, wherein the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant HSCB gene; the mutant HSCB gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 22 chromosome 29139904 is mutated from C to T, and the base with the physical position of No. 22 chromosome 29139916 is mutated from C to T;

the cDNA sequence of the mutant HSCB gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.271C>T、c.283C>T；

the region of the nucleic acid detection probe complementary to the mutant HSCB gene comprises a physical position or cDNA sequence position selected from at least one of:

physical positions 29139904 th, 29139916 th; the 271 th and 283 th positions of the cDNA sequence;

the primer is at least one group of primers with the following sequences:

HSCB _ E2F: GGTCCCTTCATAGGACTTACCA (SEQ ID NO:3) and

HSCB_E2R:GCATAACCACAAGGCTACTGC(SEQ ID NO:4)。

the nucleic acid detection probe is matched with the complementary region nucleic acid of the mutant HSCB gene so as to realize the detection of the mutant HSCB gene.

In other embodiments, the reagents for detecting a mutant HSCB gene further comprise buffers, enzymes, inorganic salts.

And (3) amplifying the template DNA by adopting a primer for detecting the mutant HSCB gene, and carrying out mutation identification on an amplification product by sequencing or gel electrophoresis.

A kit for detecting mutant HSCB genes comprises the reagent.

In other embodiments, the kit for detecting a mutant HSCB gene further comprises a buffer and instructions for use.

The application of a reagent for detecting mutant HSCB genes or mutant HSCB proteins in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the detection reagent for the fatal mitochondrial diseases of the infants is a reagent for a gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for a restriction enzyme digestion method or a reagent for sequencing.

The reagent for gene chip may be a probe for cDNA chip.

The DNA amplification reagent may be a primer or a probe.

The reagent for reverse transcription amplification can be a reverse transcription amplification primer and a reverse transcription amplification buffer solution.

The reagent for the restriction enzyme cutting method can be a primer containing a restriction enzyme site and a seamless cloning buffer solution.

The sequencing reagent may be a primer or a detection buffer.

The application of a reagent for detecting mutant HSCB genes in early molecular screening of lethal mitochondrial diseases of infants is a non-disease diagnosis purpose.

An application of a kit for detecting mutant HSCB genes in early molecular screening of lethal mitochondrial diseases of infants is disclosed, and the application is a non-disease diagnosis purpose.

Compared with the prior art, the invention has the advantages that:

the invention provides an HSCB mutant gene, a reagent, a primer, a kit and a method for detecting the HSCB mutant gene and application thereof, creatively digs a LIMD pathogenic gene HSCB, and provides an HSCB mutant gene locus, which provides important basis for early molecular screening, family genetic research and genetic consultation of the lethal mitochondrial disease of infants.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a family diagram;

FIG. 2 is a high throughput sequencing of HSCB mutant sequences.

FIG. 3 is a Sanger sequencing chart of the HSCB mutant sequences.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example performed whole exome high throughput sequencing assays for multiple families of patients with infantile fatal mitochondrial disease (LIMD), which included the following sequential steps:

(1) sample collection and extraction of genomic DNA.

Clinical data of family members and blood samples (EDTA anticoagulation) were collected, which were blood samples sent to forry medical laboratory ltd.

The Blood genomic DNA of each member of the family was extracted according to the instruction procedures of the Blood DNA extraction Kit (magenta, HiPure Blood & Tissue DNA Kit). The purity of the DNA was measured using Nanodrop one, OD260nm/OD280nm of the obtained genomic DNA were each between 1.7 and 2.0, and the concentration of the DNA was measured using Nanodrop one, the concentration of the obtained genomic DNA was 50 to 100 ng/. mu.L, and the total amount was 5 to 10. mu.g. Storing at-20 deg.C.

(2) Exome sequencing and bioinformatic analysis.

In order to find other pathogenic genes of LIMD, exome sequencing was used to screen 1 LIMD family for potential genetic variation (family map is shown in FIG. 1), and no pathological variation was found in the existing LIMD pathogenic gene test.

Exome sequencing was performed on the proband. Briefly, genomic DNA was fragmented, and subjected to enzyme digestion fragmentation, end repair, 3' -end addition of A, linker ligation and PCR amplification by using a Kit of KAPA company (KAPAHyperplus Library Preparation Kit); the exon regions were captured using a library construction kit (XGen outer Research Panel v2) from IGT. The library was sequenced on a Novaseq sequencer (Illumina, san diego, CA, usa) (sequencing depth 150X). NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remove Run Common Variants and Remove Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, ExAC, 1000g, ClinVar, OMIM, etc. Py was used to rank the annotated variants by High, Medium, Low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software.

After sequencing all exons of 1 LIMD family HSCB gene in the figure 1 and bioinformatics analysis, we find that a proband carries 2 compound heterozygous mutations, and BAM files of mutation sequencing results are shown in a figure 2, wherein the gene of the HSCB gene in an Ensemble database (www.ensembl.org) is coded as ENSG00000100209, the mutation HSCB p.Gln91Ter, and a base with the physical position of 29139904 is mutated from C to T; RNA level: the 271 th base of the HSCB gene coding RNA is mutated from C to T; protein level: the 91 st amino acid of the HSCB gene coding protein is mutated into a stop codon from glutamine; mutating HSCB p.Gln95Ter, wherein the base with the physical position of 29139916 is mutated from C to T; RNA level: the 283 th base of the RNA coded by the HSCB gene is mutated from C to T; protein level: the 95 th amino acid of the HSCB gene coding protein is mutated into a stop codon from glutamine; no other suspected site of mutation of the pathogenic gene was found.

The mutations p.Gln91Ter and p.Gln95Ter of the HSCB genes are not recorded in a normal population database such as gnomAD and the like, which leads to complete loss of the function of HSCB proteins of proband and seriously influences the physiological function of the HSCB proteins. According to the known biological function results, the clinical symptoms of proband LIMD are highly consistent.

According to the screening process designed by the inventor, by means of high-throughput deep sequencing and bioinformatics analysis, the HSCB gene is a new LIMD pathogenic gene, and the mutations p.Gln91Ter and p.Gln95Ter are new pathogenic sites of the disease.

(3) And (5) carrying out Sanger sequencing verification to identify the mutant gene.

Sanger sequencing was used to verify 2 mutations of the HSCB gene detected by exon sequencing: c.271C > T, c.283C > T (see FIG. 3). Primer 3 Primer design software is adopted to design Primer sequences SEQ ID NO. 3-SEQ ID NO.4, and the Primer sequences amplify genome DNA fragments containing HSCB gene mutation sites.

The PCR amplification system (20. mu.l) included: PCR 5 Xbuffer mix 10. mu.l, forward primer (10. mu. mol) 1. mu.l, reverse primer (10. mu. mol) 1. mu.l, ddH₂O6. mu.l, DNA 2. mu.l. PCR reaction procedure: at 95 deg.C for 5min, for 35 cycles (95 deg.C for 5min, 95 deg.C for 30s, 60 deg.C for 30s), at 72 deg.C for 10min, and at 4 deg.C. After PCR amplification is finished, 1% agarose gel electrophoresis is adopted for detection, PCR product gel is recovered by cutting gel, and products are recovered by Taq enzyme purification. All PCR products were sequenced with forward and reverse primers, respectively. The sequencing results are shown in FIG. 3.

In summary, the mutant HSCB genes identified in the present invention can be used for early clinical screening of LIMD patients, and the above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and variations can be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., Ltd

<120> HSCB mutant gene, primer, kit and method for detecting the same, and use thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 708

<212> DNA

<213> human (human)

<400> 1

atgtggcggg ggagagccgg ggctttgctc cgggtgtggg ggttttggcc gacaggggtt 60

cccagaagga gaccgctaag ctgcgatgct gcgtcgcagg cgggaagcaa ttatccccgc 120

tgttggaact gcggcggccc atggggcccc gggcgggagg acaggttctt ctgcccacag 180

tgccgagcgc tgcaggcacc tgaccccact cgagactact tcagccttat ggactgcaac 240

cgttccttca gagttgatac agcgaagctc cagcacaggt accagcaact gcagcgtctt 300

gtccacccag atttcttcag ccagaggtct cagactgaaa aggacttctc agagaagcat 360

tcgaccctgg tgaatgatgc ctataagacc ctcctggccc ccctgagcag aggactgtac 420

cttctaaagc tccatggaat agagattcct gaaaggacag attatgaaat ggacaggcaa 480

ttcctcatag aaataatgga aatcaatgaa aaactcgcag aagctgaaag tgaagctgcc 540

atgaaagaga ttgaatccat tgtcaaagct aaacagaaag aatttactga caatgtgagc 600

agtgcttttg aacaagatga ctttgaagaa gccaaggaaa ttttgacaaa gatgagatac 660

ttttcaaata tagaagaaaa gatcaagtta aagaagattc ccctttaa 708

<210> 2

<211> 235

<212> PRT

<213> human (human)

<400> 2

Met Trp Arg Gly Arg Ala Gly Ala Leu Leu Arg Val Trp Gly Phe Trp

1 5 10 15

Pro Thr Gly Val Pro Arg Arg Arg Pro Leu Ser Cys Asp Ala Ala Ser

20 25 30

Gln Ala Gly Ser Asn Tyr Pro Arg Cys Trp Asn Cys Gly Gly Pro Trp

35 40 45

Gly Pro Gly Arg Glu Asp Arg Phe Phe Cys Pro Gln Cys Arg Ala Leu

50 55 60

Gln Ala Pro Asp Pro Thr Arg Asp Tyr Phe Ser Leu Met Asp Cys Asn

65 70 75 80

Arg Ser Phe Arg Val Asp Thr Ala Lys Leu Gln His Arg Tyr Gln Gln

85 90 95

Leu Gln Arg Leu Val His Pro Asp Phe Phe Ser Gln Arg Ser Gln Thr

100 105 110

Glu Lys Asp Phe Ser Glu Lys His Ser Thr Leu Val Asn Asp Ala Tyr

115 120 125

Lys Thr Leu Leu Ala Pro Leu Ser Arg Gly Leu Tyr Leu Leu Lys Leu

130 135 140

His Gly Ile Glu Ile Pro Glu Arg Thr Asp Tyr Glu Met Asp Arg Gln

145 150 155 160

Phe Leu Ile Glu Ile Met Glu Ile Asn Glu Lys Leu Ala Glu Ala Glu

165 170 175

Ser Glu Ala Ala Met Lys Glu Ile Glu Ser Ile Val Lys Ala Lys Gln

180 185 190

Lys Glu Phe Thr Asp Asn Val Ser Ser Ala Phe Glu Gln Asp Asp Phe

195 200 205

Glu Glu Ala Lys Glu Ile Leu Thr Lys Met Arg Tyr Phe Ser Asn Ile

210 215 220

Glu Glu Lys Ile Lys Leu Lys Lys Ile Pro Leu

225 230 235

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtcccttca taggacttac ca 22

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcataaccac aaggctactg c 21

Claims (8)

1. A mutant HSCB gene or mutant HSCB protein, characterized in that: the mutant HSCB gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 22 chromosome 29139904 is mutated from C to T, and the base with the physical position of No. 22 chromosome 29139916 is mutated from C to T;

the cDNA sequence of the mutant HSCB gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.271C>T、c.283C>T；

the sequence of the mutant HSCB protein has at least one of the following mutations compared with the sequence of SEQ ID NO. 2:

p.Gln91Ter、p.Gln95Ter。

2. a method of detecting a mutant HSCB gene or mutant HSCB protein of claim 1 for non-diagnostic purposes, characterized in that: the method comprises the step of detecting whether a mutation site exists in the HSCB gene or the HSCB protein, wherein the mutation site is at least one of the following:

chr22(GRCh37) g.29139904C > T, cDNA sequence generation c.271C > T, p.Gln91Ter;

chr22(GRCh37) g.29139916C > T, cDNA sequence generation c.283C > T, p.Gln95Ter.

3. The method of claim 2, wherein: the method comprises the step of performing PCR amplification by using at least one set of primers as follows:

SEQ ID NO 3 and SEQ ID NO 4.

4. The method of claim 3, wherein: the PCR amplification reaction program comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

5. A reagent for detecting a mutant HSCB gene, which is characterized in that: the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant HSCB gene; the mutant HSCB gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 22 chromosome 29139904 is mutated from C to T, and the base with the physical position of No. 22 chromosome 29139916 is mutated from C to T;

the cDNA sequence of the mutant HSCB gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.271C>T、c.283C>T；

the region of the nucleic acid detection probe complementary to the mutant HSCB gene comprises a physical position or cDNA sequence position selected from at least one of:

physical positions 29139904 th, 29139916 th; the 271 th and 283 th positions of the cDNA sequence;

the primer is at least one group of primers with the following sequences:

SEQ ID NO 3 and SEQ ID NO 4.

6. A kit for detecting a mutant HSCB gene is characterized in that: comprising the reagent according to claim 5.

7. The application of a reagent for detecting mutant HSCB genes or mutant HSCB proteins in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the mutant HSCB gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 22 chromosome 29139904 is mutated from C to T, and the base with the physical position of No. 22 chromosome 29139916 is mutated from C to T;

the cDNA sequence of the mutant HSCB gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.271C>T、c.283C>T；

the sequence of the mutant HSCB protein has at least one of the following mutations compared with the sequence of SEQ ID NO. 2:

p.Gln91Ter、p.Gln95Ter。

8. the use of claim 7, wherein the reagent for detecting lethal mitochondrial disease in infants is a reagent for gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for restriction enzyme digestion or a reagent for sequencing.

Images