CN113201547A - CHCHD4 mutant gene, primer, kit and method for detecting same and application thereof - Google Patents

Abstract

The invention relates to a CHCHHD 4 mutant gene related to LIMD, a primer, a kit and a method for detecting the same and application thereof, wherein the mutant CHCHHD 4 gene has one of the following mutations compared with a human genome reference sequence GRCh 37: the base with the physical position of No.3 chromosome being 14158016 is mutated from G to A, and the base with the physical position of No.3 chromosome being 14154464 is mutated from T to A; the cDNA sequence of the mutant CHCHD4 gene has one of the following mutations compared to the sequence of SEQ ID No. 1: c.31C > T, c.352A > T; the sequence of the mutant chchchhd 4 protein has one of the following mutations compared to the sequence of SEQ ID No. 2: Arg11Ter, p.Lys118Ter. The invention provides important basis for early molecular screening and family genetic research of LIMD.

Description

CHCHD4 mutant gene, primer, kit and method for detecting same and application thereof

Technical Field

The invention relates to disease-related mutant genes, in particular to a CHCHD4 mutant gene, a primer, a kit and a method for detecting the same and application thereof.

Background

The incidence of mitochondrial disease is highest among all inherited metabolic diseases. Mitochondria are primarily responsible for oxidative phosphorylation to produce adenosine triphosphate. The pathogenesis of mitochondrial diseases involves two distinct genomes: nuclear genome and maternal inherited 16.6kb mitochondrial genome. Mitochondrial diseases can be caused by mutations in any of these genomes. Defects in nuclear dna (ndna) can lead to problems such as respiratory chain complex structure, translation, and mitochondrial dna (mtdna) repair defects. Of the mitochondrial diseases diagnosed in childhood, about 25% are due to mitochondrial DNA abnormalities, while the remaining 75% are due to nDNA defects. Severe neonatal or infant onset mitochondrial disease usually leads to death within one year of birth, and infant lethal mitochondrial disease (LIMD) accounts for about 8.5% of cases with childhood onset mitochondrial disease, but LIMD has a low molecular genetic diagnosis rate, and most LIMD cases are diagnosed by biochemical and genetic methods after death of the subject. Thus, when parents become pregnant again, such neonatal onset of severe mitochondrial disease may reoccur due to a diagnosis that is not timely. Although nearly thousands of nuclear genomic genes have been found to be involved in mitochondrial function, only a small proportion have been implicated in the development of LIMD, suggesting that there are new LIMD virulence genes to be exploited.

Disclosure of Invention

The invention aims to provide a CHCHHD 4 mutant gene related to infantile lethal mitochondrial diseases, a primer, a kit and a method for detecting the same and application thereof.

The purpose of the invention is realized by the following technical scheme:

a mutant CHCHCHD 4 gene or a mutant CHCHD4 protein, the mutant CHCHCHD 4 gene having at least one of the following mutations compared to a human genomic reference sequence GRCh 37:

the base with the physical position of No.3 chromosome being 14158016 is mutated from G to A, and the base with the physical position of No.3 chromosome being 14154464 is mutated from T to A;

the cDNA sequence of the mutant CHCHD4 gene has at least one of the following mutations compared with the sequence of SEQ ID No. 1:

c.31C>T、c.352A>T；

the sequence of the mutant CHCHHD 4 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

Arg11Ter (arginine at position 11 mutated to a stop codon), p.Lys118Ter (lysine at position 118 mutated to a stop codon).

A COILED-COIL-HELIX-COILED-COIL-HELIX DOMAIN-CONTAINING PROTEIN 4(COILED-COIL-HELIX-COILED-COIL-HELIX structural DOMAIN PROTEIN 4, CHCHD4) gene is located at the 3p25.1 position of the 3 # chromosome, contains 3 exons, and encodes CHCHCHD 4 PROTEIN with 142 amino acids and the molecular weight of about 15 KDa. Chchchhd 4 is a central component of the redox-sensitive protein entry into the mitochondrial membrane space (IMS) mechanism, and is a protein molecule essential for the biogenesis of respiratory chain complexes. CHCHHD 4 acts as a molecular chaperone, catalyzing the formation of dimercapto bonds of substrate proteins such as COX17, COX19, MICU1 and COA7, mediating the entry into the IMS and proper folding of these small cysteine proteins (small Tims). Plays a central role in the process of mitochondrial oxidative phosphorylation. At present, the correlation between CHCHHD 4 and diseases is not reported.

The gene of the wild-type CHCHHD 4 gene in the Ensemble database (www.ensembl.org) is encoded as ENSG00000163528, and the gene is located on chromosome 3. The inventor utilizes genetic research screening in a large number of normal people and LIMD patient families to find that the gene mutation of CHCHD4 gene can cause lethal mitochondrial diseases of infants. The invention provides a new pathogenic mutation site of a pathogenic gene and provides a new molecular biology basis for early molecular screening of the disease.

The first mutation and the second mutation are both positioned in a translation region, wherein the physical position of the first mutation is 14158016, and the base G is mutated into A; RNA level: the 31 st base of the cDNA sequence of the CHCHD4 gene is mutated from C to T; protein level: the 11 th amino acid of the protein coded by the CHCHD4 gene is mutated from arginine to a stop codon.

The second mutation was at the physical position of 14154464, base was mutated from T to a, RNA level: the 352 nd base of the cDNA sequence of the CHCHD4 gene is mutated from A to T; protein level: the 118 th amino acid of the protein coded by the CHCHD4 gene is mutated into a stop codon from lysine.

A method of detecting a mutant chchchhd 4 gene or a mutant chchchhd 4 protein for non-diagnostic purposes, the method comprising detecting the presence or absence of a mutation site in the chchhd 4 gene or chchhd 4 protein; the mutation site is at least one of the following:

chr3(GRCh37) g.14158016G > A, cDNA sequence generation c.31C > T, p.Arg11Ter (arginine at position 11 is mutated into a stop codon);

chr3(GRCh37) g.14154464T > A, cDNA sequence generation c.352A > T, p.Lys118Ter (lysine mutation at position 118 to stop codon).

In some embodiments, the purpose of the non-diagnostic diseases described in the present invention includes, but is not limited to, studying SNP distribution and polypeptidases for family evolution studies. Such applications will be understood by those skilled in the art.

Some individuals carry the mutant chchchhd 4 gene of the invention but do not suffer from LIMD, e.g., a heterozygous genotype with only one chromosome carrying the mutation. The detection of this portion of the population may not be relevant for any purpose of diagnosing the disease, since these individuals are not themselves diseased. But the results of their detection can be used as useful information, for example as important indicators for pre-natal examinations, to guide fertility, or for mutation carrier screening, or as a tool for SNP distribution and polymorphism studies or to follow gene mutations or family evolution. Such applications are also understood by those skilled in the art. Thus, the methods of detecting a mutant chchchhd 4 gene or a mutant chchchhd 4 protein provided by the present invention involve detecting heterozygous mutations.

However, the methods of the invention for detecting a mutant CHCHD4 gene or a mutant CHCHD4 protein also include detecting homozygous mutations.

In a preferred embodiment of the present invention, the method for detecting a mutant chchchhd 4 gene or a mutant chchchhd 4 protein comprises the step of performing PCR amplification using at least one set of primers:

CHCHHD 4-E2F: GTCACCTCACATAGGGATGGC (SEQ ID NO:3) and

CHCHD4_E2R:CTCCTCGTATGGATCGTTGGG(SEQ ID NO:4)；

CHCHHD 4_ E3F: GAAGCTCCTCACTAACCATCCAA (SEQ ID NO:5) and

CHCHD4_E3R:GTGTGGCAAAATTCAGGGCAATC(SEQ ID NO:6)。

in a preferred embodiment of the present invention, the PCR reaction procedure using the primers for amplification comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

The method for detecting the mutant CHCHHD 4 gene comprises the following steps:

(1) establishing a family clinical and genetic resource library of LIMD patients, collecting clinical information and blood samples of LIMD families, and extracting genome DNA;

(2) designing amplification and sequencing primers covering the whole exon sequence of the CHCHD4 gene for sequencing;

(3) and comparing the sequencing results of the family samples of the normal person and the LIMD patient.

In one embodiment, the sequencing is a Sanger sequencing.

In another embodiment, the method for detecting a mutant chchchhd 4 gene described above can be performed by a technique selected from the group consisting of:

electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.

In other embodiments, methods of detecting mutations at exon and exon/intron boundaries of the chchchhd 4 gene are also contemplated, comprising the steps of:

(1) extracting a DNA sample from a subject;

(2) sequencing the exome and all exon/intron boundary sequences of the DNA sample to obtain sequencing fragments;

(3) and comparing the sequencing fragment with a reference sequence to obtain the exon and exon/intron boundary mutation of the gene.

A reagent for detecting a mutant chchchhd 4 gene, the reagent being a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant CHCHD4 gene; the mutant chchchhd 4 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No.3 chromosome being 14158016 is mutated from G to A, and the base with the physical position of No.3 chromosome being 14154464 is mutated from T to A;

the cDNA sequence of the mutant CHCHD4 gene has at least one of the following mutations compared with the sequence of SEQ ID No. 1:

c.31C>T、c.352A>T；

the region of the nucleic acid detection probe complementary to the mutant chchchhd 4 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 14158016 th, 14154464 th; the 31 st and 352 nd cDNA sequences;

the primer is at least one group of primers with the following sequences:

CHCHHD 4-E2F: GTCACCTCACATAGGGATGGC (SEQ ID NO:3) and

CHCHD4_E2R:CTCCTCGTATGGATCGTTGGG(SEQ ID NO:4)；

CHCHHD 4_ E3F: GAAGCTCCTCACTAACCATCCAA (SEQ ID NO:5) and

CHCHD4_E3R:GTGTGGCAAAATTCAGGGCAATC(SEQ ID NO:6)。

the nucleic acid detection probe achieves detection of the mutant chchchhd 4 gene by nucleic acid pairing with the complementary region of the mutant chchhd 4 gene.

In other embodiments, the reagents for detecting the mutant chchchhd 4 gene further comprise a buffer, an enzyme, and an inorganic salt.

And (3) amplifying the template DNA by using a primer for detecting the mutant CHCHD4 gene, and carrying out mutation identification on an amplification product by sequencing or gel electrophoresis.

A kit for detecting a mutant CHCHHD 4 gene, comprising the reagent.

In other embodiments, the kit for detecting a mutant chchchhd 4 gene further comprises a buffer and instructions for use.

An application of a reagent for detecting a mutant CHCHD4 gene or a mutant CHCHD4 protein in preparing a detection reagent for fatal mitochondrial diseases of infants;

the detection reagent for the fatal mitochondrial diseases of the infants is a reagent for a gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for a restriction enzyme digestion method or a reagent for sequencing.

The reagent for gene chip may be a probe for cDNA chip.

The DNA amplification reagent may be a primer or a probe.

The reagent for reverse transcription amplification can be a reverse transcription amplification primer and a reverse transcription amplification buffer solution.

The reagent for the restriction enzyme cutting method can be a primer containing a restriction enzyme site and a seamless cloning buffer solution.

The sequencing reagent may be a primer or a detection buffer.

The application of a reagent for detecting a mutant CHCHD4 gene in early molecular screening of infant lethal mitochondrial diseases is a non-disease diagnosis purpose.

The application of a kit for detecting a mutant CHCHD4 gene in early molecular screening of infant lethal mitochondrial diseases is a non-disease diagnosis purpose.

Compared with the prior art, the invention has the advantages that:

the invention provides a CHCHHD 4 mutant gene, a reagent, a primer, a kit and a method for detecting the same and application thereof, creatively digs a LIMD pathogenic gene CHCHHD 4, and provides a CHCHHD 4 mutant gene locus, which provides important basis for early molecular screening, family genetic research and genetic consultation of infant lethal mitochondrial diseases.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a family diagram;

FIG. 2 is a high throughput sequencing graph of the CHCHD4 mutant sequence.

FIG. 3 is a Sanger sequencing chart of the CHCHD4 mutant sequence.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example performed whole exome high throughput sequencing assays for multiple families of patients with infantile fatal mitochondrial disease (LIMD), which included the following sequential steps:

(1) sample collection and extraction of genomic DNA.

Clinical data of family members and blood samples (EDTA anticoagulation) were collected, which were blood samples sent to forry medical laboratory ltd.

The Blood genomic DNA of each member of the family was extracted according to the instruction procedures of the Blood DNA extraction Kit (magenta, HiPure Blood & Tissue DNA Kit). The purity of the DNA was measured using Nanodrop one, OD260nm/OD280nm of the obtained genomic DNA were each between 1.7 and 2.0, and the concentration of the DNA was measured using Nanodrop one, the concentration of the obtained genomic DNA was 50 to 100 ng/. mu.L, and the total amount was 5 to 10. mu.g. Storing at-20 deg.C.

(2) Exome sequencing and bioinformatic analysis.

In order to find other pathogenic genes of LIMD, exome sequencing was used to screen 1 LIMD family for potential genetic variation (family map is shown in FIG. 1), and no pathological variation was found in the existing LIMD pathogenic gene test.

Exome sequencing was performed on the proband. Briefly, genomic DNA was fragmented, and subjected to enzymatic fragmentation, end repair, 3' -end addition of A, linker ligation, and PCR amplification by using a Kit of KAPA company (KAPA Hyperplus Library Preparation Kit); the exon regions were captured using a library construction kit (XGen outer Research Panel v2) from IGT. The library was sequenced on a Novaseq sequencer (Illumina, san diego, CA, usa) (sequencing depth 150X). NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remove Run Common Variants and Remove Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, ExAC, 1000g, ClinVar, OMIM, etc. Py was used to rank the annotated variants by High, Medium, Low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software.

After sequencing the whole exons of 1 LIMD family CHCHCHHD 4 gene in figure 1 and bioinformatics analysis, we find that proband carries 2 compound heterozygous mutations, and a BAM file of mutation sequencing results is shown in figure 2, wherein the gene code of the CHCHHD 4 gene in an Ensemble database (www.ensembl.org) is ENSG00000163528, wherein the mutation CHCHHD 4 p. Arg1Ter, and the base with the physical position of 14158016 is mutated from G to A; RNA level: the 31 st base of the CHCHHD 4 gene coding RNA is mutated from C to T; protein level: the 11 th amino acid of the protein coded by the CHCHD4 gene is mutated into a stop codon from arginine; mutating CHCHCHD 4 p.Lys118Ter, wherein a base with the physical position of 14154464 is mutated from T to A; RNA level: the 352 nd base of the CHCHHD 4 gene coding RNA is mutated from A to T; protein level: the 118 th amino acid of the CHCHD4 gene coding protein is mutated into a stop codon from lysine; no other suspected site of mutation of the pathogenic gene was found.

The mutation p.Arg1Ter and p.Lys118Ter of the CHCHCHD 4 gene are not recorded in a normal population database such as gnomaD and the like, which leads to complete loss of the function of the protein of the proband CHCHHD 4 and seriously influences the physiological function of the protein of CHCHHD 4. According to the known biological function results, the clinical symptoms of proband LIMD are highly consistent.

According to the screening process designed by us, by means of high-throughput deep sequencing and bioinformatics analysis, we successfully found that the gene CHCHD4 is a new virulence gene of LIMD, and the mutations p.Arg1Ter and p.Lys118Ter are new virulence sites of the disease.

(3) And (5) carrying out Sanger sequencing verification to identify the mutant gene.

Sanger sequencing was used to verify 2 mutations of chchchhd 4 gene detected by exon sequencing: c.31C > T and c.352A > T (see FIG. 3). Primer 3 Primer design software is adopted to design Primer sequences SEQ ID NO. 3-SEQ ID NO.6, and the Primer sequences amplify genome DNA fragments containing CHCHHD 4 gene mutation sites.

The PCR amplification system (20. mu.l) included: PCR 5 Xbuffer mix 10. mu.l, forward primer (10. mu. mol) 1. mu.l, reverse primer (10. mu. mol) corresponding to the forward primer 1. mu.l, ddH₂O6. mu.l, DNA 2. mu.l. PCR reaction procedure: at 95 deg.C for 5min, for 35 cycles (95 deg.C for 5min, 95 deg.C for 30s, 60 deg.C for 30s), at 72 deg.C for 10min, and at 4 deg.C. After PCR amplification is finished, 1% agarose gel electrophoresis is adopted for detection, PCR product gel is recovered by cutting gel, and products are recovered by Taq enzyme purification. All PCR products were sequenced with forward and reverse primers, respectively. The sequencing results are shown in FIG. 3.

In summary, the identified mutant CHCHCHD 4 gene of the present invention is useful for early clinical screening of LIMD patients, and the above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and variations of the present invention are possible to those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., Ltd

<120> CHCHCHD 4 mutant gene, primer, kit and method for detecting same, and use thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 429

<212> DNA

<213> human (human)

<400> 1

atgtcctatt gccggcagga agggaaggat cgaatcatat ttgtaaccaa agaagatcat 60

gaaactccaa gcagtgcaga attggtggct gatgacccca acgatccata cgaggagcat 120

ggattgatac tgccaaatgg aaacattaac tggaactgcc catgccttgg gggaatggcc 180

agcggtccct gtggagaaca gtttaagtca gccttttcct gcttccacta tagcacggag 240

gagatcaagg ggtcagactg tgtagaccag ttccgggcca tgcaggaatg catgcagaaa 300

tacccagacc tctatcccca agaggatgag gatgaggaag aggaaagaga gaagaagcca 360

gcagaacaag cagaagaaac agctcccatt gaggccactg caaccaaaga agaggaggga 420

tcaagttaa 429

<210> 2

<211> 142

<212> PRT

<213> human (human)

<400> 2

Met Ser Tyr Cys Arg Gln Glu Gly Lys Asp Arg Ile Ile Phe Val Thr

1 5 10 15

Lys Glu Asp His Glu Thr Pro Ser Ser Ala Glu Leu Val Ala Asp Asp

20 25 30

Pro Asn Asp Pro Tyr Glu Glu His Gly Leu Ile Leu Pro Asn Gly Asn

35 40 45

Ile Asn Trp Asn Cys Pro Cys Leu Gly Gly Met Ala Ser Gly Pro Cys

50 55 60

Gly Glu Gln Phe Lys Ser Ala Phe Ser Cys Phe His Tyr Ser Thr Glu

65 70 75 80

Glu Ile Lys Gly Ser Asp Cys Val Asp Gln Phe Arg Ala Met Gln Glu

85 90 95

Cys Met Gln Lys Tyr Pro Asp Leu Tyr Pro Gln Glu Asp Glu Asp Glu

100 105 110

Glu Glu Glu Arg Glu Lys Lys Pro Ala Glu Gln Ala Glu Glu Thr Ala

115 120 125

Pro Ile Glu Ala Thr Ala Thr Lys Glu Glu Glu Gly Ser Ser

130 135 140

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtcacctcac atagggatgg c 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctcctcgtat ggatcgttgg g 21

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaagctcctc actaaccatc caa 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gtgtggcaaa attcagggca atc 23

Claims (8)

1. A mutant CHCHCHD 4 gene or a mutant CHCHD4 protein, wherein: the mutant chchchhd 4 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No.3 chromosome being 14158016 is mutated from G to A, and the base with the physical position of No.3 chromosome being 14154464 is mutated from T to A;

the cDNA sequence of the mutant CHCHD4 gene has at least one of the following mutations compared with the sequence of SEQ ID No. 1:

c.31C>T、c.352A>T；

the sequence of the mutant CHCHHD 4 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

p.Arg11Ter、p.Lys118Ter。

2. a method of detecting a mutant chchchhd 4 gene or a mutant chchchhd 4 protein of claim 1 for a non-diagnostic purpose, characterized in that: the method comprises detecting the presence or absence of a mutation site in the chchchhd 4 gene or the chchhd 4 protein, the mutation site being at least one of:

chr3(GRCh37) g.14158016G > A, cDNA sequence occurrence c.31C > T, p.Arg11Ter;

chr3(GRCh37), g.14154464T > A, cDNA sequence generation c.352A > T, p.Lys118Ter.

3. The method of claim 2, wherein: the method comprises the step of performing PCR amplification by using at least one set of primers as follows:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

4. The method of claim 3, wherein: the PCR amplification reaction program comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

5. A reagent for detecting a mutant chchchhd 4 gene, comprising: the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant CHCHD4 gene; the mutant chchchhd 4 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No.3 chromosome being 14158016 is mutated from G to A, and the base with the physical position of No.3 chromosome being 14154464 is mutated from T to A;

the cDNA sequence of the mutant CHCHD4 gene has at least one of the following mutations compared with the sequence of SEQ ID No. 1:

c.31C>T、c.352A>T；

the region of the nucleic acid detection probe complementary to the mutant chchchhd 4 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 14158016 th, 14154464 th; the 31 st and 352 nd cDNA sequences;

the primer is at least one group of primers with the following sequences:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

6. A kit for detecting a mutant chchchhd 4 gene, comprising: comprising the reagent according to claim 5.

7. An application of a reagent for detecting a mutant CHCHD4 gene or a mutant CHCHD4 protein in preparing a detection reagent for fatal mitochondrial diseases of infants;

the mutant chchchhd 4 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No.3 chromosome being 14158016 is mutated from G to A, and the base with the physical position of No.3 chromosome being 14154464 is mutated from T to A;

the cDNA sequence of the mutant CHCHD4 gene has at least one of the following mutations compared with the sequence of SEQ ID No. 1:

c.31C>T、c.352A>T；

the sequence of the mutant CHCHHD 4 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

p.Arg11Ter、p.Lys118Ter。

8. the use of claim 7, wherein the reagent for detecting lethal mitochondrial disease in infants is a reagent for gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for restriction enzyme digestion or a reagent for sequencing.

Images