CN113215169A

CN113215169A - TIMM44 mutant gene, primer, kit and method for detecting same and application thereof

Info

Publication number: CN113215169A
Application number: CN202110567406.8A
Authority: CN
Inventors: 王开宇; 马鑫瑞
Original assignee: Fuzhou Furui Medical Laboratory Co ltd
Current assignee: Fuzhou Furui Medical Laboratory Co ltd
Priority date: 2021-05-24
Filing date: 2021-05-24
Publication date: 2021-08-06

Abstract

The invention relates to a TIMM44 mutant gene related to LIMD, a primer, a kit, a method for detecting the same and application thereof, wherein compared with GRCh37, the mutant TIMM44 gene has one of the following mutations: the base with the physical position of No. 19 chromosome 7998976 is mutated from G to A, and the base with the physical position of No. 19 chromosome 7997541 is mutated from C to A; the cDNA sequence of the mutant TIMM44 gene has one of the following mutations compared with the sequence of SEQ ID NO. 1: c.541C > T, c.958G > T; the sequence of the mutant TIMM44 protein has one of the following mutations compared to the sequence of SEQ ID No. 2: p.Gln181Ter, p.Glu320Ter. The invention provides important basis for early molecular screening and family genetic research of LIMD.

Description

TIMM44 mutant gene, primer, kit and method for detecting same and application thereof

Technical Field

The invention relates to disease-related mutant genes, in particular to a TIMM44 mutant gene, a primer, a kit and a method for detecting the same and application thereof.

Background

The incidence of mitochondrial disease is highest among all inherited metabolic diseases. Mitochondria are primarily responsible for oxidative phosphorylation to produce adenosine triphosphate. The pathogenesis of mitochondrial diseases involves two distinct genomes: nuclear genome and maternal inherited 16.6kb mitochondrial genome. Mitochondrial diseases can be caused by mutations in any of these genomes. Defects in nuclear dna (ndna) can lead to problems such as respiratory chain complex structure, translation, and mitochondrial dna (mtdna) repair defects. Of the mitochondrial diseases diagnosed in childhood, about 25% are due to mitochondrial DNA abnormalities, while the remaining 75% are due to nDNA defects. Severe neonatal or infant onset mitochondrial disease usually leads to death within one year of birth, and infant lethal mitochondrial disease (LIMD) accounts for about 8.5% of cases with childhood onset mitochondrial disease, but LIMD has a low molecular genetic diagnosis rate, and most LIMD cases are diagnosed by biochemical and genetic methods after death of the subject. Thus, when parents become pregnant again, such neonatal onset of severe mitochondrial disease may reoccur due to a diagnosis that is not timely. Although nearly thousands of nuclear genomic genes have been found to be involved in mitochondrial function, only a small proportion have been implicated in the development of LIMD, suggesting that there are new LIMD virulence genes to be exploited.

Disclosure of Invention

The invention aims to provide a TIMM44 mutant gene related to infantile lethal mitochondrial diseases, a primer, a kit and a method for detecting the same and application thereof.

The purpose of the invention is realized by the following technical scheme:

a mutant TIMM44 gene or a mutant TIMM44 protein, the mutant TIMM44 gene having at least one of the following mutations compared to a human genomic reference sequence GRCh 37:

the base with the physical position of No. 19 chromosome 7998976 is mutated from G to A, and the base with the physical position of No. 19 chromosome 7997541 is mutated from C to A;

the cDNA sequence of the mutant TIMM44 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.541C>T、c.958G>T；

the sequence of the mutant TIMM44 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

p.Gln181Ter (glutamine 181 to stop codon), p.Glu320Ter (glutamic acid 320 to stop codon).

The TRANSLOCASE OF INNER MITOCHONDRAL MEMBRANE 44 (MITOCHONDRIAL INNER MEMBRANE TRANSLOCASE 44, TIMM44) gene is located on chromosome 19p13.2, contains 13 exons, and encodes TIMM44 protein with 452 amino acids and a molecular weight OF about 49 kDa. TIMM44 is an important component of the PAM complex, which is used to transfer proteins containing transit peptides from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. Mitochondrial HSP70 was localized to the mitochondrial matrix using ATP as an energy source. The carrier of the hybrid variation of the TIMM44 gene is found to have high risk of thyroid cancer in limited research, but whether the carrier is related to LIMD or not is not reported.

The gene of the wild-type TIMM44 gene in Ensemble database (www.ensembl.org) is encoded as ENSG00000104980, and is located on chromosome 19. The inventor utilizes genetic research screening in a large number of normal people and LIMD patient families to find that the gene mutation of TIMM44 gene can cause lethal mitochondrial diseases of infants. The invention provides a new pathogenic mutation site of a pathogenic gene and provides a new molecular biology basis for early molecular screening of the disease.

The first mutation and the second mutation are both positioned in a translation region, wherein the physical position of the first mutation is 7998976, and the base G is mutated into A; RNA level: the 541 st base of the cDNA sequence of the TIMM44 gene is mutated from C to T; protein level: the protein encoded by the TIMM44 gene has a glutamine-modified stop codon at amino acid 181.

The physical position of the second mutation is 7997541, the base is mutated from C to A, the RNA level: the 958 th base of the cDNA sequence of the TIMM44 gene is mutated from G to T; protein level: the protein encoded by the TIMM44 gene has a change from glutamic acid to a stop codon at amino acid position 320.

A method of detecting a mutant TIMM44 gene or a mutant TIMM44 protein for non-diagnostic purposes, the method comprising detecting the presence or absence of a mutation site in the TIMM44 gene or the TIMM44 protein;

the mutation site is at least one of the following:

chr19(GRCh37) g.7998976G > A, cDNA sequence occurrence c.541C > T, p.Gln181Ter (glutamine 181 to stop codon);

chr19(GRCh37): g.7997541C > A, cDNA sequence c.958G > T, p.Glu320Ter (glutamic acid at position 320 becomes a stop codon).

In some embodiments, the purpose of the non-diagnostic diseases described in the present invention includes, but is not limited to, studying SNP distribution and polypeptidases for family evolution studies. Such applications will be understood by those skilled in the art.

Some individuals carry the mutant TIMM44 gene of the invention but do not suffer from LIMD, e.g., a heterozygous genotype with only one chromosome carrying the mutation. The detection of this portion of the population may not be relevant for any purpose of diagnosing the disease, since these individuals are not themselves diseased. But the results of their detection can be used as useful information, for example as important indicators for pre-natal examinations, to guide fertility, or for mutation carrier screening, or as a tool for SNP distribution and polymorphism studies or to follow gene mutations or family evolution. Such applications are also understood by those skilled in the art. Thus, the methods of detecting a mutant TIMM44 gene or a mutant TIMM44 protein provided by the present invention involve detecting heterozygous mutations.

However, the methods of the present invention for detecting a mutant TIMM44 gene or a mutant TIMM44 protein also include detecting a homozygous mutation.

In a preferred embodiment of the present invention, the method for detecting mutant TIMM44 gene or mutant TIMM44 protein comprises the following steps of PCR amplification using at least one set of primers:

TIMM44_ E5F: CCAGAGGACTCCTGCCCATTT (SEQ ID NO:3) and

TIMM44_E5R:CTCCGTTCTCTTCCGGAGTC(SEQ ID NO:4)；

TIMM44_ E9F: TTACGGACAAGGTCACCGAC (SEQ ID NO:5) and

TIMM44_E9R:TAAGCCCAACAAGGGTCTGG(SEQ ID NO:6)。

in a preferred embodiment of the present invention, the PCR reaction procedure using the primers for amplification comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

The method for detecting the mutant TIMM44 gene comprises the following steps:

(1) establishing a family clinical and genetic resource library of LIMD patients, collecting clinical information and blood samples of LIMD families, and extracting genome DNA;

(2) designing amplification and sequencing primers covering the whole exon sequence of the TIMM44 gene for sequencing;

(3) and comparing the sequencing results of the family samples of the normal person and the LIMD patient.

In one embodiment, the sequencing is a Sanger sequencing.

In other embodiments, the method for detecting a mutant TIMM44 gene described above may be performed by a technique selected from the group consisting of:

electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.

In other embodiments, methods of detecting mutations at exon and exon/intron boundaries of the TIMM44 gene are also contemplated, comprising the steps of:

(1) extracting a DNA sample from a subject;

(2) sequencing the exome and all exon/intron boundary sequences of the DNA sample to obtain sequencing fragments;

(3) and comparing the sequencing fragment with a reference sequence to obtain the exon and exon/intron boundary mutation of the gene.

A reagent for detecting a mutant TIMM44 gene, wherein the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant TIMM44 gene; the mutant TIMM44 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

c.541C>T、c.958G>T；

the region of the nucleic acid detection probe complementary to the mutant TIMM44 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 7998976 th, 7997541 th; the 541 st and 958 th cDNA sequences;

the primer is at least one group of primers with the following sequences:

TIMM44_ E5F: CCAGAGGACTCCTGCCCATTT (SEQ ID NO:3) and

TIMM44_E5R:CTCCGTTCTCTTCCGGAGTC(SEQ ID NO:4)；

TIMM44_ E9F: TTACGGACAAGGTCACCGAC (SEQ ID NO:5) and

TIMM44_E9R:TAAGCCCAACAAGGGTCTGG(SEQ ID NO:6)。

the nucleic acid detection probes enabled detection of the mutant TIMM44 gene by nucleic acid pairing with the complementary region of the mutant TIMM44 gene.

In other embodiments, the reagents for detecting the mutant TIMM44 gene further comprise buffers, enzymes, and inorganic salts.

And (3) amplifying the template DNA by using a primer for detecting the mutant TIMM44 gene, and carrying out mutation identification on an amplification product by sequencing or gel electrophoresis.

A kit for detecting a mutant TIMM44 gene, comprising the reagents.

In other embodiments, the kit for detecting a mutant TIMM44 gene further comprises a buffer and instructions for use.

The application of a reagent for detecting mutant TIMM44 gene or mutant TIMM44 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the detection reagent for the fatal mitochondrial diseases of the infants is a reagent for a gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for a restriction enzyme digestion method or a reagent for sequencing.

The reagent for gene chip may be a probe for cDNA chip.

The DNA amplification reagent may be a primer or a probe.

The reagent for reverse transcription amplification can be a reverse transcription amplification primer and a reverse transcription amplification buffer solution.

The reagent for the restriction enzyme cutting method can be a primer containing a restriction enzyme site and a seamless cloning buffer solution.

The sequencing reagent may be a primer or a detection buffer.

The application of a reagent for detecting mutant TIMM44 gene in early molecular screening of lethal mitochondrial diseases of infants, which is used for the purpose of non-disease diagnosis.

The application of a kit for detecting a mutant TIMM44 gene in early molecular screening of lethal mitochondrial diseases of infants is a non-disease diagnosis purpose.

Compared with the prior art, the invention has the advantages that:

the invention provides a TIMM44 mutant gene, a reagent, a primer, a kit and a method for detecting the TIMM44 mutant gene and application thereof, creatively digs a LIMD pathogenic gene TIMM44, and provides a TIMM44 mutant gene locus, which provides important basis for early molecular screening, family genetic research and genetic consultation of lethal mitochondrial diseases of infants.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a family diagram;

FIG. 2 is a high throughput sequencing of the TIMM44 mutant sequence.

FIG. 3 is a Sanger sequencing of the mutant sequence of TIMM 44.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1 this example performed a whole exome high throughput sequencing assay on multiple families of patients with infantile fatal mitochondrial disease (LIMD), comprising the following sequential steps:

(1) sample collection and extraction of genomic DNA.

Clinical data of family members and blood samples (EDTA anticoagulation) were collected, which were blood samples sent to forry medical laboratory ltd.

The Blood genomic DNA of each member of the family was extracted according to the instruction procedures of the Blood DNA extraction Kit (magenta, HiPure Blood & Tissue DNA Kit). The purity of the DNA was measured using Nanodrop one, OD260nm/OD280nm of the obtained genomic DNA were each between 1.7 and 2.0, and the concentration of the DNA was measured using Nanodrop one, the concentration of the obtained genomic DNA was 50 to 100 ng/. mu.L, and the total amount was 5 to 10. mu.g. Storing at-20 deg.C.

(2) Exome sequencing and bioinformatic analysis.

In order to find other pathogenic genes of LIMD, exome sequencing was used to screen 1 LIMD family for potential genetic variation (family map is shown in FIG. 1), and no pathological variation was found in the existing LIMD pathogenic gene test.

Exome sequencing was performed on the proband. Briefly, genomic DNA was fragmented, and subjected to enzymatic fragmentation, end repair, 3' -end addition of A, linker ligation, and PCR amplification by using a Kit of KAPA company (KAPA Hyperplus Library Preparation Kit); the exon regions were captured using a library construction kit (XGen outer Research Panel v2) from IGT. The library was sequenced on a Novaseq sequencer (Illumina, san diego, CA, usa) (sequencing depth 150X). NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remove Run Common Variants and Remove Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, ExAC, 1000g, ClinVar, OMIM, etc. Py was used to rank the annotated variants by High, Medium, Low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software. .

After sequencing the whole exon of 1 LIMD pedigree TIMM44 gene in figure 1 and bioinformatics analysis, we found that proband carries 2 complex heterozygous mutations, and the BAM file of mutation sequencing result is shown in figure 2, wherein the gene code of TIMM44 gene in Ensemble database (www.ensembl.org) is ENSG00000104980, wherein mutation TIMM44 p.Gln181Ter, and base with physical position 7998976 is mutated from G to A; RNA level: the 541 st base of the TIMM44 gene coding RNA is mutated from C to T; protein level: the protein encoded by the TIMM44 gene has the 181 th amino acid changed from glutamine to stop codon; mutation TIMM44 p.Glu320Ter, wherein the base with the physical position of 7997541 is mutated from C to A; RNA level: the 958 th base of the coding RNA of the TIMM44 gene is mutated from G to T; protein level: the protein encoded by the TIMM44 gene has the 320 th amino acid changed from glutamic acid to a stop codon; no other suspected site of mutation of the pathogenic gene was found.

The mutation p.Gln181Ter and p.Glu320Ter of the TIMM44 gene are not recorded in a normal population database such as gnomaD and the like, which leads to complete loss of the function of the protein of proband TIMM44 and seriously influences the physiological function of the TIMM44 protein. According to the known biological function results, the clinical symptoms of proband LIMD are highly consistent.

According to the screening process designed by us, by means of high-throughput deep sequencing and bioinformatics analysis, we successfully found that the TIMM44 gene is a LIMD new pathogenic gene, and the mutations p.Gln181Ter and p.Glu320Ter are new pathogenic sites of the disease.

(3) And (5) carrying out Sanger sequencing verification to identify the mutant gene.

Sanger sequencing was used to verify 2 mutations of the TIMM44 gene detected by exon sequencing: c.541C > T, c.958G > T (see FIG. 3). Primer 3 Primer design software is adopted to design Primer sequences SEQ ID NO. 3-SEQ ID NO.6, and the Primer sequences amplify genome DNA fragments containing TIMM44 gene mutation sites.

The PCR amplification system (20. mu.l) included: PCR 5 Xbuffer mix 10. mu.l, forward primer (10. mu. mol) 1. mu.l, reverse primer (10. mu. mol) corresponding to the forward primer 1. mu.l, ddH₂O6. mu.l, DNA 2. mu.l. PCR reaction procedure: at 95 deg.C for 5min, for 35 cycles (95 deg.C for 5min, 95 deg.C for 30s, 60 deg.C for 30s), at 72 deg.C for 10min, and at 4 deg.C. After PCR amplification is finished, 1% agarose gel electrophoresis is adopted for detection, PCR product gel is recovered by cutting gel, and products are recovered by Taq enzyme purification. All PCR products were sequenced with forward and reverse primers, respectively. The sequencing results are shown in FIG. 3.

In summary, the identified mutant TIMM44 gene of the present invention can be used for early clinical screening of LIMD patients, and the above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and variations can be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., Ltd

<120> TIMM44 mutant gene, primer, kit and method for detecting same, and use thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1359

<212> DNA

<213> human (human)

<400> 1

atggcggcgg cggccctgcg gagtggctgg tgccgctgtc cacggagatg cctcggcagt 60

ggaatccaat ttctttccag ccacaaccta ccccatgggt cgacctatca gatgcgccgg 120

ccgggcggag agctgccact gtccaaatca tattcttctg gaaacagaaa aggctttctg 180

tccggcttgc tagataatgt caaacaagaa ttagccaaaa acaaagaaat gaaagaaagt 240

ataaaaaaat tccgtgacga ggccagaagg ctagaagaat cagacgtgct ccaggaggcc 300

agaaggaaat acaaaaccat cgagtcagaa accgtgcgga cgagcgaggt gctacggaag 360

aagcttgggg agctgacggg caccgtgaag gagagccttc acgaagtcag taaaagtgat 420

ctcggccgga aaatcaagga gggcgtggag gaagcagcca agacggccaa gcagtcggcc 480

gagtcggtat ccaaaggcgg ggagaagctg ggcaggacag cggccttcag agccctctcc 540

cagggggtgg agtccgtgaa gaaggaaatt gacgacagcg tcctgggaca gaccgggccc 600

taccggaggc cccagcgact ccggaagaga acggagtttg cgggagataa gttcaaggag 660

gagaaagtgt ttgagccaaa cgaggaggcc ctgggggtcg tgctgcacaa ggactccaag 720

tggtaccagc agtggaagga cttcaaggag aacaacgtgg tgtttaaccg gttcttcgag 780

atgaagatga agtatgacga aagcgacaac gcgttcatcc gggcatcccg ggcccttacg 840

gacaaggtca ccgacttgct ggggggcctg ttctccaaga cagagatgtc ggaggtgctc 900

acggagatcc tccgggtgga cccggccttt gacaaggacc ggtttctgaa acagtgcgag 960

aacgacatca tccccaatgt cctggaggcc atgatttctg gagagcttga cattctcaaa 1020

gactggtgct atgaagctac ttacagccag ctggcccacc ccatccagca ggccaaggca 1080

ctgggtctcc agttccattc tcgcatccta gacattgaca acgtcgacct ggccatgggc 1140

aagatgatgg agcaggggcc ggtgctgatc atcaccttcc aggcacagct ggtgatggtg 1200

gtcaggaacc ccaaaggcga ggtggtggag ggtgacccgg acaaggtgct gcggatgctg 1260

tacgtgtggg cgctctgccg agaccaggac gagctcaacc cctacgcggc ctggcggctc 1320

ctggacatct cggcctccag caccgagcag attctctga 1359

<210> 2

<211> 452

<212> PRT

<213> human (human)

<400> 2

Met Ala Ala Ala Ala Leu Arg Ser Gly Trp Cys Arg Cys Pro Arg Arg

1 5 10 15

Cys Leu Gly Ser Gly Ile Gln Phe Leu Ser Ser His Asn Leu Pro His

20 25 30

Gly Ser Thr Tyr Gln Met Arg Arg Pro Gly Gly Glu Leu Pro Leu Ser

35 40 45

Lys Ser Tyr Ser Ser Gly Asn Arg Lys Gly Phe Leu Ser Gly Leu Leu

50 55 60

Asp Asn Val Lys Gln Glu Leu Ala Lys Asn Lys Glu Met Lys Glu Ser

65 70 75 80

Ile Lys Lys Phe Arg Asp Glu Ala Arg Arg Leu Glu Glu Ser Asp Val

85 90 95

Leu Gln Glu Ala Arg Arg Lys Tyr Lys Thr Ile Glu Ser Glu Thr Val

100 105 110

Arg Thr Ser Glu Val Leu Arg Lys Lys Leu Gly Glu Leu Thr Gly Thr

115 120 125

Val Lys Glu Ser Leu His Glu Val Ser Lys Ser Asp Leu Gly Arg Lys

130 135 140

Ile Lys Glu Gly Val Glu Glu Ala Ala Lys Thr Ala Lys Gln Ser Ala

145 150 155 160

Glu Ser Val Ser Lys Gly Gly Glu Lys Leu Gly Arg Thr Ala Ala Phe

165 170 175

Arg Ala Leu Ser Gln Gly Val Glu Ser Val Lys Lys Glu Ile Asp Asp

180 185 190

Ser Val Leu Gly Gln Thr Gly Pro Tyr Arg Arg Pro Gln Arg Leu Arg

195 200 205

Lys Arg Thr Glu Phe Ala Gly Asp Lys Phe Lys Glu Glu Lys Val Phe

210 215 220

Glu Pro Asn Glu Glu Ala Leu Gly Val Val Leu His Lys Asp Ser Lys

225 230 235 240

Trp Tyr Gln Gln Trp Lys Asp Phe Lys Glu Asn Asn Val Val Phe Asn

245 250 255

Arg Phe Phe Glu Met Lys Met Lys Tyr Asp Glu Ser Asp Asn Ala Phe

260 265 270

Ile Arg Ala Ser Arg Ala Leu Thr Asp Lys Val Thr Asp Leu Leu Gly

275 280 285

Gly Leu Phe Ser Lys Thr Glu Met Ser Glu Val Leu Thr Glu Ile Leu

290 295 300

Arg Val Asp Pro Ala Phe Asp Lys Asp Arg Phe Leu Lys Gln Cys Glu

305 310 315 320

Asn Asp Ile Ile Pro Asn Val Leu Glu Ala Met Ile Ser Gly Glu Leu

325 330 335

Asp Ile Leu Lys Asp Trp Cys Tyr Glu Ala Thr Tyr Ser Gln Leu Ala

340 345 350

His Pro Ile Gln Gln Ala Lys Ala Leu Gly Leu Gln Phe His Ser Arg

355 360 365

Ile Leu Asp Ile Asp Asn Val Asp Leu Ala Met Gly Lys Met Met Glu

370 375 380

Gln Gly Pro Val Leu Ile Ile Thr Phe Gln Ala Gln Leu Val Met Val

385 390 395 400

Val Arg Asn Pro Lys Gly Glu Val Val Glu Gly Asp Pro Asp Lys Val

405 410 415

Leu Arg Met Leu Tyr Val Trp Ala Leu Cys Arg Asp Gln Asp Glu Leu

420 425 430

Asn Pro Tyr Ala Ala Trp Arg Leu Leu Asp Ile Ser Ala Ser Ser Thr

435 440 445

Glu Gln Ile Leu

450

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccagaggact cctgcccatt t 21

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctccgttctc ttccggagtc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttacggacaa ggtcaccgac 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taagcccaac aagggtctgg 20

Claims

1. A mutant TIMM44 gene or a mutant TIMM44 protein, wherein: the mutant TIMM44 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

c.541C>T、c.958G>T；

p.Gln181Ter、p.Glu320Ter。

2. a method of detecting the mutant TIMM44 gene or mutant TIMM44 protein of claim 1 for a non-diagnostic purpose, wherein the method comprises: the method comprises detecting the presence or absence of a mutation site in the TIMM44 gene or the TIMM44 protein, wherein the mutation site is at least one of:

chr19(GRCh37) g.7998976G > A, cDNA sequence occurrence c.541C > T, p.Gln181Ter;

chr19(GRCh37) g.7997541C > A, cDNA sequence occurrence c.958G > T, p.Glu320Ter.

3. The method of claim 2, wherein: the method comprises the step of performing PCR amplification by using at least one set of primers as follows:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

4. The method of claim 3, wherein: the PCR amplification reaction program comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

5. A reagent for detecting a mutant TIMM44 gene, comprising: the reagent is a nucleic acid detection probe or primer;

c.541C>T、c.958G>T；

the primer is at least one group of primers with the following sequences:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

6. A kit for detecting a mutant TIMM44 gene, comprising: comprising the reagent according to claim 5.

7. The application of a reagent for detecting mutant TIMM44 gene or mutant TIMM44 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the mutant TIMM44 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

c.541C>T、c.958G>T；

p.Gln181Ter、p.Glu320Ter。

8. the use of claim 7, wherein the reagent for detecting lethal mitochondrial disease in infants is a reagent for gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for restriction enzyme digestion or a reagent for sequencing.