CN103374627B - Associated Gene of Congenital Heart Disease PKD1L1 and application thereof - Google Patents

Abstract

The invention discloses Associated Gene of Congenital Heart Disease PKD1L1 and application thereof.Particularly, the invention provides a kind of method detecting congenital heart disease susceptibility, it comprises the PKD1L1 gene, transcript and/or the albumen that detect individuality and than whether there is variation with normal phase, there is variation and just shows that the possibility of this individuality trouble congenital heart disease is greater than normal population.The invention also discloses corresponding detection kit, especially antenatal diagnosis test kit.

Description

Associated Gene of Congenital Heart Disease PKD1L1 and application thereof

Technical field

The present invention relates to molecular biology and medical field.Relate more specifically to Associated Gene of Congenital Heart Disease PKD1L1 (English: polycystic kidney disease 1 like 1, Chinese: multicystic kidney disease 1 sample albumen 1, be called for short PKD1L1) single nucleotide variations (single nucleotide variation, SNV) and the dependency with congenital heart disease.The invention still further relates to the method and test kit that detect these SNV.

Background technology

Congenital heart disease (Congenital Heart Defeats, CHD) is fetus period heart and the congenital malformation that causes of great vessels heteroplasia, is one of the most common congenital malformation.Owing to being in a bad way, complication is many, and treatment is complicated, is also cause one of modal defect of neonatal death.The sickness rate of CHD in fetus is up to 50 ‰.The analysis on cause of death result of China less than 1 years old baby and 1-5 year child represents, the mortality ratio of congenital heart disease all occupies front two in city and country area.The cause of disease of most of CHD is very complicated, and existing nosetiology evidence is very limited.And CHD early finds, early treatment, survival rate and the quality of life of children can be significantly improved.Set up effective examination of newborn infant CHD, with the mechanism of examining, increasing CHD can be made to be able to Timeliness coverage, obtain specialty control as early as possible.Therefore, explore pathogenic root and the pathogenesis of congenital heart disease, the also effective prevention treatment of diagnosis early, specific aim carries out medicament research and development simultaneously, for prenatal and postnatal care, improves national overall qualities and is significant.

Generally believe at present, jointly caused by inherited genetic factors and environmental factors, and there is genetic heterogeneity.Research shows, except extraneous factor as alcohol, vitamin A acid, spasmolytic and maternal disease can cause the generation of CHD, inherited genetic factors has also played sizable effect [McBride, K.L. and V.Garg, Impactof Mendelian inheritance in cardiovascular disease. Ann N Y Acad Sci.2010.1214:p.122-37; Jenkins, K.J., et al., Noninherited riskfactors and congenital cardiovascular defects:current knowledge:ascientific statement from the American Heart Association Council onCardiovascular Disease in the Young:endorsed by the AmericanAcademy of Pediatrics. Circulation, 2007.115 (23): p.2995-3014.].The inherited genetic factors of CHD is caused to comprise [the Richards such as chromosome aberration, single gene mutation and copy number variation, A.A. and V.Garg, Genetics of congenital heart disease. Curr CardiolRev, 2010.6 (2): p.91-7.].In the decades in past, along with the development of molecular genetic technique and the utilization of family sample, multiple gene of CHD or the concurrent CHD of other syndromess that may cause is found, as NKX2-5, GATA4, PTPN11, [Schott, J.J., the etal. such as JAG1 and TBX5, Congenital heart disease caused by mutations in thetranscription factor NKX2-5. Science, 1998.281 (5373): p.108-111; Garg, V., et al., GATA4 mutations cause human congenital heartdefects and reveal an interaction with TBX5. Nature, 2003.424 (6947): p.443-7; Tartaglia, M., et al., Mutations in PTPN11, encoding theprotein tyrosine phosphatase SHP-2, cause Noonan syndrome. NatureGenetics, 2001.29 (4): p.465-468; Li, L.H., et al., Alagillesyndrome is caused by mutations in human Jagged1, which encodes aligand for Notchl. Nature Genetics, 1997.16 (3): p.243-251; Oda, T., et al., Mutations in the human Jagged1 gene are responsible forAlagille syndrome. Nature Genetics, 1997.16 (3): p.235-42.; Basson, C.T., et al., Mutations in human TBX5 cause limb and cardiacmalformation in Holt-Oram syndrome (vol 15, pg 30,1997). NatureGenetics, 1997.15 (4): p.411-411.].These genes are causing all presenting monogenic inheritance pattern [Wessels in CHD, M.W. and P.J. Willems, Genetic factors innon-syndromic congenital heart malformations. Clinical Genetics, 2010.78 (2): p.103-23.].

Although existing more than 40 gene is proved and may falls ill relevant with CHD, the cause of disease of Sporadic cases and non-syndromes case is still uncertain.A such as CHD causes a disease star's gene NKX2-5, (ASD in familial congenital heart disease patients, VSD, TOF etc.), the sudden change of existing more than 40 high penetrances is in the news, and distributing patient, 6 low penetrance sudden change [Garg, V., et al. are only found, GATA4mutations cause human congenital heart defects and reveal aninteraction with TBX5. Nature, 2003.424 (6947): p.443-7.].This sharp contrast shows, due to the process that heart of fetus growth is a complexity and precision, thousands of molecule synergy and any one variation all may cause heart development abnormal around here, so in Sporadic cases, the generation of CHD may multiple inherited genetic factors cause.Therefore, find the cure the disease difficult point of gene of CHD may be present in and how to adopt efficient means to carry out genome-wide screening for distributing CHD crowd.

Increasing evidence shows, arch-criminal [the Cirulli of rare sudden change some common diseases often, E.T.and D.B. Goldstein, Uncovering the roles of rare variants in commondisease through whole-genome sequencing. Nature Reviews Genetics, 2010.11 (6): p.415-425.].In addition, about 98% human genome is made up of tumor-necrosis factor glycoproteins, intergenic sequence and non-coding sequence.Genome sequencing, genome mutation is abundant, Analysis of Complex, and real sudden change is often submerged in a large amount of variation and sequences match mistake, and cost is still very high.Therefore, gene order-checking is found Disease-causing gene sudden change to concentrate on gene coding region efficiency higher.In fact, for the disease that heredopathia and some are distributed, the disease gene sudden change had been found that focuses mostly in coding region.Therefore, the more efficiently method of heredopathia Disease-causing gene is found in current stage exon order-checking.

The polygenic disease that congenital heart disease fall ill as a kind of interaction by inherited genetic factors and environmental factors, the genetic mechanism found its genes involved and then illustrate congenital heart disease has become the focus studied at present.

Although the existing much research about various genovariation and congenital heart disease, does not confirm the report of PKD1L1 gene and congenital heart disease dependency, does not more confirm the SNV of PKD1L1 gene and the report of congenital heart disease dependency.

In sum, in order to Diagnosis of Congenital Heart Disease as early as possible, this area is in the urgent need to finding congenital heart disease tumor susceptibility gene, and exploitation detects method and the test kit of congenital heart disease.

Summary of the invention

Object of the present invention is just to provide method and the detection kit of a kind of auxiliary diagnosis (especially early diagnosis) congenital heart disease.

In a first aspect of the present invention, provide a kind of PKD1L1 gene or the purposes of its single nucleotide variations in the reagent or test kit of preparation detection congenital heart disease, wherein said single nucleotide variations SNV is:

64th T → C;

368th C → T;

1089th G → T;

1865th A → G;

2008th G → A;

3155th G → A;

3847th G → T;

4598th G → T;

4669th G → A;

4821st A → T;

5090th G → T;

5848th C → T;

6037th C → T;

6125th A → G;

6913rd T → G;

7454th T → A;

8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1.

In another preference, described reagent comprises primer, probe, chip or antibody.

In another preference, described test kit contains the reagent that one or more are selected from lower group:

The Auele Specific Primer of (a) PKD1L1 gene;

B () is for detecting the specific probe in SNV site described in one or more;

C () is for detecting the chip in SNV site described in one or more;

D () is for detecting the specific antibody of the amino acid mutation described in one or more corresponding to SNV site.

In another preference, described Auele Specific Primer has the sequence shown in SEQ ID NO:3-32, especially the sequence of SEQ ID NO.:15 and 16.

In another preference, described test kit is antenatal diagnosis test kit.

In a second aspect of the present invention, provide a kind of test kit detecting congenital heart disease, it comprises the primer of specific amplification PKD1L1 gene or transcript, and the length of amplified production that described primer amplification goes out is 100-2000bp and containing one or more single nucleotide variations being selected from lower group:

64th T → C; 368th C → T; 1089th G → T; 1865th A → G; 2008th G → A; 3155th G → A; 3847th G → T; 4598th G → T; 4669th G → A; 4821st A → T; 5090th G → T; 5848th C → T; 6037th C → T; 6125th A → G; 6913rd T → G; 7454th T → A; 8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1.

In another preference, described test kit is also containing the reagent being selected from lower group:

The probe of the combination in (a) and described SNV site;

B () identifies the restriction enzyme in described SNV site.

In another preference, described primer has the sequence shown in SEQ ID NO:3-32, especially the sequence of SEQ ID NO.:15 and 16.

In a third aspect of the present invention, provide a kind of method whether vitro detection sample exists the single nucleotide variations of PKD1L1, comprise step:

A (), with the PKD1L1 gene of PKD1L1 gene-specific primer amplification sample, obtains amplified production; With

B () detect in amplified production whether there is following single nucleotide variations:

64th T → C; 368th C → T; 1089th G → T; 1865th A → G; 2008th G → A; 3155th G → A; 3847th G → T; 4598th G → T; 4669th G → A; 4821st A → T; 5090th G → T; 5848th C → T; 6037th C → T; 6125th A → G; 6913rd T → G; 7454th T → A; 8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1.

In another preference, described primer has the sequence shown in SEQ ID NO:3-32, especially the sequence of SEQ ID NO.:15 and 16.

In another preference, the length of described amplified production is 100-2000bp, and containing one or more described single nucleotide variations.

In a fourth aspect of the present invention, provide a kind of method diagnosed the congenital heart disease susceptibility of individuality, it comprises step:

I () detects the PKD1L1 gene of this individuality, transcript and/or albumen, and compared with normal PKD1L1 gene, transcript and/or albumen,

There are differences and just show that this individuality suffers from the possibility of congenital heart disease higher than normal population.

In another preference, detect gene or the transcript of PKD1L1 in the step (i), and with normal PKD1L1 nucleotide sequence comparison difference.

In another preference, described difference is following single nucleotide variations:

64th T → C; 368th C → T; 1089th G → T; 1865th A → G; 2008th G → A; 3155th G → A; 3847th G → T; 4598th G → T; 4669th G → A; 4821st A → T; 5090th G → T; 5848th C → T; 6037th C → T; 6125th A → G; 6913rd T → G; 7454th T → A; 8547th C → A; Wherein, nucleotide position numbering is based on SEQ ID NO:1.

In another preference, described individuality is people.

In a fifth aspect of the present invention, provide a kind of reagent detects the test kit of congenital heart disease purposes in preparation, wherein said reagent is selected from lower group:

The Auele Specific Primer of (a) PKD1L1 gene;

B () is for detecting the specific probe in SNV site described in one or more;

C () is for detecting the chip in SNV site described in one or more; Or

D () is for detecting the specific antibody of the amino acid mutation described in one or more corresponding to SNV site.

In another preference, described test kit is antenatal diagnosis test kit.

In a sixth aspect of the present invention, provide a kind of purposes of people PKD1L1 gene, for the preparation of the test kit detecting congenital heart disease.

In another preference, described test kit comprises the primer of specific amplification PKD1L1 gene or transcript, and the length of amplified production that described primer amplification goes out is 100-2000bp and containing one or more single nucleotide variations being selected from lower group:

64th T → C; 368th C → T; 1089th G → T; 1865th A → G; 2008th G → A; 3155th G → A; 3847th G → T; 4598th G → T; 4669th G → A; 4821st A → T; 5090th G → T; 5848th C → T; 6037th C → T; 6125th A → G; 6913rd T → G; 7454th T → A; 8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1.

In another preference, also containing the reagent being selected from lower group:

The probe of the combination in (a) and described SNV site;

B () identifies the restriction enzyme in described SNV site.

In a seventh aspect of the present invention, provide a kind of PKD1L1 nucleotide sequence of separation, described nucleotide sequence as shown in SEQ ID NO.:1, and has one or more sudden change being selected from lower group:

64th T → C; 368th C → T; 1089th G → T; 1865th A → G; 2008th G → A; 3155th G → A; 3847th G → T; 4598th G → T; 4669th G → A; 4821st A → T; 5090th G → T; 5848th C → T; 6037th C → T; 6125th A → G; 6913rd T → G; 7454th T → A; 8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1.

In a eighth aspect of the present invention, provide a kind of PKD1L1 aminoacid sequence of separation, described aminoacid sequence as shown in SEQ ID NO.:2, and has one or more sudden change being selected from lower group: Cys22Arg, Ala123Val, Gln363His, Tyr622Cys, Val670Met, Gly1052Asp, Val1283Leu, Gly1533Val, Val1557Met, Lys1607Asn, Arg1697Ile, Arg1950Cys, Leu2013Phe, His2042Arg, Phe2305Val, Leu2485His, Phe2849Leu; Wherein, amino acid position number is based on SEQ ID NO:2.

Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.

Accompanying drawing explanation

Fig. 1 shows PKD1L1 and distributes mutation analysis in congenital heart disease patients at 217.

Fig. 2 shows PKD1L1 protein mutation site conservative Analysis.

Embodiment

The present inventor, through deeply studying widely, measures the SNV of a large amount of candidate gene and analyzes.Late Cambrian is closely related with the genome sequence and congenital heart disease demonstrating PKD1L1, therefore can be used as the specificity SNV of complementary detection congenital heart disease (or its susceptibility).Complete the present invention on this basis.

Particularly, 5 the site generating functions variations of this this gene are found in 4 mixing samples that the present inventor consists of at 66 patients with congenital heart samples (sample picks up from Hebei province's Grade A hospital) full-length genome exon sequencing technologies, after being verified by Sequenom Mass Array platform, Sanger order-checking and two generations are adopted to check order the means combined, distribute in patient's sample at 217 and find 19 heterozygosis point mutation altogether, and all do not find above-mentioned variation in 800 normal people's samples, significance is P=8.997e ^-6, this sufficient proof PKD1L1 is a kind of Disease-causing gene of congenital heart disease.The present invention is the accessory molecule diagnosis of congenital heart disease, molecule parting, antenatal diagnosis, drug target selects and clinical treatment provides foundation.

PKD1L1 gene

PKD1L1 (polycystic kidney disease 1 like 1) is positioned at people's No. 7 karyomit(e), and its sequence is known.Its detailed sequence and some relevant informations can see network address http://www.ncbi.nlm.nih.gov/Genebank/; Http:// www.ncbi.nlm.nih.gov/SNP.

Genome sequence total length 173kb, totally 57 exons altogether of PKD1L1.Proteins encoded is made up of 2849 amino acid, expresses in heart and testis, coding class polycystin albumen, comprise PKD, REJ, GPS and PLAT structural domain [Yuasa, T., et al., The sequence, expression, andchromosomal localization of a novel polycystic kidney disease 1-likegene, PKD1L1, in human. Genomics, 2002.79 (3): p.376-386.].

For convenience's sake, provide nucleotide sequence relevant to SNV of the present invention in PKD1L1 at SEQ ID NO:1, wherein, initiator codon is from the 1st atg.The aminoacid sequence of PKD1L1 is as shown in SEQ ID NO.:2.

The present inventor has found a kind of congenital heart disease Disease-causing gene PKD1L1 by full exon group sequencing technologies, Sanger sequencing technologies and Sequenom analytical technique of mass spectrum, and discloses and confirm the multiple SNV very high with congenital heart disease susceptibility cognation.

Specifically, present invention is disclosed this gene and to distribute in patient totally 19 sites at 217 CHD heterozygosis missense mutations occur, and all do not find in 800 normal peoples.As shown in table 1 below:

Table 1:PKD1L1 distributes mutation analysis in congenital heart disease patients at 217

Note: ASD=atrial septal defect

DORV=double outlet of right ventricle

PDA=patent ductus arteriosus

PS=pulmonic stenosis

TOF=tetralogy of Fallot

VSD=ventricular septal defect

VSD & ASD=ventricular septal defect is atrial septal defect simultaneously

The application of PKD1L1 gene

Based on new discovery of the present invention, PKD1L1 gene, albumen or polypeptide have many-sided novelty teabag.These purposes include, but is not limited to: for complementary Diagnosis of Congenital Heart Disease, or for screening the material promoting PKD1L1 protein function, as antibody, polypeptide or other part.

On the other hand, the present invention also comprises and has specific polyclonal antibody and monoclonal antibody to people PKD1L1DNA or the polypeptide of its fragment coding, especially monoclonal antibody.Here, " specificity " refers to that antibody capable is incorporated into people PKD1L1 gene product or fragment.Preferably, refer to that those can be combined with people PKD1L1 gene product or fragment but nonrecognition and be incorporated into the antibody of other non related antigen molecule.In the present invention antibody comprise those can in conjunction with and suppress the molecule of people PKD1L1 albumen, also comprise the antibody that those do not affect people PKD1L1 protein function.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises and have immunocompetent antibody fragment, as Fab ' or (Fab) ₂fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered Single Chain Fv Molecule A; Or chimeric antibody.

Antibody of the present invention can be prepared by the various technology that those skilled in that art are known.Such as, the people PKD1L1 gene product of purifying or its there is antigenic fragment, animal can be applied to induce the generation of polyclonal antibody.Similarly, expression people's PKD1L1 albumen or its cell with antigenic fragment can be used to immune animal to produce antibody.Multiple adjuvant can be used for strengthening immune response, includes but not limited to freund's adjuvant etc.

Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare.Antibody of the present invention comprises the antibody that can block people PKD1L1 protein function and the antibody not affecting people PKD1L1 protein function.Each antibody-like of the present invention can utilize fragment or the functional zone of people PKD1L1 gene product, is obtained by common immunological techniques.These fragments or functional zone can utilize recombination method prepare or utilize Peptide synthesizer to synthesize.The antibody be combined with the unmodified form of people PKD1L1 gene product can carry out immune animal by the gene product of producing in prokaryotic cell prokaryocyte (such as E. Coli) and produce; The antibody that is combined with posttranslational modification form (albumen or polypeptide as glycosylation or phosphorylation), can use the gene produced in eukaryotic cell (such as yeast or insect cell) to produce

The antibody of anti-human PKD1L1 albumen can be used in immunohistochemistry technology, detect the people PKD1L1 albumen in biopsy specimen number and/or whether suddenly change.Preferred anti-PKD1L1 antibody is the normal PKD1L1 of nonrecognition but identifies an antibody of sudden change PKD1L1, or identifies normal PKD1L1 but the antibody of nonrecognition sudden change PKD1L1.Utilize these antibody, the congenital heart disease susceptibility can carrying out protein level easily detects.

Utilize PKD1L1 albumen of the present invention, by various conventional screening assays, can filter out and with PKD1L1 albumen, interactional material occur, as inhibitor, agonist or antagonist etc.

The invention still further relates to diagnostic testing process that is quantitative and detection and localization people PKD1L1 protein level.These tests are known in the art, and comprise ELISA etc.

A kind of method that whether there is PKD1L1 albumen in detection sample utilizes the specific antibody of PKD1L1 albumen to detect, and it comprises: contacted with PKD1L1 protein specific antibody by sample; Observe and whether form antibody complex, define antibody complex and just represent in sample to there is PKD1L1 albumen.

The polynucleotide of PKD1L1 albumen can be used for the auxiliary diagnosis of PKD1L1 protein related diseases.In diagnosis, the unconventionality expression of the expression that the polynucleotide of PKD1L1 albumen can be used for detecting PKD1L1 albumen PKD1L1 albumen whether or under morbid state.As PKD1L1 DNA sequence dna can be used for the hybridization of biopsy specimen to judge the abnormal expression of PKD1L1 albumen.Hybridization technique comprises Southern blotting, Northern blotting, in situ hybridization etc.These technological methods are all disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe and is fixed in microarray (microarray) or DNA chip (being also called " gene chip "), for analyzing Differential expression analysis and the gene diagnosis of gene in tissue.The transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect PKD1L1 albumen is carried out with the primer that PKD1L1 albumen is special.

Detection can for cDNA, also can for genomic dna.The form of PKD1L1 protein mutation comprises point mutation compared with normal wild type PKD1L1DNA sequence, transposition, disappearance, restructuring and other any exception etc.Available existing technology such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change likely affects the expression of albumen, therefore indirectly can judge that gene is with or without sudden change by Northern blotting, western blot method.

The method of the detection SNV of the present invention of most convenient, is by the PKD1L1 gene with PKD1L1 gene-specific primer amplification sample, obtains amplified production; Then detect in amplified production whether there is the single nucleotide variations shown in table 1.Such as, detect by order-checking or specific probe.

Should understand, after the present invention discloses the SNV of PKD1L1 gene and the dependency of congenital heart disease first, those skilled in the art can design easily and can go out amplified production containing this SNV position by specific amplification, then determine whether there is disclosed SNV or sudden change by methods such as order-checkings.Usually, the length of primer is 15-50bp, is preferably 20-30bp.Although primer and template sequence complete complementary are preferred, but those skilled in the art will know that, when there is certain not complementary (especially 5 ' of primer holding) in primer and template, also can increase specifically (namely only amplifying required fragment).Test kit containing these primers and use the method for these primers all within the scope of the invention, as long as the amplified production that this primer amplification goes out contains the correspondence position of SNV of the present invention.

Although the length of amplified production is not particularly limited, the length of amplified production is 100-2000bp usually, and being preferably 150-1500bp, is more preferably 200-1000bp.

Major advantage of the present invention is:

Disclose a kind of Disease-causing gene PKD1L1 of new congenital heart disease first.Because transgenation of the present invention and congenital heart disease have very high cognation, therefore not only can be used for early stage complementary Diagnosis of Congenital Heart Disease, and can diagnose antenatal against a rainy day, instruct prenatal and postnatal care, thus improve fetal survival rate, therefore there is earth shaking using value and social benefit.In addition, of the present invention being conducive to sets forth the pathogenesis of CHD, provides foundation for the research of disease and CHD medicament research and development.

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number are weight percent and parts by weight.

Embodiment 1

1.1 samples prepare

217 congenital heart disease blood samples all pick up from Hebei province's Grade A hospital.All patients diagnose through senior cardiologist, and clinical phenotypes is all determined by standard ultrasound electrocardiogram(ECG and other tests.Abundant understanding also collects patient clinical information and family's medical history.Have 3 people to suffer from Down's syndrome in 217 people, other 214 people all do not suffer from any syndromes.Most patients accepts to care operative catheter.

All patients or its guardian fully know the inside story and agree to that gathering its blood sample carries out genetics research, and this research also have passed the approval of Ethics Committee of health science institute of Shanghai life science institute of the Chinese Academy of Sciences.

Sample (500 example) in contrast picks up from the clinical normal people determining not suffer from congenital heart disease, knows the inside story and agrees to adopt its blood sample to carry out genetics research.

Employing QIAamp DNA Blood is little takes out test kit extracting blood sample genomic dna, and NanoDrop surveys concentration.

217 routine congenital heart disease samples, divide and have multiple hypotype, wherein modal is VSD, PDA, TOF, ASD tetra-kinds of hypotypes, and some patients suffers from two kinds or two or more hypotype simultaneously.

Have selected from above-mentioned sample 20 patients VSD, 19 patients PDA, 9 patients TOF and 18 patients ASD genomic dna be mixed into 4 storehouses respectively.And each patient dna amount controls equal in each storehouse.Selection standard is 1, high by 2, the corresponding patient of DNA sample quality comparation only shows wherein a kind of hypotype clinical profile.

Wherein, with the patient's sample information of PKD1L1 gene-correlation following (only listing the patient's sample that this gene is undergone mutation).

Table 2: patient's sample information

2, full-length genome exon order-checking

Adopt NimbleGen 2.1M human exome array to catch genomic dna sample exon 1, in each sample, 180,000 exon is by enrichment.The DNA sample of these enrichments is subsequently interrupted at random, connects top connection respectively prepare Hybrid Library at fragment two ends.Hybridization enrichment is carried out through the linear amplification of LM-PCR and Biotinylated DNA Library after library is purified, then through the linear amplification of LM-PCR, namely with Illumina Genome Analyzer II order-checking after library detection is qualified.

Sequencing result average fragment size is 75bp.Exon group sequencing data is as follows:

Show 3:4 mixing sample exon sequencing result

Exon trapping data	Pool1	Pool2	Pool3	Pool4
					Mixing sample number	20	19	9	18
Total length (bp)	6667566876	6816327380	6552956536	6358639428
					Originally read ordinal number	82214918	84305890	80384124	78573962
Navigate to the sequence in genome	80680618	81931344	79376178	77724534
					The percent sequence (%) on gene can be navigated to	98.13	97.18	98.75	98.92
What navigate to target region reads ordinal number amount	47545038	51944774	54103261	54873136
					Navigate to the sequence ratio of reading (%) of target region	57.83	61.61	67.31	69.84
The mean depth of target region	87.36	95.88	100.08	100.25
					The fraction of coverage (%) of target region	99.73	99.73	99.69	99.6

3, base location and analysis of variance

Checked order by full-length genome exon, the present inventor obtains the base pair of 26G altogether, and wherein the base of 98.3% can navigate to reference on genome, and the average order-checking degree of depth is 95.9.By MAQ (version 0.7.1), order-checking is obtained base and navigate to (UCSC hg18) on the reference sequences of database.Be 20,19 for sample number, the compound sample of 18,9, the MAQ parameter of use is respectively-N40,38,36,18.Filter out site in dbSNP132 to obtain new variation.

Based on NCBI and UCSC database, use SeattleSeqAnnotation to annotate a new variation, the final variation data obtained are as shown in the table:

Table 4: exon order-checking variation interpretation of result

Note: 1. candidate SNV is total to the SNV obtained after referring to data analysis process;

2. the SNV of checking refers to be verified as positive SNV by sanger or mass spectrographic way;

4, sequenom is used to carry out sequencing result checking and genotype identification

MassArray Assay Design 3.1 is utilized to design PCR primer and extend primer.The site of Sequenom authentication failed adopts the checking of Sanger sequencing.Multiplex PCR experiment, SAP reaction and iPLEX reaction adopt iPLEX test kit, and Sequenom process is carried out according to routine operation handbook, and the amount that each reaction adds genomic dna is 5-10ng.Extension products utilizes MassArrayNanodispenser to be added drop-wise on SpectroCHIP II-G384 chip, and chip is loaded into MassArray Analyzer analyser and obtains spectrum subsequently.The commercially available MassArrayTyper 4.0 of spectral data analysis software.

Finally determining that PKD1L1 gene has the sudden change of 5 some generating functions, is the gene that mutational site is maximum, therefore selects and analyze further as congenital heart disease emphasis candidate gene.

5, LA-PCR is in conjunction with the order-checking order-checking of two generations and the catastrophe of Sanger sequencing analysis PKD1L1 in 217 samples,

(1) LA-PCR in conjunction with two generation sequencing

Because PKD1L1 comprises 57 exons, total length 173kb, Sanger examining order amount is too huge, therefore adopts LA-PCR to distribute searching sudden change in sample in conjunction with the method that two generations checked order at 217.PKD1L1 full genome is resolved into 11 sections by us, and LA-PCR primer is as follows:

LA-PCR uses commercially available KAPA HiFiHotStart PCR Kits to obtain high guarantee property product.Product is removed residue primer, single-stranded nucleotide and salt by AxyPrep-96PCR Clean-up Kits subsequently and is carried out purifying.

217 sample PCR primer are divided into 18 groups, balanced mix quantitatively, 18 Sample Storehouses are stamped 18 kinds of barcodes to distinguish the SNV that detects from which Sample Storehouse.Subsequently by Illumina GenomeAnalyzer II sequencing analysis, finally obtain the raw data of 5.8Gb altogether.To filter and to annotate result as follows:

Table 5: two generations sequencing analysis PKD1L1 sudden change result

(2) Sanger sequencing

The region that part long segment does not cover adopts common Sanger sequencing, and PCR primer is as follows:

Primer	Sequence	SEQ ID NO.：
			PKD1L1-Exon8-F：	5’＞CTCCCTCATCAGCCTTTC＜3’	25
PKD1L1-Exon8-R：	5’＞GCACCTAAATCTTAGAACCC＜3’	26
			PKD1L1-Exon25-26-F：	5’＞TTCTGAGATGGGCTTTGC＜3’	27
PKD1L1-Exon25-26-R：	5’＞GCTGTAGCGTGGTGGTAT＜3’	28
			PKD1L1-Exon46-F：	5’＞TACGAACTGCAACCATAGGC＜3’	29
PKD1L1-Exon46-R：	5’＞TGCAAATTGAAGCACTCAGG＜3’	30

PKD1L1-Exon57-F：	5’＞TGATATGCATGCCAAACCAG＜3’	31
			PKD1L1-Exon57-R：	5’＞AGCATTCCAGGTTGAATTGG＜3’	32

PCR adopts TouchDown method, and program is as follows:

Amplified production ExoSAP-IT (USB) carries out purifying, BigDye Terminator (ABI) sequencing reaction, and program is as follows:

Product ethanol precipitation is purified, and ABI 3730Genetic Analyzer carries out sequencing analysis subsequently.Sequencing result Chromas analyzes.Find the new PCR that makes a variation subsequently again, check order to filter false positive.

6, statistical analysis

For distributing the different individual mutational site of 17 of finding in patient at 19 routine CHD, the present inventor carries out examination and (does not deliver exon sequencing data for 400 in 800 normal peoples, 400 Sequenom data) all do not find said mutation, to get rid of the possibility of single nucleotide polymorphism (SNP, Singer NucleotidePolymorphism).Between CHD patient and normal people, difference analysis adopts two tail t check analysis (R statistical software).

7. result

17 different mutational sites are in table 1.217 CHD distribute patient, have 19 patients, 17 different loci generation heterozygosis missense mutations, and all do not find in 800 normal peoples (wherein have 2 sites, each site all has 2 patients to undergo mutation).Statistical analysis has significance (P=8.997e ^-6).

In 19 variations, 9 are had to affect PKD2, REJ and GPS structural domain (see Fig. 1).

It should be noted that great majority sudden change all concentrates in method clamp cardiac (VSD, ASD, PDA, PS), only have 4 to appear at purple pincers property cardiac (DROV and TOF).This prompting PKD1L1 sudden change may mainly cause heart diaphragm defect.

Conservative Analysis finds, Val1283 has high conservative type at all selected species, and also has higher conservative type (see Fig. 2) in Tyr622 species selected by mostly.

Embodiment 2

Congenital heart disease susceptibility detection kit

As described in Example 1, in SEQ ID NO:1 the sudden change shown in table 1 and congenital heart disease disease closely related.Therefore, can detect carrying out amplification with the DNA of patient for template based on these sudden change design PKD1L1 gene-specific primers.

Prepare a test kit (100 person-times), it contains:

* note: to exon27-31 region detection

Whether the test group that random choose 100 people are formed, suffer from the object of congenital heart disease, known trouble congenital heart disease patients and after testing without the normal people of congenital heart disease comprising the unknown.

Extract the peripheral blood 3ml of object to be detected in test group, use ordinary method (or using specific test kit) to extract DNA from blood.PCR primer in congenital heart disease detection kit is diluted to 2 μm of ol/ μ l, with extracted DNA for template and the primer provided carry out PCR reaction.After PCR primer purifying, use ABI-PRISM ^tM377DNA sequenator carries out the two-way order-checking of fluorescent mark chain termination method, carries out interpretation and the SNV confirmation of sequence with Chromas software.

Or, amplified production and normal control denaturing high-performance chromatography instrument (DHPLC) are carried out stratographic analysis, also can detect the sudden change shown in table 1.

Detected result:

PKD1L1 is existed to the object of the sudden change shown in table 1, detect to be confirmed whether suffering from congenital heart disease situation further by ordinary method.Detected result shows, contains the congenital heart disease susceptibility ratio of the detected object (Functional mutations especially in REJ region) of sudden change apparently higher than normal population (exceeding at least 2 times).

This shows the sudden change by detecting PKD1L1, can carry out complementary detection and/or the early diagnosis of congenital heart disease.

Embodiment 3

The complementary detection of congenital heart disease susceptibility

Prepare a test kit (300 person-times), it contains:

Repeat the detection of embodiment 2, difference is that the sample (not knowing whether there is Congenital Heart disease symptoms before detection) of random selecting 180 people detects.Wherein, part sample is blood sample (preparation method is with embodiment 1), and part sample is amniocentesis sample.

The preparation of amniotic fluid sample: utilize amniocentesis to perform the operation, gathers amniotic fluid acquisition amniocyte and carries out candidate gene gene mutation analysis.Ordinary method (or using specific test kit) is used to extract DNA from described amniotic fluid.

PCR primer in congenital heart disease detection kit is diluted to 2 μm of ol/ μ l, with the DNA of extracted each sample for template and the primer provided carry out PCR reaction.After PCR primer purifying, use ABI-PRISM ^tM377DNA sequenator carries out the two-way order-checking of fluorescent mark chain termination method, carries out interpretation and the SNV confirmation of sequence with Chromas software.

Result detects that 4 objects exist SNV (isozygotying) (corresponding to mutation T yr622Cys) at the 1865th A → G of the present invention, confirms wherein there are 2 samples from the object suffering from congenital heart disease further by ordinary method.

Application

The inventive method is specially adapted to antenatal diagnosis.Amniocentesis can be used for obtaining Fetal genome DNA, predicts for fetal disease.Because Fetal genome DNA has half from male parent, half is from female parent, and therefore fetus father and mother either party (or in family other members) suffer from congenital heart disease, be then necessary to carry out antenatal diagnosis.Especially when fetus father and mother either party (or in family other members) prove the sudden change of carrying PKD1L1, whether have the sudden change of PKD1L1 can predict the probability size of fetus trouble congenital heart disease, thus contribute to prenatal and postnatal care if so detecting fetus by amniocentesis.

The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (11)

1. the purposes of PKD1L1 gene mononucleotide variation in the reagent or test kit of preparation detection congenital heart disease susceptibility, wherein said single nucleotide variations SNV is:

64th T → C;

368th C → T;

1089th G → T;

1865th A → G;

2008th G → A;

3155th G → A;

3847th G → T;

4598th G → T;

4669th G → A;

4821st A → T;

5090th G → T;

5848th C → T;

6037th C → T;

6125th A → G;

6913rd T → G;

7454th T → A;

8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1;

Describedly be detected as the complementary detection of distributing congenital heart disease.

2. purposes as claimed in claim 1, it is characterized in that, described reagent comprises primer, probe, chip or antibody.

3. purposes as claimed in claim 1, it is characterized in that, described test kit contains the reagent that one or more are selected from lower group:

The Auele Specific Primer of (a) PKD1L1 gene;

B () is for detecting the specific probe in SNV site described in one or more;

C () is for detecting the chip in SNV site described in one or more;

D () is for detecting the specific antibody of the amino acid mutation described in one or more corresponding to SNV site.

4. purposes as claimed in claim 2 or claim 3, it is characterized in that, described primer has the sequence shown in SEQ ID NO:3-32.

5. purposes as claimed in claim 2 or claim 3, it is characterized in that, described primer is the sequence shown in SEQ ID NO.:15 and 16.

6. one kind is detected the test kit of congenital heart disease susceptibility, it is characterized in that, it comprises the primer of specific amplification PKD1L1 gene or transcript, and the length of amplified production that described primer amplification goes out is 100-2000bp and containing one or more single nucleotide variations being selected from lower group:

64th T → C;

368th C → T;

1089th G → T;

1865th A → G;

2008th G → A;

3155th G → A;

3847th G → T;

4598th G → T;

4669th G → A;

4821st A → T;

5090th G → T;

5848th C → T;

6037th C → T;

6125th A → G;

6913rd T → G;

7454th T → A;

8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1;

Describedly be detected as the complementary detection of distributing congenital heart disease.

7. test kit as claimed in claim 6, it is characterized in that, it is also containing the reagent being selected from lower group:

The probe of the combination in (a) and described SNV site;

B () identifies the restriction enzyme in described SNV site.

8. reagent detects the purposes in the test kit of congenital heart disease susceptibility in preparation, and wherein said reagent is selected from lower group:

The Auele Specific Primer of (a) PKD1L1 gene;

(b) for detect PKD1L1 gene one or more described in the specific probe in SNV site;

(c) for detect PKD1L1 gene one or more described in the chip in SNV site; Or

(d) for detect PKD1L1 gene one or more described in the specific antibody of amino acid mutation corresponding to SNV site;

Wherein said SNV site is selected from:

64th T → C;

368th C → T;

1089th G → T;

1865th A → G;

2008th G → A;

3155th G → A;

3847th G → T;

4598th G → T;

4669th G → A;

4821st A → T;

5090th G → T;

5848th C → T;

6037th C → T;

6125th A → G;

6913rd T → G;

7454th T → A;

8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1;

Wherein, described Auele Specific Primer has the sequence shown in SEQ ID NO:3-32;

Describedly be detected as the complementary detection of distributing congenital heart disease.

9. a purposes for people PKD1L1 gene, is characterized in that, for the preparation of the test kit detecting congenital heart disease susceptibility;

Wherein PKD1L1 gene has the SNV site being selected from lower group and is selected from:

64th T → C;

368th C → T;

1089th G → T;

1865th A → G;

2008th G → A;

3155th G → A;

3847th G → T;

4598th G → T;

4669th G → A;

4821st A → T;

5090th G → T;

5848th C → T;

6037th C → T;

6125th A → G;

6913rd T → G;

7454th T → A;

8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1;

Describedly be detected as the complementary detection of distributing congenital heart disease.

10. the PKD1L1 nucleotide sequence be separated, it is characterized in that, described nucleotide sequence as shown in SEQ ID NO.:1, and has the sudden change that is selected from lower group:

64th T → C;

368th C → T;

1089th G → T;

1865th A → G;

2008th G → A;

3155th G → A;

3847th G → T;

4598th G → T;

4669th G → A;

4821st A → T;

5090th G → T;

5848th C → T;

6037th C → T;

6125th A → G;

6913rd T → G;

7454th T → A;

8547th C → A;

Wherein, nucleotide position numbering is based on SEQ ID NO:1.

11. 1 kinds of PKD1L1 aminoacid sequences be separated, it is characterized in that, described aminoacid sequence as shown in SEQ ID NO.:2, and has the sudden change that is selected from lower group: Cys22Arg, Ala123Val, Gln363His, Tyr622Cys, Val670Met, Gly1052Asp, Val1283Leu, Gly1533Val, Val1557Met, Lys1607Asn, Arg1697Ile, Arg1950Cys, Leu2013Phe, His2042Arg, Phe2305Val, Leu2485His, Phe2849Leu,

Wherein, amino acid position number is based on SEQ ID NO:2.