KR20210067530A - LATS1 Gene Mutation Marker Based Diagnosis of Amyotrophic Lateral Sclerosis - Google Patents

Abstract

The present invention relates to a method for diagnosing amyotrophic lateral sclerosis on the basis of a LATS1 gene mutation. The present invention provides an accurate and effective marker-based diagnosis method for diagnosing amyotrophic lateral sclerosis for which effective molecular diagnostic markers are insufficient. The marker of the present invention enables the diagnosis of amyotrophic lateral sclerosis even when none of the markers reported beforehand are observed, and suggests a novel diagnosis method for amyotrophic lateral sclerosis. The diagnosis method and the marker and a use thereof according to the present invention are very advantageous for diagnosis, prediction, treatment, and prevention of amyotrophic lateral sclerosis. Furthermore, the LATS1 gene of the present invention can be utilized in studying the pathological mechanism of amyotrophic lateral sclerosis and in developing a therapeutic drug for amyotrophic lateral sclerosis.

Description

LATS1 Gene Mutation Marker Based Diagnosis of Amyotrophic Lateral Sclerosis

It relates to a method for diagnosing amyotrophic lateral sclerosis based on LATS1 gene mutation, and more particularly, LATS1 mutant gene or LATS1 encoded by it. To a method and marker for diagnosing and predicting amyotrophic lateral sclerosis by detecting a mutated protein.

Amyotrophic lateral sclerosis (ALS), also called Lou Gehrig disease, is a disease in which only motor neurons are selectively killed. cells), the brain stem (brainstem), and the lower motor neurons of the spinal cord are all gradually destroyed. Clinical symptoms start with slowly progressive weakness and atrophy of the extremities, and as the disease progresses, it is a fatal disease that eventually leads to death within a few years of respiratory muscle paralysis. It is known that about 1 to 2 people per 100,000 people a year develop Lou Gehrig's disease.

The onset of ALS increases from the late 50s, and the incidence rate is 1.4 to 2.5 times higher in men than in women. Amyotrophic lateral sclerosis is a fatal disease with the fastest symptom progression among motor neuron diseases (MND), and is known to have an average lifespan of less than 4-5 years, and as the disease progresses, death from respiratory failure and other complications due to respiratory muscle paralysis. will do Although there is no medical treatment that can cure it yet, drug treatment to slow the progression of symptoms, prevention and management of other complications, etc., have a great influence on the patient's prognosis, so early diagnosis is the most important for prevention and treatment ( Seoul National University Hospital medical information).

Although the cause of ALS is not yet known, several hypotheses have been proposed so far. About 5-10% of all ALS patients are known to have familial muscular atrophic familial sclerosis, and of these, mutations in the causative gene on chromosome 21 are confirmed in about 20% of families. So far, eight genes have been reported to cause familial ALS. In addition, in sporadic ALS, which is not hereditary, apoptosis (apoptosis, apoptosis, a phenomenon in which cells die by themselves under gene control) is thought to play an important role in excitotoxicity. Other hypotheses that a special virus is the cause and the action of environmental toxins have been suggested as the cause of ALS, but there is no direct evidence yet (Medical Information of Seoul National University Hospital).

Tests for the diagnosis of amyotrophic lateral sclerosis include blood tests, electromyography, brain and spinal cord imaging tests, and in some cases, muscle biopsy and genetic tests are additionally performed. After diagnosis, progress status and prognosis are evaluated, and appropriate drug treatment and rehabilitation treatment are performed according to the stage of the disease. As genes that cause ALS, superoxide dismutase 1 (SOD1), transactive response DNA-binding protein (TARDBP), fused in sarcoma (FUS), chromosome 9 open reading frame 72 (C9orf72), etc. are well known. With the recent discovery of a new gene associated with the onset of amyotrophic lateral sclerosis, it has been found that this disease is related to frontotemporal dementia and various types of muscular and degenerative diseases. is recognized as

Still, most diagnoses are based primarily on clinical symptoms. However, the diagnosis based on clinical symptoms has a problem in that the treatment time is missed because the diagnosis can be made only at a later stage when the symptoms appear prominent. In addition, although the exact cause of amyotrophic lateral sclerosis is not known, and it has a complex onset and progression mechanism, it is related to various types of diseases. The types of markers are limited, and a lot of effort and investment are being made to develop various biomarkers.

Under this technical background, the present inventors made efforts to develop novel biomarkers for diagnosis and prediction of amyotrophic lateral sclerosis. As a result, in the ALS trio study conducted on patients and parents with amyotrophic lateral sclerosis, parents and normal people The LATS1 gene, which is a causative gene for amyotrophic lateral sclerosis, was discovered through a novel mutation analysis not found in the control group but found only in the progenitor, and the present invention was completed.

The information described in the background section is only for improving the understanding of the background of the present invention, and it does not include information forming prior art known to those of ordinary skill in the art to which the present invention pertains. may not be

It is an object of the present invention to provide a method for diagnosing and predicting amyotrophic lateral sclerosis based on novel biomarkers.

Another object of the present invention is to provide a LATS1 mutant gene as a novel biomarker.

Another object of the present invention is to provide a LATS1 mutant protein as a novel biomarker.

Another object of the present invention is to provide a composition for diagnosis of amyotrophic lateral sclerosis.

Another object of the present invention is to provide a kit for diagnosis of amyotrophic lateral sclerosis.

In order to achieve the above object,

In the isolated biological sample, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene or LATS1 encoded by the LATS1 mutant gene It provides an information providing method for the diagnosis of amyotrophic lateral sclerosis (ALS) comprising the step of detecting a mutated protein.

The present invention also provides a mutant LATS1 (Large tumor suppressor kinase 1) gene comprising at least one of SNV, Indel and CNV as a diagnostic marker for amyotrophic lateral sclerosis, and a mutant LATS1 protein encoded by the gene.

The present invention also provides a composition for diagnosis of amyotrophic lateral sclerosis comprising an agent capable of detecting a large tumor suppressor kinase 1 ( LATS1 ) mutant gene or a LATS1 mutant protein encoded by a mutant LATS1 gene.

The present invention also provides a kit for diagnosis of amyotrophic lateral sclerosis, comprising an agent capable of detecting a large tumor suppressor kinase 1 ( LATS1 ) mutant gene or a LATS1 mutant protein encoded by the LATS1 mutant gene.

The present invention provides an accurate and efficient marker-based diagnostic method for diagnosing amyotrophic lateral sclerosis that lacks effective molecular diagnostic markers. The marker of the present invention can diagnose amyotrophic lateral sclerosis even when a previously reported marker is not found, and suggests a new diagnostic method for amyotrophic lateral sclerosis. The diagnostic method, marker, and use thereof of the present invention are useful in the diagnosis, prediction, treatment and prevention of amyotrophic lateral sclerosis. Furthermore, the LATS1 gene of the present invention can be used to study the onset mechanism of amyotrophic lateral sclerosis and develop a drug for treatment.

1 is a graph showing the expression level of the LATS1 gene for each tissue.
Figure 2 is the result of performing exome sequencing of amyotrophic lateral sclerosis patients and parents. Mutations not present in normal parents were found in the LATS1 gene.
3 is a result of reconfirming the mutation of the LATS1 gene discovered in exome sequencing of amyotrophic lateral sclerosis patients and parents by Sanger sequencing method.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease that occurs in adults and is caused by progressive loss of motor nerves in the cerebral cortex, cerebellum, and spinal cord. About 10% of patients have familial ALS with a family history, and about 90% of patients develop sporadically without a family history. To date, mutations in several genes, including SOD1, TARDBP, FUS, and C9orf72, have been reported as the cause of ALS, but the genetic cause is unknown in 1/3 of familial ALS patients and about 90% of sporadic ALS patients. With the recent discovery of a new gene associated with the onset of amyotrophic lateral sclerosis, it has been found that this disease is related to frontotemporal dementia and various types of muscle diseases and degenerative diseases. There are problems in diagnosing or applying to treatment.

Amyotrophic lateral sclerosis is a disease that does not currently have an effective treatment method, and is rapidly invented and progressing with an average lifespan of less than 4-5 years. When diagnosed by clinical symptoms, treatment or improvement is almost impossible. Therefore, it is important to diagnose the disease at an early stage of onset through early diagnosis such as prenatal diagnosis.

Accordingly, the present inventors tried to identify a gene related to amyotrophic lateral sclerosis and the SNV of the gene for early diagnosis of amyotrophic lateral sclerosis. In an embodiment of the present invention, sequencing analysis was performed after extracting genomic DNA from a blood sample for patients with sporadic amyotrophic lateral sclerosis and their parents. As a result of screening for mutations in the previously reported ALS-FTD causative gene or related gene for the differential diagnosis of amyotrophic lateral sclerosis, HSP and other disease genes for the differential diagnosis of amyotrophic lateral sclerosis, No previously reported mutations were found.

In another embodiment of the present invention, one novel mutation was found in the analysis through Sanger sequencing of the patient and parent, which was the deletion of the 2790th base from the nucleotide sequence of the LATS1 gene, and the 930th amino acid leucine was substituted with phenylalanine and it was confirmed that it is a frameshift mutation in which synthesis ends at the 27th (956th). It was confirmed that the mutation was a novel mutation that was not found in dbSNP, 1000 Genome Project, gnomAD, and KRGDB, the normal control group Korean data, and that the mutation could be used as a new diagnostic marker for amyotrophic lateral sclerosis.

Accordingly, in one aspect, in an isolated biological sample, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene or LATS1 encoded by the LATS1 mutant gene It relates to an information providing method for the diagnosis of amyotrophic lateral sclerosis (ALS) comprising the step of detecting a mutated protein.

In another aspect, the present invention provides an isolated biological sample,LATS1(Large tumor suppressor kinase 1) mutant gene or the aboveLATS1LATS1 encoded by the mutant gene It relates to a diagnostic method of amyotrophic lateral sclerosis (ALS) comprising the step of detecting a mutated protein.

In the present invention, the LATS1 mutant gene or LATS1 encoded by the LATS1 mutant gene When the mutant protein is detected, it may be characterized in that amyotrophic lateral sclerosis is diagnosed.

"Amyotrophic lateral sclerosis" is largely classified into two types according to the cause, and is divided into a familial type and a sporadic type that occurs alone. Familial ALS accounts for about 10% of all cases, and mutations in one or more genes are the cause. About 15% of familial patients develop the disease due to a mutation in the SOD1 gene, and the disease can occur even if a defective gene is inherited from one parent in an autosomal dominant form. On the other hand, the cause of sporadic ALS has not been specifically identified. Heavy metals such as aluminum, mercury, and lead used in dental rods, which are environmental factors, are suggested as the cause, but it is not clear. Mutations in several genes have been reported as the cause of ALS, but the genetic cause is unknown in 1/3 of familial ALS and about 90% of sporadic ALS. In the present invention, amyotrophic lateral sclerosis may be characterized as familial or sporadic.

Diagnosis of amyotrophic lateral sclerosis is primarily based on clinical symptoms. Damage to both upper and lower motor nerves is characteristic. In the early stages, damage to only the upper motor nerve may appear, but generally, damage to the lower motor nerve occurs within 3 to 5 years after the onset. Diagnosis by clinical symptoms of amyotrophic lateral sclerosis is diagnosed by the condition exclusion method after the primary clinical findings because the causes and treatment methods can appear similar to those of completely different myopathy. In general, based on the patient's history and neurological examination, nerve conduction velocity test (NCV), muscle tissue biopsy, blood test, urine test, cerebrospinal fluid test, cervical spine X-ray and magnetic resonance imaging test, electromyography (EMG), etc. are performed to make a diagnosis For example, amyotrophic lateral sclerosis is excluded from the diagnosis if these symptoms are present because it is rarely accompanied by ocular movement disorders, sensory disorders, bladder and anal disorders, or intellectual disorders.

As described above, most diagnoses are made at the time when clinical symptoms appear after the onset. However, the diagnosis based on clinical symptoms has a problem in that the treatment time is missed because the diagnosis can be made only at a later stage when the symptoms appear prominent. Therefore, early diagnosis of amyotrophic lateral sclerosis is more important compared to other disease fields. Nevertheless, the cause of the onset is not clear, and a clear diagnostic marker is lacking due to the characteristics of the onset by complex factors.

As used herein, the term “diagnosis” refers to determining the susceptibility of a subject to a specific disease or disorder, whether the subject currently has a specific disease or disorder. determining, determining the prognosis of a subject afflicted with a particular disease or condition, or using therametrics (e.g., monitoring the condition of a subject to provide information about the efficacy of treatment) . For the purposes of the present invention, diagnosis is to determine whether or not (risk) the development of amyotrophic lateral sclerosis.

In one embodiment of the present invention, LATS1 (large tumor suppressor kinase 1) gene was identified as a gene candidate causing amyotrophic lateral sclerosis. The present inventors discovered a novel frameshift mutation c.2790del (p.Leu930Phefs*27) of the LATS1 gene in the sALS trio. The mutation in the LATS1 gene was not present in 1722 same-race normal controls. And no corresponding mutations were reported in dbSNP, 1000 Genome Project (all and East Asians) and gnomAD.

In the present invention, the LATS1 mutant gene refers to the LATS1 gene in which the mutation has occurred, for example, the mutation is a single nucleotide variant (Single Nucleotide variant: SNV), insertion or deletion (Indel) and gene copy number mutation (Copy-) number variation, CNV) may be any one or more selected from the group consisting of, but is not limited thereto, and refers to all genetic mutations recognized by those skilled in the art. Preferably, in the present invention, the mutation of the large tumor suppressor kinase 1 (LATS1) mutant gene may be a single nucleotide variant (SNV), insertion or deletion, and more preferably, may be a deletion.

Most preferably, in the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that the 2790th nucleotide is deleted from the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that a frame shift occurs by insertion or deletion of one or more bases.

The " LATS1 gene" is located on chromosome 6q25.1, consists of 8 exons, and encodes 1,130 amino acids. LATS1 protein is a putative serine/threonine kinase that is involved in the initial meiosis process together with CDC2 kinase that regulates the cell division cycle, and is known to act as a tumor suppressor gene. LATS1 is expressed in various tissues, including the brain. The expression level for each tissue of the LATS1 gene is shown in FIG. 1 . The LATS1 gene includes all homologous genes found in all animals, including humans, and the cDNA sequence of the normal human LATS1 gene confirmed in an embodiment of the present invention is the same as SEQ ID NO: 1 (NM_004690.4) Homo sapiens large tumor suppressor kinase 1 (LATS1), transcript variant 1, mRNA), confirmed in an embodiment of the present invention The amino acid sequence of the normal human LATS1 protein is the same as SEQ ID NO: 2 (NP_004681.1 serine/threonine-protein kinase LATS1) isoform 1 [Homo sapiens]), but not limited thereto.

In an embodiment of the present invention, as a result of analysis through gene sequencing and bioinformatics methods for patients with sporadic amyotrophic lateral sclerosis that did not develop in their parents, the previously reported cause of ALS-FTD or related genes, differential diagnosis of ALS No mutations were found in HSP and other disease genes for , and mutations in the LATS1 gene of the initiator were confirmed.

Therefore, in the present invention, the information providing method or the diagnostic method is characterized in that a gene is obtained from a sample isolated from an individual, amplified, and whether a mutation in the LATS1 gene occurs using sequencing data of the amplified product is analyzed. can be done with

As used herein, the term “amplification” refers to a reaction that amplifies a nucleic acid molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), ligase chain reaction (LCR) Gap-LCR, repair chain reaction , transcription-mediated amplification (TMA), self sustained sequence replication, selective amplification of target polynucleotide sequences, consensus sequence priming polymerase chain reaction (consensus) sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR), nucleic acid sequence based amplification (NASBA), strand displacement amplification (strand displacement amplification) and loop-mediated isothermalamplification (LAMP).

PCR is the most well-known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse polymerase chain reaction) Chain reaction: IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications.

“Single Nucleotide Variant (SNV)” refers to a mutation that shows a difference in single nucleotide sequence among genomic mutations. Single nucleotide polymorphism (SNP) and point mutation are here can occur in somatic cells of any frequency Single nucleotide variation in somatic cells (e.g., caused by cancer) is also called single-nucleotide alteration Single nucleotide polymorphism is the same It means that a specific nucleotide sequence is changed to another nucleotide at a position and expressed as a different trait, and it is the most common form of gene mutation in the human genome.Single nucleotide polymorphisms generally occur with a frequency of 1% or more of the population, If it is less than 1%, it is classified as a mutation Point mutation is a substitution, insertion, or deletion of one base sequence, and can prevent or modify the production of a specific protein.

Single nucleotide mutations are classified according to their location and function in the genome. In addition, according to the presence or absence of amino acid sequence mutation, it is classified into synonymous SNV (sSNV) that does not cause amino acid sequence mutation and nonsynonymous SNV (nsSNV) that does not cause amino acid sequence mutation. Among single nucleotide mutations, indels can cause more serious mutations than substitutions. In the case of indel, a frame shift of the amino acid sequence sequence is induced, so that the amino acid translated after the SNV is changed.

SNV present in the coding exon region is called coding SNV (cSNV) according to its position on the genome, and has the same ratio as intron, 5' and 3' untranslated region (UTR). The SNV present in the coding region is called non-coding SNV (ncSNV).

In the present invention, "SNP" and "SNV" may be used interchangeably, and may be used with the same meaning as "SNV of LATS1 gene" or " SNP of LATS1 gene".

“Single Nucleotide Polymorphism (SNP)” refers to a single nucleotide (A, T, C, or G) in the genome that differs between members of a species or between chromosomes of an individual. Refers to the diversity of DNA sequences Within a population, SNPs can be assigned to a minor allele frequency (MAF; the lowest allele frequency at a locus found in a particular population) Variations exist within the human population, and a single SNP allele common in a geological or ethnic group is very rare. A single base is a change (replacement), deletion (deletion) or addition ( The SNP may cause an inframe shift.

Various methods are used for SNV or SNP analysis. Most of the methods developed and used so far mainly analyze a limited number of samples based on the PCR method, but analyze a large number of SNPs at the same time using a DNA array or use ultra-precision analysis equipment such as MALDI-TOF. Analysis methods are also widely used. There are four principles of SNP genotyping: Allele-Specific Hybridization, Primer Extension, Allele-Specific Oligonucleotide Ligation, and Cleavage, depending on the difference between sample preparation and retrieval methods (Heterogeneous/Disease Genome Analysis 3 (Genetic Variation and Disease)) .

As the main assays based on PCR, for example, SSCP (Single Strand Conformation Polymorphism), AFLP (Amplified Fragment Length Polymorphism), RFLP (Restriction Fragment Length Polymorphism), RAPD (Random Amplified Polymorphic DNA), AS-PCR (Allele-PCR) Specific PCR), but is not limited thereto.

"Insertion or deletion (Indel)" means that one or more nucleotides are inserted or deleted in a gene. Indel in SNV means that one nucleotide is inserted or deleted, and "insertion or deletion (Indel)" can be used to include it.

"Copy-number variation (CNV)" refers to a phenomenon in which the repetition of a certain section of a gene differs from one individual to another. The repetition may be repeated 0 times to n times. When it is repeated 0 times, the function of the gene is lost, and when it is repeated more than 1 time, the function of the gene is generally amplified, but is not limited thereto.

In the present invention, the sequencing may be characterized by Sanger sequencing or next generation sequencing (NGS).

In an embodiment of the present invention, novel mutations causing substitution of all amino acids according to the filtering criteria were evaluated through Sanger sequencing of DNA. All exon and exon-intron boundaries of the target gene were amplified by PCR using primers (Table 6).

The term “Sanger sequencing analysis” of the present invention is a method of analyzing a nucleotide sequence through DNA chain termination using dideoxynucleotide triphosphate (ddNTP). The Sanger sequencing method is very convenient and has low toxicity, so it has spread rapidly compared to the Maxam-Gilbert method developed at the same time (Maxam and Gilbert, 1977), and other methods in the future have been modified and developed from this method. . In the present invention, Sanger sequencing includes modifications and advanced analysis methods known to those skilled in the art, in addition to the first known method.

The term “next-generation sequencing (NGS)” in the present invention corresponds to the second-generation technology in terms of automation. NGS is a name called to distinguish it from the first automation device before and to distinguish it from the Next NGS device (also referred to as next-generation or third-generation NGS) that was created later. However, as competition for the development of efficient sequencing technology accelerates and sequencing technology continues to be developed based on the introduction of new technologies and the purpose of using the platform, the distinction between sequencing technologies of each generation becomes vague, and NGS is used in a broad sense encompassing all of the sequencing technology after the automated Sanger sequencing technology. In the present invention, “next-generation sequencing” is used in a broad sense encompassing all sequencing techniques after Sanger sequencing technology.

With the development of sequencing technology, it may be possible to perform sequencing from a single molecule of DNA. Therefore, in the present invention, when analyzing a gene mutation using a next-generation sequencing method, the step of amplifying a gene can be omitted. For example, a sequencing method that does not amplify a gene includes, but is not limited to, a single molecule, real-time (SMRT), Oxford Nanopore sequencer, and the like.

In the present invention, the step of detecting the LATS1 mutant gene may LATS1 mutation using primers for the gene, it is also possible to use a pair (pair) or more primer sets. The primer can be used without limitation as long as it is a sequence that can specifically bind to the LATS1 mutant gene, but is preferably a primer capable of amplifying a site containing a mutation at position 2970 of SEQ ID NO: 1. and, more preferably, the primer may include the sequence represented by SEQ ID NO: 4 or 5.

In the present invention, the step of detecting the LATS1 mutant gene is to use a probe that LATS1 mutant binding complementarily to the gene, wherein the probe is complementary to a region containing the mutation position of 2970-th positions in SEQ ID NO: 1 It may be characterized as a binding probe, but is not limited thereto. In the present invention, a reporter may be attached to the 5' end of the probe, and another fluorescent material showing fluorescence may be attached, but is not limited thereto. For example, the reporter may be an enzyme, a fluorescent substance, a ligand, a luminescent substance, a microparticle, a redox molecule, and a radioisotope, but is not limited thereto. As another example, the reporter is FAM, JOE, BHQ1, VIC, TAMRA, ROX, NED, HEX, TET, fluorescein, fluorescein chlorotriazinyl, rhodamine green ), rhodamine red, tetramethylrhodamine, FITC, Oregon green, Alexa Fluor, Texas Red, Cyanine-based dyes and cyanine It may be at least one selected from the group consisting of dicarbocyanine dyes. In addition, a black hole quencher-1 (BHQ-1) may be attached to the 3' end of the probe as a quencher, and other materials that can be used as a quencher may be attached thereto. Not limited. For example, the quencher may be selected from the group consisting of Dabcyl, TAMRA, Eclipse, DDQ, QSY, Blackberry Quencher, Qxl, Iowa black FQ, Iowa black RQ and IRDye QC-1. It may be one or more selected.

It is easy for those skilled in the art to design a primer set capable of specifically amplifying the mutation site of the LATS1 gene and a probe that complementarily binds to the region including the mutation site of the gene. The primer set and probe can be used for real time polymerase chain reaction (PCR), and more preferably, can be used for multiplex real time PCR. The nucleic acid sequence contained in the probe or primer may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, "encapsulation", substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

In the present invention, the step of detecting the LATS1 mutant gene is a polymerase chain reaction, nucleic acid digestion, hybridization, Southern blotting, restriction enzyme fragment polymorphism (restriction). enzyme fragment polymorphism), primer extension, single stranded conformation polymorphism, DNA chip, microarray, and a method selected from the group consisting of a combination thereof. It may be characterized, but is not limited thereto, and in addition to the above method, it may be analyzed using a known molecular biological method together.

In the present invention, the "simultaneous multiplex PCR" means that two or more sets of primers used for PCR are used in one amplification reaction.

A primer is a short single-stranded oligonucleotide that serves as a starting point for DNA synthesis. A primer binds specifically to a polynucleotide as a template under suitable buffer and temperature conditions, and DNA polymerase adds a nucleoside triphosphate having a base complementary to the template DNA to the primer to link it. is synthesized A primer generally consists of a sequence of 15 to 30 bases, but is not limited thereto, and the temperature (melting temperature, Tm) at which it binds to the template strand varies depending on the base composition and length.

"Probe" refers to a fragment of a polynucleotide such as RNA or DNA with a length of several to several hundred base pairs that can specifically bind to mRNA or cDNA (complementary DNA) of a specific gene. In addition, since it is labeled, the presence or absence of the target mRNA or cDNA to be bound to, and the amount of expression, etc. can be confirmed. In the present invention, the probe specifically binds to the LATS1 mutant gene, and preferably specifically binds to a site containing the mutation of the LATS1 gene, most preferably the LATS1 gene of SEQ ID NO: 1 It is characterized in that it specifically binds to a site including a site in which the 2790th base is deleted.

In one embodiment of the present invention, as a result of analyzing the protein encoded by the deletion at the 2790th base of the LATS1 gene of SEQ ID NO: 1, this is a frame shift mutation, 930 of the LATS1 protein of SEQ ID NO: 2 when transcribed and translated The th amino acid is substituted with phenylalanine (Phe) from leucine (Leu), and from this, it was confirmed that protein synthesis is terminated at the 27 th amino acid (956 th) (SEQ ID NO: 3). Therefore, LATS1 encoded by the LATS1 mutant gene from a sample isolated from an individual When the mutated protein is detected, amyotrophic lateral sclerosis can be diagnosed.

In the present invention, LATS1 encoded by the LATS1 mutant gene The mutant protein is characterized in that in the amino acid sequence of SEQ ID NO: 2, the 930th amino acid is substituted with leucine (Leu) to phenylalanine (Phe), and from this, protein synthesis is terminated at the 27th amino acid (956th). , Preferably it may be characterized as a protein represented by the amino acid sequence of SEQ ID NO: 3.

In the present invention, LATS1 encoded by the LATS1 mutant gene The detecting of the mutant protein may be characterized in that it is detected using an antibody or aptamer specific for the protein.

In the present invention, LATS1 encoded by the LATS1 mutant gene The step of detecting the mutated protein is Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation analysis, complement fixation assay, FACS, It may be characterized by detecting using a method selected from the group consisting of a protein chip and a combination thereof.

As used herein, the term “antibody” refers to an immunoglobulin that specifically binds to an antigenic site. Antibodies for use in the present invention include monoclonal or polyclonal antibodies, immunologically active fragments (eg, Fab or (Fab)2 fragments), antibody heavy chains, humanized antibodies, antibody light chains, genetically engineered single chain Fv molecules, It may be a chimeric antibody or the like. All immunoglobulin antibodies, antigen-binding sites and fragments thereof that specifically bind to the LATS1 mutant protein encoded by the LATS1 mutant gene are included. In the present invention, the antibody specifically binds to the mutant LATS1 protein encoded by the mutant LATS1 gene, and preferably, in the amino acid sequence of SEQ ID NO: 2, amino acid at position 930 is substituted from leucine (Leu) to phenylalanine (Phe) From this, the protein synthesis is terminated at the 27th amino acid (956th), or may be an antibody that specifically binds to the protein represented by the amino acid sequence of SEQ ID NO: 3.

"Aptamer" refers to a small single-stranded oligonucleic acid capable of specifically recognizing a target material with high affinity as a single-stranded DNA or RNA molecule. Aptamers can be used as one element of a biosensor capable of recognizing molecules in a detection and analysis system, and thus has been recognized as an antibody substitute. In particular, unlike antibodies, aptamers can be used as target molecules of various organic and inorganic substances, including toxins, and once an aptamer that specifically binds to a specific substance is isolated, it is reproduced at low cost and consistency by an automated oligomer synthesis method. This was possible and economical. Accordingly, since the first aptamer-based biosensor that measured a target protein using a fluorescently-labeled aptamer was developed in 1996, various aptamer biosensors have been developed based on the advantages and structural characteristics of the aptamer. Yes (Kim Yeon-seok & Koo Man-bok, NICE, 26(6): 690, 2008). In the present invention, the aptamer specifically binds to the mutant LATS1 protein encoded by the mutant LATS1 gene, and preferably, in the amino acid sequence of SEQ ID NO: 2, amino acid at position 930 is substituted from leucine (Leu) to phenylalanine (Phe) and, from this, it may be an aptamer that specifically binds to a protein in which protein synthesis is terminated at the 27th amino acid (956th) or a protein represented by the amino acid sequence of SEQ ID NO:3.

In the present invention, the biological sample is a nucleic acid sample isolated from a sample selected from the group consisting of blood, hair, saliva, urine, semen, vaginal cells, oral cells, placental cells, amniotic fluid including fetal cells, and mixtures thereof. can be characterized as The nucleic acid may be genomic DNA, cell free DNA (cfDNA), RNA or micro RNA, but is not limited thereto.

The nucleic acid can be obtained through a conventional method known in the art. For example, the tissue is treated with a DNA lysis buffer (e.g., tris-HCl, EDTA, EGTA, SDS, deoxycholate, and tritonX and/or NP-40) to isolate DNA. However, the present invention is not limited thereto.

The information providing method or diagnostic method can be used alone for the diagnosis of amyotrophic lateral sclerosis, and in addition to the detection of the LATS1 gene of the present invention, it can be used in combination with the detection of other genes or proteins known as diagnostic markers of amyotrophic lateral sclerosis. have. In addition, based on clinical symptoms, patient history, and neurological examination, nerve conduction velocity test (NCV), muscle tissue biopsy, blood test, urine test, cerebrospinal fluid test, cervical spine X-ray and magnetic resonance imaging test, electromyography (EMG) ) can also be used with non-genetic diagnostic methods such as

In another aspect, the present invention provides a diagnostic marker for amyotrophic lateral sclerosis, a single nucleotide variant (SNV), an insertion or deletion (Indel), and any one or more of a copy-number variation (CNV). It relates to a LATS1 (Large Tumor Suppressor Kinase 1) mutant gene, including.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that insertion or deletion occurs.

In the present invention, the LATS1 (Large tumor suppressor kinase 1) mutant gene may be characterized in that one or more of the nucleotides of the gene are deleted.

In the present invention, the LATS1 gene may be characterized in that it comprises a nucleotide sequence represented by SEQ ID NO: 1.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that the mutation occurs at the 2790th base in the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 (Large tumor suppressor kinase 1) mutant gene may be characterized in that the 2790th nucleotide is deleted from the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that a frame shift occurs due to mutation.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that a frame shift mutation occurs by deletion of the 2790th nucleotide from the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 (Large tumor suppressor kinase 1) mutant gene may be characterized in that the 2790th nucleotide is deleted from the nucleotide sequence of SEQ ID NO: 1.

In another aspect, the present invention provides a diagnostic marker for amyotrophic lateral sclerosis, a single nucleotide variant (SNV), an insertion or deletion (Indel), and a copy-number variation (CNV) any one of It relates to a LATS1 mutant protein encoded by a large tumor suppressor kinase 1 ( LATS1 ) mutant gene including the above.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that insertion or deletion occurs.

In the present invention, the LATS1 (Large tumor suppressor kinase 1) mutant gene may be characterized in that one or more of the nucleotides of the gene are deleted.

In the present invention, the LATS1 gene may be characterized in that it comprises a nucleotide sequence represented by SEQ ID NO: 1.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that the mutation occurs at the 2790th base in the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 (Large tumor suppressor kinase 1) mutant gene may be characterized in that the 2790th nucleotide is deleted from the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that a frame shift occurs due to mutation.

In the present invention, the LATS1 (Large Tumor Suppressor Kinase 1) mutant gene may be characterized in that a frame shift mutation occurs by deletion of the 2790th nucleotide from the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 (Large tumor suppressor kinase 1) mutant gene may be characterized in that the 2790th nucleotide is deleted from the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the LATS1 mutant protein is that in the amino acid sequence of SEQ ID NO: 2, the 930th amino acid is substituted from leucine (Leu) to phenylalanine (Phe), and protein synthesis is terminated at the 27th amino acid (956th) therefrom. It may be characterized, and preferably, it may be characterized as represented by the amino acid sequence of SEQ ID NO: 3.

As used herein, the term "diagnostic marker" refers to an organic biomolecule that is a substance that can distinguish cancer patients from healthy people and diagnose them, and shows an increase in cancer-causing individuals compared to healthy people. Examples of the organic biomolecules include, but are not limited to, polypeptides, proteins, nucleic acids, lipids, glycolipids, glycoproteins, and sugars. In the present invention, preferably, the organic biomolecule refers to DNA, RNA, polypeptide or protein. In the present invention, the diagnostic marker is a LATS1 mutant gene or a LATS1 mutant protein encoded by the gene.

In another aspect, the present invention relates to a composition for diagnosis of amyotrophic lateral sclerosis comprising an agent capable of detecting a large tumor suppressor kinase 1 ( LATS1 ) mutant gene or a LATS1 mutant protein encoded by a mutant LATS1 gene.

In the present invention, the preparation may include a primer capable of specifically amplifying the mutation site of the LATS1 gene or a probe that complementarily binds to the region including the mutation site of the LATS1 gene. have.

In the present invention, the preparation may include an antibody or aptamer specific for the LATS1 mutant protein.

In the present invention, one or more pairs of primer sets may be used. The primer can be used without limitation as long as it is a sequence capable of specifically binding to the LATS1 mutant gene, but is preferably a primer capable of amplifying a site containing a mutation at position 2970 of SEQ ID NO: 1. . More preferably, it may be characterized in that it is capable of amplifying a site containing a deletion at position 2970 of SEQ ID NO: 1, and most preferably, the primer comprises the nucleotide sequence represented by SEQ ID NO: 4 or 5 can be characterized as

In the present invention, the probe specifically binds to the LATS1 mutant gene, preferably, it is characterized in that it specifically binds to a site containing the mutation of the LATS1 gene, most preferably the LATS1 gene of SEQ ID NO: 1 It may be characterized in that it specifically binds to a site including a site in which the 2790th base of the is deleted.

In the present invention, the antibody is LATS1 It specifically binds to the LATS1 mutant protein encoded by the mutant gene, and preferably, in the amino acid sequence of SEQ ID NO: 2, amino acid at position 930 is substituted from leucine (Leu) to phenylalanine (Phe), and from this, the 27th amino acid It may be an antibody that specifically binds to a protein whose protein synthesis is terminated in (956th) or a protein represented by the amino acid sequence of SEQ ID NO: 3.

In the present invention, the aptamer specifically binds to the LATS1 mutant protein encoded by the LATS1 mutant gene, and preferably, in the amino acid sequence of SEQ ID NO: 2, the 930th amino acid is leucine (Leu) to phenylalanine (Phe) It may be an aptamer that specifically binds to a protein of which protein synthesis is terminated at the 27th amino acid (956th) or a protein represented by the amino acid sequence of SEQ ID NO:3.

In the present invention, the composition may include all of the diagnostic primer, probe, antibody, and aptamer, and may include any combination thereof.

The diagnostic composition of the present invention may include a reagent known in the art used to detect a LATS1 mutated gene or mutated protein for specific diagnosis of amyotrophic lateral sclerosis.

The diagnostic composition of the present invention may be provided in a state of being fixed on a suitable carrier or support using various known methods in order to increase the speed and convenience of diagnosis. Non-limiting examples of suitable carriers or supports include agarose, cellulose, nitrocellulose, dextran, sephadex, sepharose, liposome, carboxymethylcellulose, polyacrylamide, polyesterin, gabbro, filter paper, ion exchange resin, plastic. films, plastic tubes, glass, polyamine-methyl vinyl-ether-maleic acid copolymers, amino acid copolymers, ethylene-maleic acid copolymers, nylon, cups, flat packs, and the like. Other solid substrates include cell culture plates, ELISA plates, tubes, and polymeric membranes. The support may have any possible shape, for example spherical (bead), cylindrical (test tube or well inner surface), planar (sheet, test strip).

The diagnostic composition of the present invention can be used alone for the diagnosis of amyotrophic lateral sclerosis, and other genes or proteins known as diagnostic markers of amyotrophic lateral sclerosis in addition to the detection of the LATS1 gene of the present invention can be used in combination with a composition for detection can In addition, based on clinical symptoms, patient history, and neurological examination, nerve conduction velocity test (NCV), muscle tissue biopsy, blood test, urine test, cerebrospinal fluid test, cervical spine X-ray and magnetic resonance imaging test, electromyography (EMG) ) can also be used with compositions for non-genetic diagnosis such as

In another aspect, the present invention relates to a kit for diagnosis of amyotrophic lateral sclerosis, comprising an agent capable of detecting a large tumor suppressor kinase 1 ( LATS1 ) mutant gene or a LATS1 mutant protein encoded by a mutant LATS1 gene.

In the present invention, the kit may include the composition for diagnosis of amyotrophic lateral sclerosis.

In the present invention, the preparation may include a primer capable of specifically amplifying the mutation site of the LATS1 gene or a probe that complementarily binds to the region including the mutation site of the LATS1 gene. have.

In the present invention, the preparation may include an antibody or aptamer specific for the LATS1 mutant protein.

In the present invention, one or more pairs of primer sets may be used. The primer can be used without limitation as long as it is a sequence capable of specifically binding to the LATS1 mutant gene, but is preferably a primer capable of amplifying the mutation at position 2970 of SEQ ID NO: 1. Most preferably, the primer may be characterized in that it comprises a nucleotide sequence represented by SEQ ID NO: 4 or 5.

In the present invention, the probe specifically binds to the LATS1 mutant gene, preferably, it is characterized in that it specifically binds to a site containing the mutation of the LATS1 gene, most preferably the LATS1 gene of SEQ ID NO: 1 It may be characterized in that it specifically binds to a site including a site in which the 2790th base of the is deleted.

In the present invention, the antibody is LATS1 It specifically binds to the LATS1 mutant protein encoded by the mutant gene, and preferably, in the amino acid sequence of SEQ ID NO: 2, amino acid at position 930 is substituted from leucine (Leu) to phenylalanine (Phe), and from this, the 27th amino acid (956th) protein synthesis is terminated; Or it may be an antibody that specifically binds to the protein represented by the amino acid sequence of SEQ ID NO: 3.

In the present invention, the aptamer is LATS1 It specifically binds to the LATS1 mutant protein encoded by the mutant gene, and preferably, in the amino acid sequence of SEQ ID NO: 2, amino acid at position 930 is substituted from leucine (Leu) to phenylalanine (Phe), and from this, the 27th amino acid (956th) protein synthesis is terminated; Or it may be an aptamer that specifically binds to the protein represented by the amino acid sequence of SEQ ID NO: 3.

In the present invention, the kit may further include one or more other component compositions, solutions, or devices suitable for the analysis method as well as primers, probes, antibodies, etc. for diagnosing amyotrophic lateral sclerosis, preferably RT - It may be in the form of a PCR kit, a microarray chip kit, a DNA chip kit, or a protein chip kit, but is not limited thereto.

As a specific example, the kit for measuring the mRNA expression level of the marker genes in the present invention may be a kit including essential elements necessary for performing RT-PCR. In addition to each primer pair specific for a marker gene, the RT-PCR kit includes a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterile water, etc. may be included.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing a microarray. The microarray kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative control gene or fragment thereof, and using the marker of the present invention, the art It can be easily prepared by a manufacturing method commonly used in In order to fabricate a microarray, a micropipetting method using a piezoelectric method or a pin type to immobilize the detected marker on a substrate of a DNA chip using the probe DNA molecule It is preferable to use a method using a spotter, but is not limited thereto. The substrate of the microarray chip is preferably coated with an active group selected from the group consisting of amino-silane, poly-L-lysine and aldehyde, but is not limited thereto. In addition, the substrate is preferably selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane and nitrocellulose membrane, but is not limited thereto.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescent probe. The substrate may also contain cDNA or oligonucleotides corresponding to control genes or fragments thereof.

In the present invention, the kit may further include, without limitation, an agent for detecting a diagnostic marker of amyotrophic lateral sclerosis known to those of ordinary skill in the art, in addition to the agent.

The diagnostic kit of the present invention can be used alone for the diagnosis of amyotrophic lateral sclerosis, and in addition to the detection of the LATS1 gene of the present invention, other genes or proteins known as diagnostic markers of amyotrophic lateral sclerosis can be used in combination with a kit for detection can In addition, based on clinical symptoms, patient history, and neurological examination, nerve conduction velocity test (NCV), muscle tissue biopsy, blood test, urine test, cerebrospinal fluid test, cervical spine X-ray and magnetic resonance imaging test, electromyography (EMG) ) can also be used with kits for non-genetic diagnostics such as

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

Materials and Methods

Sporadic ALS Trio (sALS Trio) Selection

Patients and parents with sporadic ALS who visited Hanyang University Neurology ALS Clinic were included in the ALS trio study. The patient was born in Korea. For clinical diagnosis, a neurological evaluation including electromyography, clinical examination, and appropriate imaging methods was performed on the patient. All ALS patients were diagnosed by a neurologist specializing in neuromuscular disease, and it was confirmed that they met the revised El Escorial diagnostic criteria (reference required). Such as spinal muscular atrophy, Kennedy syndrome, monomelic atrophy, Hirayama syndrome and multifocal motor neuropathy not considered in the ALS spectrum Patients diagnosed with the condition were excluded from the study.

To objectively evaluate response to treatment or disease progression during follow-up, ALSFRS-R was used to determine the extent of functional impairment for diagnosis by physicians. ALSFRS-R includes language skills, salivation, swallowing, handwriting, food cutting and instrumentation (with or without gastrostomy), dressing and hygiene, bed rotation and futon adjustment, walking, stair climbing, dyspnea, and orthepnea. ) and 12 questions assessing respiratory failure. Scores for each item were summed to give a score between 0 and 48. Progression rate was calculated as ΔFS (48-ALSFRS-R at diagnosis/time from onset to diagnosis), and patients were divided into three groups [slow (cut-off value < 0.66), medium (0.66-1.00), and fast (>1.00)]. Clinical reports included indications of upper and lower motor neuron damage at the spinal and medulla oblongata. Sporadic ALS was defined as cases in which the initiator exhibited signs such as progressive superior or inferior motor neuron damage and had no clinically affected family history of the same lineage.

It was conducted with approval from the institutional ethics review committee of Hanyang University Hospital (#HYI-10-01-3) and Samsung Seoul Hospital (#2013-04-131-002), and participants filled out a consent form for the approved research protocol did. The present inventors previously screened genes known to cause ALS, and no pathological mutations were found in the participants.

Whole exome sequencing

에서 360초 동안 모드 주파수 회전(mode frequency sweeping)으로 세팅된 Covaris-S2 instrument (Covaris, Woburn, MA)를 이용하여 120 ㎕ EB 버퍼에 녹인 3 ㎍의 지노믹 DNA를 150 bp의 사이즈로 절단하였다. 절단 효율은 DNA1000 칩(Bioanalyzer, Agilent)의 모세관 전기영동을 통해 평가하였다. 제조사의 프로토콜(Agilent)에 따라 시퀀싱 어댑터를 DNA 단편에 결합시켰다. DNA에 결합시킨 어댑터는 PCR을 이용하여 증폭하였다. PCR 산물의 질(quality)은 모세관 전기영동(Bioanalyzer, Agilent)을 통해 평가하였다. 혼성화 버퍼를 만들기 위해 SureSelect hyb #1, #2, #3, 및 #4 시약(Agilent)을 혼합하였다. 증폭된 DNA 단편은 3.4 ㎕에 750 ng가 되도록 농축하였다. SureSelect block #1, #2, 및 #3 시약(Agilent)을 750 ng의 DNA에 첨가하였다. 혼성화 버퍼 및 DNA 블로커 믹스는 유전자 증폭기를 이용하여 95

에서 5분, 그 다음 65

에서 10분간 배양하였다. RNase 블록(Agilent)을 SureSelect 올리고 캡처 라이브러리(Agilent)에 첨가하였다. 캡처 라이브러리는 65

에서 2분간 배양하였다. 먼저 혼성화 버퍼, 그 다음 DNA 블로커 믹스를 캡처 라이브러리에 첨가하고, 유전자 증폭기를 이용하여 혼합물을 65

에서 24시간 배양하였다. 50 ㎖ 스트렙타비딘이 코팅된 Dynal MyOne Streptavidin T1 (Invitrogen)을 200 ㎖ SureSelect 바인딩 버퍼(Agilent)로 3회 세척한 다음, 200 ㎕ 바인딩 버퍼에 재부유시켰다. 혼성화 혼합물을 비드 부유물에 첨가하고 상온에서 믹싱하면서 30분간 배양하였다. 상온에서 15분간 500 ㎕ SureSelect 세척 버퍼 #1 (Agilent)로 비드를 세척한 다음, 65

에서 10분간 500 ㎕ SureSelect 세척 버퍼 #2 (Agilent)로 3회 세척하였다. 30 ㎕ 물로 상온에서 5분간 DNA를 용출하였다. 반응물은 AMPure XP 비드(Beckman Coulter, Brea, CA)로 정제하였다. Herculase II Fusion DNA Polymerase(Finnzymes, Life Technologies)를 이용하여 인덱스 태그를 첨가하기 위해 캡처한 라이브러리를 증폭하였다. 증폭한 라이브러리의 질(quality)는 모세관 전기영동(Bioanalyzer, Agilent)을 통해 평가하였다. SYBR Green PCR 마스터 믹스(Applied Biosystems, Life Technologies)를 이용하여 QPCR를 실시한 다음, 풀(pool)에서 등몰 농도(equimolar amounts)로 태깅된 6 라이브러리들을 결합하였다. 클러스터 형성은 cBot automated cluster generation system (illumine, San Diego, CA)을 이용하였으며 HiSeq 2500 시퀀싱 시스템(illumina)을 이용하여 단위 길이 2x100 bp로 시퀀싱을 실시하였다.Genomic DNA (gDNA) was isolated from peripheral blood leukocytes using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI) according to the manufacturer's instructions. DNA was confirmed by 1% agarose gel electrophoresis and PicoGreen® dsDNA Assay (Invitrogen, Life Technologies, Waltham, Mass.). As far as possible, the DNA should be intact with an OD 260/280 ratio of 1.8-2.0. The SureSelect sequencing library was prepared according to the manufacturer's instructions using the Agilent SureSelect all Exon kit 50Mb (Agilent, Santa Clara, CA) with The Bravo automated liquid handler. 10% utilization, 5 intensity, 200 cycles per burst, and 4

3 μg of genomic DNA dissolved in 120 μl EB buffer was cut to a size of 150 bp using a Covaris-S2 instrument (Covaris, Woburn, MA) set to mode frequency sweeping for 360 seconds in a . The cleavage efficiency was evaluated by capillary electrophoresis of a DNA1000 chip (Bioanalyzer, Agilent). The sequencing adapter was ligated to the DNA fragment according to the manufacturer's protocol (Agilent). The adapter bound to the DNA was amplified using PCR. The quality of the PCR product was evaluated by capillary electrophoresis (Bioanalyzer, Agilent). SureSelect hyb #1, #2, #3, and #4 reagents (Agilent) were mixed to make the hybridization buffer. The amplified DNA fragment was concentrated to 750 ng in 3.4 μl. SureSelect block #1, #2, and #3 reagents (Agilent) were added to 750 ng of DNA. Hybridization buffer and DNA blocker mix 95 using a gene amplifier

at 5 minutes, then 65

incubated for 10 min. The RNase block (Agilent) was added to the SureSelect oligo capture library (Agilent). The capture library is 65

incubated for 2 min. Add hybridization buffer first, then DNA blocker mix to the capture library, and use a gene amplifier to convert the mixture to 65

incubated for 24 hours. Dynal MyOne Streptavidin T1 (Invitrogen) coated with 50 ml streptavidin was washed three times with 200 ml SureSelect binding buffer (Agilent), and then resuspended in 200 μl binding buffer. The hybridization mixture was added to the bead suspension and incubated for 30 minutes while mixing at room temperature. Beads were washed with 500 μl SureSelect Wash Buffer #1 (Agilent) for 15 min at room temperature, followed by 65

was washed 3 times with 500 μl SureSelect Wash Buffer #2 (Agilent) for 10 min at DNA was eluted with 30 μl water at room temperature for 5 minutes. The reaction was purified with AMPure XP beads (Beckman Coulter, Brea, CA). Captured libraries were amplified to add index tags using Herculase II Fusion DNA Polymerase (Finnzymes, Life Technologies). The quality of the amplified library was evaluated through capillary electrophoresis (Bioanalyzer, Agilent). QPCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies), and then 6 libraries tagged at equimolar amounts in the pool were combined. Cluster formation was performed using a cBot automated cluster generation system (illumine, San Diego, CA) and sequencing was performed with a unit length of 2x100 bp using a HiSeq 2500 sequencing system (illumina).

Bioinformatics analysis

The reads were mapped to the GRCh37/hg19 build using a Burrows-Wheeler Aligner (BWA) 0.7.10 (114). Picard-tools 1.114 was used to display duplicate reads (http://picard.sourceforge.net/). A GATK (v3.2-2) IndelRealigner was used to reconcile reads around insertion or deletion (indel) positions. The quality of the read results was measured using the GATK BaseRecalibrator. Genotypes were generated simultaneously for all samples by the GATK HaplotypeCaller. Variant quality score adjustment was performed using GATK VariantRecalibrator, and was filtered with 99.7 truth sensitivity level. To identify rare mutations, dbSNP, 1000 Genomes Project (http://www.1000genomes.org/), and gnomAD (http://http://gnomad.broadinstitute.org/) were identified. Annotation of mutations was performed using an in-house custom-made script (Table 1).

Bioinformatics Analysis Pipeline for Whole Exome Sequencing analysis tool Fastq quality control NGSQCToolkit_v2.3.3 alignment BWA-0.7.10 mem,
Picard-tools-1.114/AddOrReplaceReadGroups.jar Remove duplicate Picard-tools-1.114/MarkDuplicates.jarPicard-tools-1.114/FixMateInformation.jar Realignment GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar
-T RealignerTargetCreator
GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar
-T IndelRealigner Recalibration GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar
-T BaseRecalibrator
GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar
-T PrintReads Variant/Genotype calling
(gVCF method) GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar
-T HaplotypeCaller Filtering GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar
-T VariantRecalibrator
GenomeAnalysisTK-3.2-2/GenomeAnalysisTK.jar
-T ApplyRecalibration sensitivity 99.7 cutoff Annotation In-house perl script annotations

Filter by

For the initiator, for the differential diagnosis of ALS, previously known ALS and FTD causative genes or related genes, HSP, and mutations in other disease genes requiring differentiation were first screened (Table 2-5). In order to identify previously known pathogenic mutations, a list of mutations against the human gene mutation database (HGMD®2014.1Proversion) was compared.

The novel mutation was confirmed that the parent was homozygous for the reference sequence, and the initiator was heterozygous. We selected mutations with an allele frequency of less than 0.01 identified in the dbSNP database, the 1000 Genome Project and gnomAD as rare mutations.

In addition, the mutations found in this study were compared with 1722 normal controls of matched race. For normal control data, KRGDB (Korean Reference Genome Database, http://coda.nih.go.kr/coda/KRGDB/index.jsp) was used.

Genes responsible for ALS and FTD phenotype gene RefSeq gene description chromosomal location hereditary form ALS SPG11 NM_025137.3 Spastic paraplegia 11 15q14 AR ALS VAPB NM_004738.4 VAMP (vesicle-associated membrane protein)-associated protein B and C 20q13.3 AD ALS ALS2 NM_020919.3 Amyotrophic lateral sclerosis 2 2q33.1 AD ALS ANG NM_001145.4 Angiogenin, ribonuclease, RNase A family, 5 14q11.1 AD ALS DAO NM_001917.4 D-amino-acid oxidase 12q24 AD ALS FIG4 NM_014845.5 FIG4 phosphoinositide 5-phosphatase 6q21 AD ALS OPTN NM_021980.4 Optineurin 10p13 AD ALS SETX NM_015046.5 Senataxin 9q34.13 AD FTD MAPT NM_005910.5 Microtubule-associated protein tau 17q21.1 AD FTD PSEN1 NM_000021.3 Presenilin-1 14q24.3 AD FTD PSEN2 NM_000447.2 Presenilin-2 1q42.13 AD FTD TARDBP NM_007375.3 TAR DNA binding protein 1p36.22 AD FTD TREM2 NM_018965.2 Triggering receptor expressed on myeloid cells 2 6p21.1 AR ALS/FTD FUS NM_004960.3 FUS RNA binding protein 16p11.2 AD ALS/FTD GRN NM_002087.2 Granulin 17q21.32 AD ALS/FTD SIGMAR1 NM_005866.2 Sigma non-opioid intracellular receptor 1 9p13.3 AD/AR ALS/FTD SOD1 NM_000454.4 Superoxide dismutase 1 21q22.11 AD ALS/FTD SQSTM1 NM_003900.4 Sequestosome 1 5q35 AD ALS/FTD TAF15 NM_139215.2 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor 17q11.1-q11.2 AD ALS/FTD TARDBP NM_007375.3 TAR DNA binding protein 1p36.22 AD ALS/FTD UBQLN2 NM_013444.3 Ubiquilin 2 Xp11.21 X-linked ALS/FTD VCP NM_007126.3 Valosin-containing protein 9p13.3 AD

ALS and FTD Related Genes phenotype gene RefSeq gene description chromosomal location references ALS APEX1 NM_001641.3 APEX nuclease (multifunctional DNA repair enzyme) 1 14q11.2-q12 (115) ALS ARHGEF28 NM_001080479.2 Rho guanine nucleotide exchange factor (GEF) 28 5q13.2 (116) ALS ERBB4 NM_005235.2 Erb-b2 receptor tyrosine kinase 4 2q33.3-q34 (117) ALS EWSR1 NM_001163285.1 Ewing sarcoma breakpoint region 1 22q12.2 (118) ALS NEFH NM_021076.3 Neurofilament, heavy polypeptide (200 kDa) 22q12.2 (119) ALS PFN1 NM_005022.3 Profilin 1 17p13.3 (69) ALS PON1 NM_000446.5 Paraoxonase 1 7q21.3 (120) ALS PON2 NM_000305.2 Paraoxonase 2 7q21.3 (120) ALS PON3 NM_000940.2 Paraoxonase 3 7q21.3 (120) ALS PRPH NM_006262.3 Peripherin 12q12-q13 (121) ALS SRCAP NM_006662.2 Snf2-related CREBBP activator protein 16p11.2 (110) ALS SS18L1 NM_198935.1 Synovial sarcoma translocation gene on chromosome
18-like 1 20q13.3 (122) ALS CHRNA4 NM_000744.6 Acetylcholine receptor, neuronal nicotinic, alpha-4 subunit 20q13.2-q13.3 (123) ALS/FTD CHMP2B NM_014043.3 Chromatin modifying protein 2B 3p11.2 (124) ALS/FTD DCTN1 NM_004082.4 Dynactin 1 2p13 (125) ALS/FTD HNRNPA1 NM_031157.2 Heterogeneous nuclear ribonucleoprotein A1 12q13.1 (72) ALS/FTD HNRNPA2B1 NM_031243.2 Heterogeneous nuclear ribonucleoprotein A2/B1 7p15 (72)

HSP causative gene for differential diagnosis of ALS phenotype gene Locus name gene description chromosomal location hereditary form Uncomplicated HSP ATL1 SPG3A Atlastin GTPase 1 14q22.1 AD Uncomplicated HSP SPAST SPG4 Spastin 2p24-p21 AD Uncomplicated HSP NIPA1 SPG6 Non-imprinted in Prader-Willi / Angelman syndrome 1 15q11.2 AD Uncomplicated HSP KIAA0196 SPG8 KIAA0196 8q24.13 AD Uncomplicated HSP KIF5A SPG10 Kinesin family member 5A 12q13.13 AD Uncomplicated HSP RTN2 SPG12 Reticulon 2 19q13.32 AD Uncomplicated HSP HSPD1 SPG13 Heat shock protein 60kDa protein1 (chaperonin) 2q33.1 AD Complicated HSP BSCL2 SPG17 Berardinelli-Seip congenital lipodystrophy 2 (seipin) 11q13 AD Uncomplicated HSP REEP1 SPG31 receptor accessory protein 1 2p11.2 AD Uncomplicated HSP ZFYVE27 SPG33 Zinc finger, FYVE domain containing 27 10q24.2 AD Uncomplicated HSP SLC33A1 SPG42 Solute carrier family 33 (acetyl-CoA transporter), member 1 3q25.31 AD Uncomplicated HSP CYP7B1 SPG5A Cytochrome P450, family 7, subfamily B, polypeptide 1 8q21.3 AR Uncomplicated HSP SPG7 SPG7 Spastic paraplegia 7 16q24.3 AR Uncomplicated HSP SPG11 SPG11 Spastic paraplegia 11 15q14 AR Complicated HSP ZFYVE26 SPG15 Zinc finger, FYVE domain containing 26 14q24.1 AR Complicated HSP ERLIN2 SPG18 ER lipid raft associated 2 8p11.2 AR Complicated HSP SPG20 SPG20 Spastic paraplegia 20 13q13.3 AR Complicated HSP SPG21 SPG21 Spastic paraplegia 21 15q22.31 AR Complicated or uncomplicated HSP DDHD1 SPG28 DDHD domain containing 1 14q21 AR Complicated HSP KIF1A SPG30 Kinesin family member 1A 2q37.3 AR Complicated HSP FA2H SPG35 Fatty acid 2-hydroxylase 16q23 AR Complicated HSP PNPLA6 SPG39 Patatin-like phospholipase domain containing 6 19p13.2 AR Complicated HSP GJC2 SPG44 Gap junction protein, gamma 2 1q42.13 AR Complicated HSP GBA2 SPG46 Glucosidase, beta (bile acid) 2 9p13.3 AR Complicated HSP AP4B1 SPG47 Adapter-related protein complex 4, beta 1 subunit 1p13.2 AR Uncomplicated HSP AP5Z1 SPG48 Adaptor-related protein complex 5, zeta 1 subunit 7p22.2 AR Complicated HSP TECPR2 SPG49 Tectonin beta-propeller repeat-containing 2 14q32.31 AR Complicated HSP AP4M1 SPG50 Adapter-related protein complex 4, mu 1 subunit 7q22.1 AR Complicated HSP AP4E1 SPG51 Adaptor-related protein complex 4, epsilon 1 subunit 15q21.2 AR Complicated HSP AP4S1 SPG52 Adaptor-related protein complex 4, sigma 1 subunit 14q12 AR Complicated HSP VPS37A SPG53 Vacuolar protein sorting 37 homolog A 8p22 AR Complicated HSP DDHD2 SPG54 DDHD domain containing 2 8p11.23 AR Complicated HSP CYP2U1 SPG56 Cytochrome P450, family 2, subfamily U, polypeptide 1 4q25 AR Complicated HSP GAD1 N/A Glutamate decarboxylase 1 2q31 AR Complicated HSP L1CAM SPG1 L1 cell adhesion molecule Xq28 X-linked Complicated HSP PLP1 SPG2 Proteolipid protein 1 Xq22 X-linked Complicated HSP SLC16A2 SPG22 Solute carrier family 16, member 2 Xq13.2 X-linked

* Abbreviations: AD, autosomal dominant; AR, autosomal recessive; N/A, not applicable.

Other disease-related genes for differential diagnosis of ALS phenotype gene gene description chromosomal location hereditary form Hexosaminadase A deficiency HEXA Hexosaminidase A 15q24.1 AR Adult polyglucosan body disease GBE1 Glucan (1,4-alpha-), branching enzyme 1 3p12.3 AR

Sanger sequencing to evaluate variant validity

Novel mutations leading to substitution of all amino acids according to the filtering criteria were evaluated by Sanger sequencing of paternal, maternal and progenitor DNA samples. All exon and exon-intron boundaries of the target gene were amplified by PCR using primers (Table 6). PCR was performed using the gene amplifier model GeneAmp PCR system 9700 (Applied Biosytems, Foster City, CA) under the following conditions: 32 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. . Amplicon (5 μl) was treated with 2U shrimp alkaline phosphatase and 10U exonuclease I (USB Corp., Cleveland, OH) at 37° C. for 15 minutes, and then incubated at 80° C. for 15 minutes to inactivate the enzyme. did it Cycle sequencing was performed using the Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA) in ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Mutations were named according to the reference sequence of GenBank. In the present invention, the notation for mutation followed the recommendation of the Human Genome Variation Association (http://www.hgvs.org/mutnomen/) in which the nucleotide corresponding to A of the ATG start codon is denoted by +1.

Primer pairs for verification of Sanger sequencing for mutations detected by whole-exome sequencing gene Nucleotide Variation RefSeq primer sequence order
number LATS1 c.2790del NM_004690.3 forward GGCTAGGAAGTAGGCATGGA 4 reverse CTCATCAAATCCAGCAGCTT 5

Example 1: Descriptive statistics for Q.C analysis and exome sequencing

Whole exome sequencing of one ALS progenitor and their healthy parents (n=3) was performed using the Agilent SureSelect all Exon kit 50Mb (Agilent). Total reads of over 50,000,000 bp on average were obtained per individual. All samples from one progenitor and his parents averaged 106x. For each individual, an average of 99.7% of target bases were processed by at least one independent sequence read, 98.2% were processed by at least 10 independent sequence reads, and 95.2% were processed by at least 20 independent sequence reads became (Table 7).

No mutations were found in previously reported ALS-FTD causes or related genes, HSP for differential diagnosis of ALS, and other disease genes (Table 2-5).

Statistical summary for exome sequencing Trio No. Total reads Mean coverage depth % target at 1X % target at 10X % target at 20X 1-P 5794209366 115.0 99.7 98.3 95.6 1-F 5281382264 104.8 99.8 98.1 94.9 1-M 4973166242 98.7 99.7 98.2 95.2

P is the patient (initiator), F is the patient's father (normal), M is the patient's mother (normal)

Example 2: Discovery of novel variants of unknown significance (VUS)

After confirming the mutations using Sanger sequencing, the present inventors discovered one novel variants of unknown significance (VUS) from the sALS trio ( FIGS. 2 and 3 ). In this mutation, the 2790th nucleotide sequence of the LATS1 gene is deleted, and leucine, the 930th amino acid among the amino acid sequence of the normal protein LATS1 having the amino acid sequence of SEQ ID NO: 2, is substituted with phenylalanine, and protein synthesis is performed at the 27th (956th) therefrom. The frameshift mutation that ends. The LATS1 mutant protein expressed by mutation of the LATS1 gene is represented by the amino acid sequence of SEQ ID NO: 3.

This novel VUS was not found in dbSNP, 1000 Genome Project (total and East Asian allele frequencies), gnomAD. Also, it was not found in KRGDB, which is the data of a normal control group of Koreans with matching race. The experimental analysis results suggest that the LATS1 gene is the causative gene for sALS (Table 8).

Frequency within the population of new variants identified in the sALS trio Trio
No. Gene RefSeq Nucleotide
change amino acid change rs number Allele frequency KRGDB dbSNP 1000
Genome 1000
Genome
(EA) gnomAD One LATS1 NM_004690.3 c.2790del p.Leu930Phefs*27 N/A N/A N/A N/A N/A N/A

N/A, not applicable. EA, East Asian; gnomAD, genomic aggregation database

<110> Green Cross Genome Corporation <120> LATS1 Gene Mutation Marker Based Diagnosis of Amyotrophic Lateral Sclerosis <130> P19-B313 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 3393 <212> DNA <213> Artificial Sequence <220> <223> Homo sapiens large tumor suppressor kinase 1 (LATS1) cDNA <400> 1 atgaagagga gtgaaaagcc agaaggatat agacaaatga ggcctaagac ctttcctgcc 60 agtaactata ctgtcagtag ccggcaaatg ttacaagaaa ttcgggaatc ccttaggaat 120 ttatctaaac catctgatgc tgctaaggct gagcataaca tgagtaaaat gtcaaccgaa 180 gatcctcgac aagtcagaaa tccacccaaa tttgggacgc atcataaagc cttgcaggaa 240 attcgaaact ctctgcttcc atttgcaaat gaaacaaatt cttctcggag tacttcagaa 300 gttaatccac aaatgcttca agacttgcaa gctgctggat ttgatgagga tatggttata 360 caagctcttc agaaaactaa caacagaagt atagaagcag caattgaatt cattagtaaa 420 atgagttacc aagatcctcg acgagagcag atggctgcag cagctgccag acctattaat 480 gccagcatga aaccagggaa tgtgcagcaa tcagttaacc gcaaacagag ctggaaaggt 540 tctaaagaat ccttagttcc tcagaggcat ggcccgccac taggagaaag tgtggcctat 600 cattctgaga gtcccaactc acagacagat gtaggaagac ctttgtctgg atctggtata 660 tcagcatttg ttcaagctca ccctagcaac ggacagagag tgaacccccc accaccacct 720 caagtaagga gtgttactcc tccaccacct ccaagaggcc agactccccc tccaagaggt 780 acaactccac ctcccccttc atgggaacca aactctcaaa caaagcgcta ttctggaaac 840 atggaatacg taatctcccg aatctctcct gtcccacctg gggcatggca agagggctat 900 cctccaccac ctctcaacac ttcccccatg aatcctccta atcaaggaca gagaggcatt 960 agttctgttc ctgttggcag acaaccaatc atcatgcaga gttctagcaa atttaacttt 1020 ccatcaggga gacctggaat gcagaatggt actggacaaa ctgatttcat gatacaccaa 1080 aatgttgtcc ctgctggcac tgtgaatcgg cagccaccac ctccatatcc tctgacagca 1140 gctaatggac aaagcccttc tgctttacaa acagggggat ctgctgctcc ttcgtcatat 1200 acaaatggaa gtattcctca gtctatgatg gtgccaaaca gaaatagtca taacatggaa 1260 ctatataaca ttagtgtacc tggactgcaa acaaattggc ctcagtcatc ttctgctcca 1320 gcccagtcat ccccgagcag tgggcatgaa atccctacat ggcaacctaa cataccagtg 1380 aggtcaaatt cttttaataa cccattagga aatagagcaa gtcactctgc taattctcag 1440 ccttctgcta caacagtcac tgcaattaca ccagctccta ttcaacagcc tgtgaaaagt 1500 atgcgtgtat taaaaccaga gctacagact gctttagcac ctacacaccc ttcttggata 1560 ccacagccaa ttcaaactgt tcaacccagt ccttttcctg agggaaccgc ttcaaatgtg 1620 actgtgatgc cacctgttgc tgaagctcca aactatcaag gaccaccacc accctaccca 1680 aaacatctgc tgcaccaaaa cccatctgtt cctccatacg agtcaatcag taagcctagc 1740 aaagaggatc agccaagctt gcccaaggaa gatgagagtg aaaagagtta tgaaaatgtt 1800 gatagtgggg ataaagaaaa gaaacagatt acaacttcac ctattactgt taggaaaaac 1860 aagaaagatg aagagcgaag ggaatctcgt attcaaagtt attctcctca agcatttaaa 1920 ttctttatgg agcaacatgt agaaaatgta ctcaaatctc atcagcagcg tctacatcgt 1980 aaaaaacaat tagagaatga aatgatgcgg gttggattat ctcaagatgc ccaggatcaa 2040 atgagaaaga tgctttgcca aaaagaatct aattacatcc gtcttaaaag ggctaaaatg 2100 gacaagtcta tgtttgtgaa gataaagaca ctaggaatag gagcatttgg tgaagtctgt 2160 ctagcaagaa aagtagatac taaggctttg tatgcaacaa aaactcttcg aaagaaagat 2220 gttcttcttc gaaatcaagt cgctcatgtt aaggctgaga gagatatcct ggctgaagct 2280 gacaatgaat gggtagttcg tctatattat tcattccaag ataaggacaa tttatacttt 2340 gtaatggact acattcctgg gggtgatatg atgagcctat taattagaat gggcatcttt 2400 ccagaaagtc tggcacgatt ctacatagca gaacttacct gtgcagttga aagtgttcat 2460 aaaatgggtt ttattcatag agatattaaa cctgataata ttttgattga tcgtgatggt 2520 catattaaat tgactgactt tggcctctgc actggcttca gatggacaca cgattctaag 2580 tactatcaga gtggtgacca tccacggcaa gatagcatgg atttcagtaa tgaatggggg 2640 gatccctcaa gctgtcgatg tggagacaga ctgaagccat tagagcggag agctgcacgc 2700 cagcaccagc gatgtctagc acattctttg gttgggactc ccaattatat tgcacctgaa 2760 gtgttgctac gaacaggata cacacagttg tgtgattggt ggagtgttgg tgttattctt 2820 tttgaaatgt tggtgggaca acctcctttc ttggcacaaa caccattaga aacacaaatg 2880 aaggttatca actggcaaac atctcttcac attccaccac aagctaaact cagtcctgaa 2940 gcttctgatc ttattattaa actttgccga ggacccgaag atcgcttagg caagaatggt 3000 gctgatgaaa taaaagctca tccatttttt aaaacaattg acttctccag tgacctgaga 3060 cagcagtctg cttcatacat tcctaaaatc acacacccaa cagatacatc aaattttgat 3120 cctgttgatc ctgataaatt atggagtgat gataacgagg aagaaaatgt aaatgacact 3180 ctcaatggat ggtataaaaa tggaaagcat cctgaacatg cattctatga atttaccttc 3240 cgaaggtttt ttgatgacaa tggctaccca tataattatc cgaagcctat tgaatatgaa 3300 tacattaatt cacaaggctc agagcagcag tcggatgaag atgatcaaaa cacaggctca 3360 gagattaaaa atcgcgatct agtatatgtt taa 3393 <210> 2 <211> 1130 <212> PRT <213> Artificial Sequence <220> <223> Homo sapiens serine/threonine-protein kinase LATS1 isoform 1 <400> 2 Met Lys Arg Ser Glu Lys Pro Glu Gly Tyr Arg Gln Met Arg Pro Lys 1 5 10 15 Thr Phe Pro Ala Ser Asn Tyr Thr Val Ser Ser Arg Gln Met Leu Gln 20 25 30 Glu Ile Arg Glu Ser Leu Arg Asn Leu Ser Lys Pro Ser Asp Ala Ala 35 40 45 Lys Ala Glu His Asn Met Ser Lys Met Ser Thr Glu Asp Pro Arg Gln 50 55 60 Val Arg Asn Pro Pro Lys Phe Gly Thr His His Lys Ala Leu Gln Glu 65 70 75 80 Ile Arg Asn Ser Leu Leu Pro Phe Ala Asn Glu Thr Asn Ser Ser Arg 85 90 95 Ser Thr Ser Glu Val Asn Pro Gln Met Leu Gln Asp Leu Gln Ala Ala 100 105 110 Gly Phe Asp Glu Asp Met Val Ile Gln Ala Leu Gln Lys Thr Asn Asn 115 120 125 Arg Ser Ile Glu Ala Ala Ile Glu Phe Ile Ser Lys Met Ser Tyr Gln 130 135 140 Asp Pro Arg Arg Glu Gln Met Ala Ala Ala Ala Ala Arg Pro Ile Asn 145 150 155 160 Ala Ser Met Lys Pro Gly Asn Val Gln Gln Ser Val Asn Arg Lys Gln 165 170 175 Ser Trp Lys Gly Ser Lys Glu Ser Leu Val Pro Gln Arg His Gly Pro 180 185 190 Pro Leu Gly Glu Ser Val Ala Tyr His Ser Glu Ser Pro Asn Ser Gln 195 200 205 Thr Asp Val Gly Arg Pro Leu Ser Gly Ser Gly Ile Ser Ala Phe Val 210 215 220 Gln Ala His Pro Ser Asn Gly Gln Arg Val Asn Pro Pro Pro Pro Pro 225 230 235 240 Gln Val Arg Ser Val Thr Pro Pro Pro Pro Pro Arg Gly Gln Thr Pro 245 250 255 Pro Pro Arg Gly Thr Thr Pro Pro Pro Pro Ser Trp Glu Pro Asn Ser 260 265 270 Gln Thr Lys Arg Tyr Ser Gly Asn Met Glu Tyr Val Ile Ser Arg Ile 275 280 285 Ser Pro Val Pro Pro Gly Ala Trp Gln Glu Gly Tyr Pro Pro Pro Pro 290 295 300 Leu Asn Thr Ser Pro Met Asn Pro Pro Asn Gln Gly Gln Arg Gly Ile 305 310 315 320 Ser Ser Val Pro Val Gly Arg Gln Pro Ile Ile Met Gln Ser Ser Ser 325 330 335 Lys Phe Asn Phe Pro Ser Gly Arg Pro Gly Met Gln Asn Gly Thr Gly 340 345 350 Gln Thr Asp Phe Met Ile His Gln Asn Val Val Pro Ala Gly Thr Val 355 360 365 Asn Arg Gln Pro Pro Pro Pro Tyr Pro Leu Thr Ala Ala Asn Gly Gln 370 375 380 Ser Pro Ser Ala Leu Gln Thr Gly Gly Ser Ala Ala Pro Ser Ser Tyr 385 390 395 400 Thr Asn Gly Ser Ile Pro Gln Ser Met Met Val Pro Asn Arg Asn Ser 405 410 415 His Asn Met Glu Leu Tyr Asn Ile Ser Val Pro Gly Leu Gln Thr Asn 420 425 430 Trp Pro Gln Ser Ser Ser Ala Pro Ala Gln Ser Ser Pro Ser Ser Ser Gly 435 440 445 His Glu Ile Pro Thr Trp Gln Pro Asn Ile Pro Val Arg Ser Asn Ser 450 455 460 Phe Asn Asn Pro Leu Gly Asn Arg Ala Ser His Ser Ala Asn Ser Gln 465 470 475 480 Pro Ser Ala Thr Thr Val Thr Ala Ile Thr Pro Ala Pro Ile Gln Gln 485 490 495 Pro Val Lys Ser Met Arg Val Leu Lys Pro Glu Leu Gln Thr Ala Leu 500 505 510 Ala Pro Thr His Pro Ser Trp Ile Pro Gln Pro Ile Gln Thr Val Gln 515 520 525 Pro Ser Pro Phe Pro Glu Gly Thr Ala Ser Asn Val Thr Val Met Pro 530 535 540 Pro Val Ala Glu Ala Pro Asn Tyr Gln Gly Pro Pro Pro Pro Tyr Pro 545 550 555 560 Lys His Leu Leu His Gln Asn Pro Ser Val Pro Tyr Glu Ser Ile 565 570 575 Ser Lys Pro Ser Lys Glu Asp Gln Pro Ser Leu Pro Lys Glu Asp Glu 580 585 590 Ser Glu Lys Ser Tyr Glu Asn Val Asp Ser Gly Asp Lys Glu Lys Lys 595 600 605 Gln Ile Thr Thr Ser Pro Ile Thr Val Arg Lys Asn Lys Lys Asp Glu 610 615 620 Glu Arg Arg Glu Ser Arg Ile Gln Ser Tyr Ser Pro Gln Ala Phe Lys 625 630 635 640 Phe Phe Met Glu Gln His Val Glu Asn Val Leu Lys Ser His Gln Gln 645 650 655 Arg Leu His Arg Lys Lys Gln Leu Glu Asn Glu Met Met Arg Val Gly 660 665 670 Leu Ser Gln Asp Ala Gln Asp Gln Met Arg Lys Met Leu Cys Gln Lys 675 680 685 Glu Ser Asn Tyr Ile Arg Leu Lys Arg Ala Lys Met Asp Lys Ser Met 690 695 700 Phe Val Lys Ile Lys Thr Leu Gly Ile Gly Ala Phe Gly Glu Val Cys 705 710 715 720 Leu Ala Arg Lys Val Asp Thr Lys Ala Leu Tyr Ala Thr Lys Thr Leu 725 730 735 Arg Lys Lys Asp Val Leu Leu Arg Asn Gln Val Ala His Val Lys Ala 740 745 750 Glu Arg Asp Ile Leu Ala Glu Ala Asp Asn Glu Trp Val Val Arg Leu 755 760 765 Tyr Tyr Ser Phe Gln Asp Lys Asp Asn Leu Tyr Phe Val Met Asp Tyr 770 775 780 Ile Pro Gly Gly Asp Met Met Ser Leu Leu Ile Arg Met Gly Ile Phe 785 790 795 800 Pro Glu Ser Leu Ala Arg Phe Tyr Ile Ala Glu Leu Thr Cys Ala Val 805 810 815 Glu Ser Val His Lys Met Gly Phe Ile His Arg Asp Ile Lys Pro Asp 820 825 830 Asn Ile Leu Ile Asp Arg Asp Gly His Ile Lys Leu Thr Asp Phe Gly 835 840 845 Leu Cys Thr Gly Phe Arg Trp Thr His Asp Ser Lys Tyr Tyr Gln Ser 850 855 860 Gly Asp His Pro Arg Gln Asp Ser Met Asp Phe Ser Asn Glu Trp Gly 865 870 875 880 Asp Pro Ser Ser Cys Arg Cys Gly Asp Arg Leu Lys Pro Leu Glu Arg 885 890 895 Arg Ala Ala Arg Gln His Gln Arg Cys Leu Ala His Ser Leu Val Gly 900 905 910 Thr Pro Asn Tyr Ile Ala Pro Glu Val Leu Leu Arg Thr Gly Tyr Thr 915 920 925 Gln Leu Cys Asp Trp Trp Ser Val Gly Val Ile Leu Phe Glu Met Leu 930 935 940 Val Gly Gln Pro Pro Phe Leu Ala Gln Thr Pro Leu Glu Thr Gln Met 945 950 955 960 Lys Val Ile Asn Trp Gln Thr Ser Leu His Ile Pro Gln Ala Lys 965 970 975 Leu Ser Pro Glu Ala Ser Asp Leu Ile Ile Lys Leu Cys Arg Gly Pro 980 985 990 Glu Asp Arg Leu Gly Lys Asn Gly Ala Asp Glu Ile Lys Ala His Pro 995 1000 1005 Phe Phe Lys Thr Ile Asp Phe Ser Ser Asp Leu Arg Gln Gln Ser Ala 1010 1015 1020 Ser Tyr Ile Pro Lys Ile Thr His Pro Thr Asp Thr Ser Asn Phe Asp 1025 1030 1035 1040 Pro Val Asp Pro Asp Lys Leu Trp Ser Asp Asp Asn Glu Glu Glu Asn 1045 1050 1055 Val Asn Asp Thr Leu Asn Gly Trp Tyr Lys Asn Gly Lys His Pro Glu 1060 1065 1070 His Ala Phe Tyr Glu Phe Thr Phe Arg Arg Phe Phe Asp Asp Asn Gly 1075 1080 1085 Tyr Pro Tyr Asn Tyr Pro Lys Pro Ile Glu Tyr Glu Tyr Ile Asn Ser 1090 1095 1100 Gln Gly Ser Glu Gln Gln Ser Asp Glu Asp Asp Gln Asn Thr Gly Ser 1105 1110 1115 1120 Glu Ile Lys Asn Arg Asp Leu Val Tyr Val 1125 1130 <210> 3 <211> 955 <212> PRT <213> Artificial Sequence <220> <223> Homo sapiens serine/threonine-protein kinase LATS1 Variant <400> 3 Met Lys Arg Ser Glu Lys Pro Glu Gly Tyr Arg Gln Met Arg Pro Lys 1 5 10 15 Thr Phe Pro Ala Ser Asn Tyr Thr Val Ser Ser Arg Gln Met Leu Gln 20 25 30 Glu Ile Arg Glu Ser Leu Arg Asn Leu Ser Lys Pro Ser Asp Ala Ala 35 40 45 Lys Ala Glu His Asn Met Ser Lys Met Ser Thr Glu Asp Pro Arg Gln 50 55 60 Val Arg Asn Pro Pro Lys Phe Gly Thr His His Lys Ala Leu Gln Glu 65 70 75 80 Ile Arg Asn Ser Leu Leu Pro Phe Ala Asn Glu Thr Asn Ser Ser Arg 85 90 95 Ser Thr Ser Glu Val Asn Pro Gln Met Leu Gln Asp Leu Gln Ala Ala 100 105 110 Gly Phe Asp Glu Asp Met Val Ile Gln Ala Leu Gln Lys Thr Asn Asn 115 120 125 Arg Ser Ile Glu Ala Ala Ile Glu Phe Ile Ser Lys Met Ser Tyr Gln 130 135 140 Asp Pro Arg Arg Glu Gln Met Ala Ala Ala Ala Ala Arg Pro Ile Asn 145 150 155 160 Ala Ser Met Lys Pro Gly Asn Val Gln Gln Ser Val Asn Arg Lys Gln 165 170 175 Ser Trp Lys Gly Ser Lys Glu Ser Leu Val Pro Gln Arg His Gly Pro 180 185 190 Pro Leu Gly Glu Ser Val Ala Tyr His Ser Glu Ser Pro Asn Ser Gln 195 200 205 Thr Asp Val Gly Arg Pro Leu Ser Gly Ser Gly Ile Ser Ala Phe Val 210 215 220 Gln Ala His Pro Ser Asn Gly Gln Arg Val Asn Pro Pro Pro Pro Pro 225 230 235 240 Gln Val Arg Ser Val Thr Pro Pro Pro Pro Pro Arg Gly Gln Thr Pro 245 250 255 Pro Pro Arg Gly Thr Thr Pro Pro Pro Pro Ser Trp Glu Pro Asn Ser 260 265 270 Gln Thr Lys Arg Tyr Ser Gly Asn Met Glu Tyr Val Ile Ser Arg Ile 275 280 285 Ser Pro Val Pro Pro Gly Ala Trp Gln Glu Gly Tyr Pro Pro Pro Pro 290 295 300 Leu Asn Thr Ser Pro Met Asn Pro Pro Asn Gln Gly Gln Arg Gly Ile 305 310 315 320 Ser Ser Val Pro Val Gly Arg Gln Pro Ile Ile Met Gln Ser Ser Ser 325 330 335 Lys Phe Asn Phe Pro Ser Gly Arg Pro Gly Met Gln Asn Gly Thr Gly 340 345 350 Gln Thr Asp Phe Met Ile His Gln Asn Val Val Pro Ala Gly Thr Val 355 360 365 Asn Arg Gln Pro Pro Pro Pro Tyr Pro Leu Thr Ala Ala Asn Gly Gln 370 375 380 Ser Pro Ser Ala Leu Gln Thr Gly Gly Ser Ala Ala Pro Ser Ser Tyr 385 390 395 400 Thr Asn Gly Ser Ile Pro Gln Ser Met Met Val Pro Asn Arg Asn Ser 405 410 415 His Asn Met Glu Leu Tyr Asn Ile Ser Val Pro Gly Leu Gln Thr Asn 420 425 430 Trp Pro Gln Ser Ser Ser Ala Pro Ala Gln Ser Ser Pro Ser Ser Ser Gly 435 440 445 His Glu Ile Pro Thr Trp Gln Pro Asn Ile Pro Val Arg Ser Asn Ser 450 455 460 Phe Asn Asn Pro Leu Gly Asn Arg Ala Ser His Ser Ala Asn Ser Gln 465 470 475 480 Pro Ser Ala Thr Thr Val Thr Ala Ile Thr Pro Ala Pro Ile Gln Gln 485 490 495 Pro Val Lys Ser Met Arg Val Leu Lys Pro Glu Leu Gln Thr Ala Leu 500 505 510 Ala Pro Thr His Pro Ser Trp Ile Pro Gln Pro Ile Gln Thr Val Gln 515 520 525 Pro Ser Pro Phe Pro Glu Gly Thr Ala Ser Asn Val Thr Val Met Pro 530 535 540 Pro Val Ala Glu Ala Pro Asn Tyr Gln Gly Pro Pro Pro Pro Tyr Pro 545 550 555 560 Lys His Leu Leu His Gln Asn Pro Ser Val Pro Tyr Glu Ser Ile 565 570 575 Ser Lys Pro Ser Lys Glu Asp Gln Pro Ser Leu Pro Lys Glu Asp Glu 580 585 590 Ser Glu Lys Ser Tyr Glu Asn Val Asp Ser Gly Asp Lys Glu Lys Lys 595 600 605 Gln Ile Thr Thr Ser Pro Ile Thr Val Arg Lys Asn Lys Lys Asp Glu 610 615 620 Glu Arg Arg Glu Ser Arg Ile Gln Ser Tyr Ser Pro Gln Ala Phe Lys 625 630 635 640 Phe Phe Met Glu Gln His Val Glu Asn Val Leu Lys Ser His Gln Gln 645 650 655 Arg Leu His Arg Lys Lys Gln Leu Glu Asn Glu Met Met Arg Val Gly 660 665 670 Leu Ser Gln Asp Ala Gln Asp Gln Met Arg Lys Met Leu Cys Gln Lys 675 680 685 Glu Ser Asn Tyr Ile Arg Leu Lys Arg Ala Lys Met Asp Lys Ser Met 690 695 700 Phe Val Lys Ile Lys Thr Leu Gly Ile Gly Ala Phe Gly Glu Val Cys 705 710 715 720 Leu Ala Arg Lys Val Asp Thr Lys Ala Leu Tyr Ala Thr Lys Thr Leu 725 730 735 Arg Lys Lys Asp Val Leu Leu Arg Asn Gln Val Ala His Val Lys Ala 740 745 750 Glu Arg Asp Ile Leu Ala Glu Ala Asp Asn Glu Trp Val Val Arg Leu 755 760 765 Tyr Tyr Ser Phe Gln Asp Lys Asp Asn Leu Tyr Phe Val Met Asp Tyr 770 775 780 Ile Pro Gly Gly Asp Met Met Ser Leu Leu Ile Arg Met Gly Ile Phe 785 790 795 800 Pro Glu Ser Leu Ala Arg Phe Tyr Ile Ala Glu Leu Thr Cys Ala Val 805 810 815 Glu Ser Val His Lys Met Gly Phe Ile His Arg Asp Ile Lys Pro Asp 820 825 830 Asn Ile Leu Ile Asp Arg Asp Gly His Ile Lys Leu Thr Asp Phe Gly 835 840 845 Leu Cys Thr Gly Phe Arg Trp Thr His Asp Ser Lys Tyr Tyr Gln Ser 850 855 860 Gly Asp His Pro Arg Gln Asp Ser Met Asp Phe Ser Asn Glu Trp Gly 865 870 875 880 Asp Pro Ser Ser Cys Arg Cys Gly Asp Arg Leu Lys Pro Leu Glu Arg 885 890 895 Arg Ala Ala Arg Gln His Gln Arg Cys Leu Ala His Ser Leu Val Gly 900 905 910 Thr Pro Asn Tyr Ile Ala Pro Glu Val Leu Leu Arg Thr Gly Tyr Thr 915 920 925 Gln Phe Val Ile Gly Gly Val Leu Val Leu Phe Phe Leu Lys Cys Trp 930 935 940 Trp Asp Asn Leu Leu Ser Trp His Lys His His 945 950 955 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LATS1 SNV (c.2790del) primer Forward <400> 4 ggctaggaag taggcatgga 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LATS1 SNV (c.2790del) primer Reverse <400> 5 ctcatcaaat ccagcagctt 20

Claims (15)

In the isolated biological sample, LATS1 (Large tumor suppressor kinase 1) mutant gene or LATS1 encoded by the LATS1 mutant gene A method for providing information for diagnosis of amyotrophic lateral sclerosis (ALS), comprising the step of detecting a mutated protein.
According to claim 1, wherein the LATS1 mutant gene is a single nucleotide variant (Single Nucleotide variant: SNV), insertion or deletion (Indel), and any one or more selected from the group consisting of copy-number variation (CNV) An information providing method for the diagnosis of amyotrophic lateral sclerosis (ALS), characterized in that the mutation has occurred.
According to claim 1, wherein the LATS1 (Large tumor suppressor kinase 1) mutant gene,
In the nucleotide sequence of SEQ ID NO: 1, the gene in which the 2790th base is deleted; or
Information providing method, characterized in that the gene encoding the protein represented by the amino acid sequence of SEQ ID NO: 3.
According to claim 1, wherein detecting the LATS1 mutant gene amplifies the gene,
An information providing method, characterized in that the gene mutation is analyzed using sequencing data of the amplified product.
The method of claim 1, wherein a primer capable of specifically amplifying the mutation site of the LATS1 mutant gene or
An information providing method, characterized in that the detection is performed using a probe that complementarily binds to the region including the mutation site of the LATS1 mutant gene.
The LATS1 according to claim 1, which is encoded by the LATS1 mutant gene. The mutant protein is
In the nucleotide sequence of SEQ ID NO: 1, a protein encoded by a gene in which the 2790th base is deleted; or
Information providing method, characterized in that the protein represented by the amino acid sequence of SEQ ID NO: 3.
The LATS1 according to claim 1, which is encoded by the LATS1 mutant gene. The step of detecting the mutant protein is an information providing method, characterized in that the detection using an antibody or aptamer specific for the mutant protein.
As a diagnostic marker of amyotrophic lateral sclerosis, LATS1 (Large tumor) containing at least one of single nucleotide variant (SNV), insertion or deletion (Indel), and copy-number variation (CNV) suppressor kinase 1) mutant gene.
The mutant gene according to claim 8, wherein the LATS1 mutant gene has the 2790th nucleotide deleted from the nucleotide sequence of SEQ ID NO: 1.
As a diagnostic marker for amyotrophic lateral sclerosis, LATS1 (Large tumor) containing at least one of single nucleotide variant (SNV), insertion or deletion (Indel), and copy-number variation (CNV) suppressor kinase 1) LATS1 mutant protein encoded by mutant gene.
11. The method of claim 10, wherein the LATS1 mutant protein,
In the nucleotide sequence of SEQ ID NO: 1, a protein encoded by a gene in which the 2790th base is deleted; Or a protein characterized in that the protein represented by the amino acid sequence of SEQ ID NO: 3.
A composition for diagnosis of amyotrophic lateral sclerosis comprising an agent capable of detecting a large tumor suppressor kinase 1 ( LATS1) mutant gene or a LATS1 mutant protein encoded by the LATS1 mutant gene.
The method of claim 12, wherein the formulation is characterized in that in the region containing the mutation occurs region of LATS1 variation Mutagenic capable of amplifying the region with specific primers or LATS1 mutant gene of a gene comprising a probe that binds complementarily composition to do.
The composition according to claim 12, wherein the agent comprises an antibody or aptamer specific for the LATS1 mutant protein.
A kit for diagnosis of amyotrophic lateral sclerosis, comprising an agent capable of detecting a large tumor suppressor kinase 1 ( LATS1) mutant gene or a LATS1 mutant protein encoded by the LATS1 mutant gene.

Images