CN110804657A

CN110804657A - Application of DIP2C gene in congenital heart disease diagnosis product

Info

Publication number: CN110804657A
Application number: CN201910735521.4A
Authority: CN
Inventors: 夏宇; 黄曙方; 吴岳恒; 杨永超; 陈少贤; 王永化; 李萍; 陈寄梅; 庄建
Original assignee: GUANGDONG PROV CARDIOVASCULAR DISEASE INST
Current assignee: GUANGDONG PROV CARDIOVASCULAR DISEASE INST
Priority date: 2019-08-09
Filing date: 2019-08-09
Publication date: 2020-02-18

Abstract

The invention provides an application of a DIP2C gene in a congenital heart disease diagnosis product, and particularly relates to an application of the expression level of the DIP2C gene and the DIP2C gene, the mutation of the DIP2C gene or the mutation of the DIP2C gene expression product in the congenital heart disease diagnosis product; the invention also provides an animal model of congenital heart disease, and further proves the relationship between the DIP2C gene and congenital heart disease through a zebra fish experiment.

Description

Application of DIP2C gene in congenital heart disease diagnosis product

Technical Field

The invention relates to an application of DIP2C gene in the diagnosis product of congenital heart disease.

Background

Congenital Heart Disease (CHD) refers to heart and large blood vessels that exhibit abnormal anatomical structures after birth due to abnormal occurrence and development of the heart and large blood vessels during embryonic development. CHD is the most common birth defect in China at present, and accounts for 1/5-1/4 of all birth defects. CHD not only causes physical and psychological pains to patients, but also causes great economic stress and social burden to families and society.

CHD is clinically manifested in a variety of ways, both in isolated onset and in syndromes. The causes of some syndrome-type CHD are closely related to Copy Number Variations (CNVs). CNVs refer to genomic structural variations of DNA fragments ranging from 1Kb to 3Mb in length, including deletions, insertions, duplications, rearrangements, inversions, changes in DNA copy number, and the like. For example, the main cause of 10p15.3microdeletion syndrome (10p15.3microdeletion syndrome) is the deletion of the copy number of the 10p15.3 segment of the patient's chromosome. The 10p15.3microdeletion syndrome is a rare disease, and patients with the syndrome often have clinical manifestations of special face appearance, developmental retardation, mental retardation, limb deformity, CHD and the like.

Although most CHD can be cured by interventional occlusion and open-heart surgery, the partially simplified CHD patient is usually asymptomatic, and is only discovered after symptoms have appeared, or is discovered accidentally during physical examination, a insidious property that poses a potential threat to quality of life and health. For patients with complicated CHD, the operation effect is not ideal and the fatality rate is extremely high. Such complex CHD patients, particularly those with other clinical manifestations such as mental retardation, can take steps if they can be found early in the fetus, either during cardiac surgery or to avoid the fetus from being born. The method has definite familial hereditary history, and can also adopt means such as test tube babies and the like according to the detection result of parents to block the next generation of hereditary same diseases.

The three points all put higher demands on the early discovery, early diagnosis and early treatment of CHD. Currently, the etiology and pathogenesis of CHD has not been fully elucidated, and prenatal screening and prevention remains a dilemma. Reveals the etiology and pathogenesis of CHD, and reduces the birth rate of CHD children patients becomes a great public health subject. Therefore, an accurate, convenient and cheap CHD early diagnosis tool is searched, which not only can explore the etiology of hereditary CHD, but also can clarify the pathogenesis of CHD, and can provide data support for prenatal screening, prenatal diagnosis and differential diagnosis.

Disclosure of Invention

An object of the present invention is to provide a gene related to CHD.

The invention also aims to provide an application of a preparation, a chip or a kit for detecting the expression level of the DIP2C gene, the expression level of the DIP2C gene, the mutation of the DIP2C gene or the mutation of the expression product of the DIP2C gene in diagnosis of congenital heart disease.

The invention also aims to provide a zebra fish model and application thereof in CHD diagnosis and treatment.

In order to achieve the purpose, the invention adopts the following technical scheme:

the first aspect of the invention provides an expression product of DIP2C gene and DIP2C gene, wherein the DIP2C gene has a nucleotide sequence shown as SEQ ID No.1, and an expression product of DIP2C, DIP2C protein has an amino acid sequence shown as SEQ ID No. 2.

In order to analyze the relationship between CHD and the DIP2C gene, the present invention first analyzes the DIP2C gene of some patients with congenital heart disease and their parents by using the CMA method, and confirms congenital heart disease by cardiac ultrasound, Digital Subtraction Angiography (DSA), magnetic resonance imaging/angiography, or computed tomography.

The second aspect of the present invention provides for the first time the use of the DIP2C gene in a product for the detection of congenital heart disease.

Further, the product comprises a reagent for detecting congenital heart disease by detecting the expression level of DIP2C gene, DIP2C gene, mutation of DIP2C gene or mutation of DIP2C gene expression product in a biological sample.

Further, the detection method of the product is at least one of direct nucleic acid sequencing, nucleic acid molecule hybridization technology, nucleic acid amplification technology, nucleic acid probe technology or immunodetection.

Further, the product comprises a formulation, a chip or a kit.

Further, the detection sample of the product is peripheral blood.

The third aspect of the present invention provides a kit for diagnosing CHD, which comprises at least one pair of DIP2C gene-specific amplification primer pairs, a PCR reaction solution, and at least one nucleic acid probe.

Further, the nucleic acid probe is SYBR Green I, a Taqman probe, a molecular beacon, a hybridization probe or a composite probe.

Further, the DIP2C gene specific amplification primer pair has nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO. 4.

In a fourth aspect of the present invention, there is provided a method for constructing an animal model of congenital heart disease, comprising administering a DIP2C inhibitor to a culture system, wherein the culture system comprises a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

Further, a DIP2ca gene inhibitor homologous to the human DIP2C gene was injected into zebrafish embryos.

Further, the inhibitors are antisense morpholine antisense oligonucleotides MO1 (against exon 4-intron 4 splicing region) and MO2 (against ATG site) having the sequence of SEQ ID No.5 or SEQ ID No. 6.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only one embodiment of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

Fig. 1 is CMA results and clinical cardiac ultrasound diagnosis of patients carrying a microdeletion of DIP 2C;

FIG. 2 is a statistical plot of normal gross phenotype and number of phenotypes of zebrafish;

FIG. 3 is a cardiovascular phenotype of zebrafish;

FIG. 4 shows the result of detecting the expression level of dip2ca mRNA in zebra fish CHD model.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The mutation of DIP2C gene includes base substitution mutation, frame shift mutation, deletion mutation and insertion mutation of DIP2C gene, and the mutation of DIP2C gene expression product includes expression product of DIP2C mutant gene.

Methods for detecting the expression level of DIP2C include, but are not limited to: polymerase Chain Reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), Transcription Mediated Amplification (TMA), Ligase Chain Reaction (LCR), Strand Displacement Amplification (SDA) and Nucleic Acid Sequence Based Amplification (NASBA), In Situ Hybridization (ISH), chromosomal microarray expression profiling, Southern or Northern blotting, sandwich ELISA, Radioimmunoassay (RIA), direct, indirect or contrast enzyme-linked immunosorbent assay (ELISA), Enzyme Immunoassay (EIA), Fluorescence Immunoassay (FIA), western blotting, immunoprecipitation, and any particle-based immunoassay (e.g. using gold, silver or latex particles, magnetic particles or quantum dots). Among them, PCR requires reverse transcription of RNA into DNA before amplification (RT-PCR), TMA and NASBA to directly amplify RNA. Detecting the expression level of a gene "refers to determining the presence of mRNA of a marker gene in a biological sample and its expression level in order to predict CHD occurrence and can be accomplished by measuring the amount of mRNA. Analytical methods for this purpose are, but are not limited to, RT-PCR, competitive RT-PCR, Real-time RTPCR, RNase Protection Assay (RPA), Northern blotting, DNA microarray chips, etc.

Methods for detecting gene mutations or protein mutations include, but are not limited to: PCR-SSCP method, heteroduplex analysis method, denaturation gradient gel electrophoresis method, chemical cutting mismatch method, allele specific oligonucleotide analysis method, DNA chip technology, ligase chain reaction, allele specific amplification method, direct sequencing method.

In the present invention, the formulation can determine the presence of mRNA in a sample on a test strip, membrane, chip, disk, test strip, filter, microsphere, slide, multiwell plate, or fiber optic. The assay system can have a solid support to which a nucleic acid corresponding to mRNA is attached. The solid support may comprise, for example, a plastic, a silicon wafer, a metal, a resin, a glass, a membrane, a particle, a precipitate, a gel, a polymer, a sheet, a sphere, a polysaccharide, a capillary, a film, a plate, or a slide. The assay components can be packaged together after manufacture as a kit for detecting mRNA.

Nucleic acid hybridization techniques of the present invention include, but are not limited to, in situ hybridization (FISH), chromosomal microarrays, and Southern or Northern blots. In Situ Hybridization (FISH) is a hybridization of specific DNA or RNA sequences in a tissue section or section using a labeled complementary DNA or RNA strand as a probe (in situ) or in the entire tissue if the tissue is small enough (whole tissue embedded ISH). DNAISH can be used to determine the structure of chromosomes. Rnash is used to measure and locate mRNA and other transcripts (e.g., ncRNA) within tissue sections or whole tissue embedding. Sample cells and tissues are typically treated to fix the target transcript in situ and to increase probe access. The probe is hybridized to the target sequence at high temperature, and then excess probe is washed away. The localization and quantification of base-labeled probes in tissues labeled with radiation, fluorescence or antigens is performed using autoradiography, fluorescence microscopy or immunohistochemistry, respectively. ISH can also use two or more probes labeled with radioactive or other non-radioactive labels to detect two or more transcripts simultaneously.

In the present invention, the immunoassay can be based on any of the following methods:

immunoprecipitation (Immunoprecipitation): immunoprecipitation is the simplest immunoassay method; this method measures the amount of precipitate that is formed after the reagent antibody has been incubated with the sample and reacted with the target antigen present therein to form insoluble aggregates. The immunoprecipitation can be either qualitative or quantitative.

Particle immunoassay: in a particle immunoassay, multiple antibodies are attached to the particle and the particle is capable of binding many antigenic molecules simultaneously. This greatly accelerates the speed of the visible reaction. This allows for a fast and sensitive detection of the biomarker.

Immunoturbidimetry (immunonephelometry): in immunoturbidimetry, the interaction of the antibody and the target antigen on the biomarker causes the formation of an immune complex that is too small to precipitate. However, these complexes will scatter incident light, which can be measured using a turbidimeter. The concentration of the antigen (i.e. biomarker) can be determined within a few minutes of the reaction.

Radioimmunoassay (RIA): radioimmunoassays use radioisotopes such as I125 to label antigens or antibodies. The isotope used emits gamma rays, which are usually measured after removal of unbound (free) radiolabel. The main advantages of RIA compared to other immunoassays are higher sensitivity, easy signal detection and confirmation, fast assay. The main disadvantages are the health and safety risks posed by the use of radiation and the time and expense associated with maintaining the licensed radiation safety and disposal procedures. For this reason, RIA has been largely replaced by enzyme immunoassays in routine clinical laboratory practice.

Enzyme Immunoassay (EIA): enzyme immunoassays use enzymes to label antibodies or target antigens. The sensitivity of EIA is close to that of RIA and there is no risk caused by radioisotopes. One of the most widely used EIA methods for detection is enzyme-linked immunosorbent assay (ELISA). The ELISA method may use two antibodies, one specific for the target antigen and the other coupled to an enzyme, the addition of an enzyme substrate causing the generation of a chemiluminescent or fluorescent signal.

Fluorescence Immunoassay (FIA): fluorescence immunoassay refers to an immunoassay that uses a fluorescent label or an enzyme label that acts on a substrate to form a fluorescent product. Fluorescence measurements are inherently more sensitive than chromatic (spectrophotometric) measurements. Thus, the FIA method has higher analytical sensitivity than the EIA method using absorption (optical density) measurement.

Chemiluminescence immunoassay: chemiluminescent immunoassays (CLIA) use a chemiluminescent label that produces light when excited by chemical energy; the emission is measured using a photodetector.

In the present invention, the inhibitor of DIP2C refers to any substance that can decrease the activity of DIP2C protein, decrease the stability of DIP2C gene or protein, down-regulate the expression of DIP2C protein, decrease the effective duration of DIP2C protein, or inhibit the transcription and translation of DIP2C gene, and can be used in the present invention, for example, the inhibitor is: nucleic acid inhibitors, protein inhibitors, antibodies, ligands, proteolytic enzymes, protein binding molecules, as long as they are capable of down-regulating the expression of DIP2C protein or its encoding gene at the protein or gene level.

Wherein the nucleic acid inhibitor is selected from: an interfering molecule which uses DIP2C or a transcript thereof as a target sequence and can inhibit the expression or the transcription of a DIP2C gene, comprising: shRNA (small hairpin RNA), small interfering RNA (sirna), dsRNA, microrna, antisense nucleic acid, or a construct capable of expressing or forming said shRNA, small interfering RNA, dsRNA, microrna, antisense nucleic acid. The protein binding molecule is selected from: a substance that specifically binds to DIP2C protein, such as an antibody or ligand that inhibits the activity of DIP2C protein.

In an alternative embodiment of the invention, the inhibitor of DIP2C is an antibody that specifically binds to DIP 2C. The specific antibody comprises a monoclonal antibody and a polyclonal antibody; the invention encompasses not only intact antibody molecules, but also any fragment or modification of an antibody, e.g., chimeric antibodies, scFv, Fab, F (ab') 2, Fv, etc. As long as the fragment retains the ability to bind to DIP2C protein. The preparation of antibodies for use at the protein level is well known to those skilled in the art and any method may be used in the present invention to prepare such antibodies.

As an alternative embodiment of the present invention, the inhibitor of DIP2C is a DIP2C specific small interfering RNA molecule. As used herein, the term "small interfering RNA" refers to a short segment of double-stranded RNA molecule that targets mRNA of homologous complementary sequence to degrade a specific mRNA, which is the RNA interference (RNA interference) process. Small interfering RNA can be prepared as a double-stranded nucleic acid form, which contains a sense and an antisense strand, the two strands only in hybridization conditions to form double-stranded. A double-stranded RNA complex can be prepared from the sense and antisense strands separated from each other. Thus, for example, complementary sense and antisense strands are chemically synthesized, which can then be hybridized by annealing to produce a synthetic double-stranded RNA complex.

As an alternative of the present invention, the inhibitor of DIP2C may also be a "Small hairpin RNA (shRNA)" which is a non-coding Small RNA molecule capable of forming a hairpin structure, and the Small hairpin RNA can inhibit gene expression via RNA interference pathway. As described above, shRNA can be expressed from a double-stranded DNA template. The double-stranded DNA template is inserted into a vector, such as a plasmid or viral vector, and then expressed in vitro or in vivo by ligation to a promoter. The shRNA can be cut into small interfering RNA molecules under the action of DICER enzyme in eukaryotic cells, so that the shRNA enters an RNAi pathway. "shRNA expression vector" refers to some plasmids which are conventionally used for constructing shRNA structure in the field, usually, a "spacer sequence" and multiple cloning sites or alternative sequences which are positioned at two sides of the "spacer sequence" are present on the plasmids, so that people can insert DNA sequences corresponding to shRNA (or analogues) into the multiple cloning sites or replace the alternative sequences on the multiple cloning sites in a forward and reverse mode, and RNA after the transcription of the DNA sequences can form shRNA (short Hairpin) structure. The "shRNA expression vector" is completely available by the commercial purchase of, for example, some viral vectors.

In a preferred embodiment of the present invention, the inhibitor of DIP2C is an antisense oligonucleotide, which refers to an RNA or DNA fragment having a sequence complementary to an RNA sequence in vivo and capable of hybridizing to a complementary strand by base pairing, thereby affecting the transcription or translation process. More preferably, the inhibitor is a morpholine antisense oligonucleotide, which is named after a morpholine ring on its nucleotide backbone, replacing a ribonucleotide ring in RNA or a deoxyribonucleotide ring in DNA. Morpholine antisense oligonucleotide is a novel antisense oligonucleotide capable of inhibiting the splicing process of mRNA in cells, thereby inhibiting the expression of genes; meanwhile, the product has good stability, solubility and cell permeability.

To achieve the above object, the present invention first analyzes some patients with congenital heart disease and their parents with the CMA method for their DIP2C gene, and confirms congenital heart disease by cardiac ultrasound, Digital Subtraction Angiography (DSA), magnetic resonance imaging/angiography, or computed tomography.

And (3) CMA detection:

1. collecting samples:

patients diagnosed with CHD at the Guangdong provincial hospital during the 11 th to 2018 th months in 2015 were collected. Patients commonly incorporate a particular facial appearance, mental development disorders and/or behavioral disorders. (blood was retained for patient and their biological parents, patient + biological parents as core family). The diagnosis of CHD is confirmed by cardiac ultrasound, Digital Subtraction Angiography (DSA), magnetic resonance imaging/angiography, or computed tomography. All parents underwent physical examination to confirm clinical performance.

The study was approved by the ethical committee of the people's hospital of Guangdong province. The patient or his parent sign informed consent. The zebrafish experiment was approved by the animal protection and application committee (IACUC) of the national hospital of people, guangdong province.

2. And (3) sample analysis:

2.1DNA extraction: the whole genome DNA of the peripheral blood of a patient and parents is extracted by using a blood genome DNA extraction kit of Tiangen, and the DNA is quantitatively detected by using 1 percent agarose gel electrophoresis and a Nanodrop 2000 spectrophotometer.

2.2CMA detection: all specimens were tested using the Affymetrix chip test platform and AffymetrixCytoscan HD chips. ChAS 2.1software for analysis.

3. And (3) detection results:

the results are shown in figure 1, CMA results show that patients harbor a microdeletion containing the DIP2C gene.

4. Constructing a zebra fish model:

4.1 zebrafish line:

AB strain

4.2 in vitro transcription and embryo injection:

an antisense morpholine antisense oligonucleotide was designed comprising MO1 (for exon 4-intron 4 splicing region) having the nucleotide sequence SEQ ID No.5 and MO2 (for ATG site) having the nucleotide sequence SEQ ID No. 6.

Meanwhile, a control group was prepared using MO3 having the nucleotide sequence of SEQ ID NO. 7.

Zebrafish morphology control experiment 1:

injecting MO1 into cells from a single cell stage to a two cell stage of a plurality of zebra fish embryos, wherein 4ng of each cell is injected, and an inhibition group containing 116 dip2ca genes for inhibiting zebra fish is obtained after 48 hours;

MO3 was injected into cells from the unicellular stage to the bicellular stage of zebra fish embryos, 4ng of each cell was injected, and an inhibition control group containing 116 zebra fish was obtained 48 hours later;

zebrafish morphology control experiment 2:

MO1 was injected into cells from a single-cell stage to a two-cell stage of multiple zebra fish embryos, and 4ng of each cell was injected for 48 hours to obtain a rescue inhibition group containing 102 dip2ca genes for inhibiting zebra fish;

MO3 is injected into cells from a zebra fish embryo in a single cell stage to a two-cell stage, and a rescue control group containing 108 zebra fish is obtained after 4n of injection for 48 h;

MO1 and wild-type zebrafish dip2ca mRNA were injected into the zebrafish embryonic cells from the one-cell stage to the two-cell stage, 4ng of MO1 and 4ng of wild-type zebrafish dip2ca mRNA were injected into each cell, and a rescue group containing 96 zebrafish was obtained 48h later.

4.3 Observation under the mirror

The egg membranes of the zebra fish in the inhibition group and the zebra fish in the control group are stripped by using tweezers, and the zebra fish in the control group are anesthetized by using Tricane. Embryos were fixed in low-melt glue, photographed using a confocal microscope, and zebrafish cerebrovascular phenotypes were assessed using a blinding method by two researchers. The zebra fish brain vessel phenotype is shown in figure 3.

4.4 results

The morphology and statistics of zebrafish are shown in fig. 2, wherein,

(A) representing inhibition of zebrafish posture in the control group:

(B) zebrafish posture, which represents a mild developmental defect in the inhibited group:

(C) zebrafish posture, which represents a severe developmental defect in the inhibited group:

(D) histograms show the proportion of embryo developmental disorders;

inhibiting the normal development of zebra fish in the control group; 43.10% (50) of the inhibited group of zebrafish showed mild developmental defects, and 56.90% (66) of the inhibited group of zebrafish showed severe developmental defects;

(E) comparing the body lengths of the zebra fish in the inhibition group and the zebra fish in the inhibition control group; inhibition control group: 3.287 +/-0.0525 mm; inhibition of mild developmental defects in the group zebrafish: 2.905 + -0.1034 mm; zebrafish with severe developmental defects in the group were inhibited by 1.288 ± 0.1470mm (mean ± sd,. p < 0.05);

(F) representing the posture of the zebra fish in the rescue control group;

(G) representing the posture of the zebrafish in the rescue-inhibited group;

(H) representing the posture of normally developing zebrafish in the rescue group;

(I) histogram shows the proportion of dysplastic embryos in the rescue experiment:

saving the control group, wherein the zebra fish all normally develop; 45.09% (46) of rescue inhibited zebra fish showed mild developmental defect, 54.91% (56) of rescue inhibited zebra fish showed severe developmental defect; 31.25% (30) of the rescued zebrafish, which developed normally, 22.92% (22) of the rescued zebrafish, which exhibited mild developmental defects, and 45.83% (44) of the rescued zebrafish, which exhibited severe developmental defects;

(J) comparing the embryo lengths of the zebrafish of the rescue inhibition group, the rescue control group and the rescue group; rescue group normally developing zebrafish and rescue control group: 3.466 + -0.0263 mm; zebrafish with mild developmental defects in rescue-inhibited and rescue groups: 2.443 +/-0.2091 mm; rescue of zebrafish with severe developmental defects in the suppressor and rescue groups: 1.430 + -0.2786 mm. (mean ± standard deviation,. p < 0.05).

The cardiovascular phenotypic analysis of zebrafish is shown in FIG. 3, wherein

(A) Representing the normal developing zebrafish cardiovascular phenotype in the suppressed control group and the rescue control group;

(B) a zebrafish cardiovascular phenotype indicative of a moderate developmental defect;

(C) a zebrafish cardiovascular phenotype indicative of a severe developmental defect;

(D) representing a cardiovascular phenotype of normally developing zebrafish in the rescue group.

4.5 conclusion:

(1) zebrafish phenotypic analysis showed that zebrafish exhibited head deformity, body segment deformity and shortened body length compared to the inhibition control group (fig. 2A-C). Statistics on the number of zebra fish revealed that the inhibition group had a significantly increased number of zebra fish developmental malformations compared to the control group (fig. 2D, E). And rescue experiments show that exogenous dip2ca mRNA can improve the development condition of the zebra fish with the dip2ca gene inhibited (FIG. 2F-H). Statistics on the number of zebra fish in the rescue experiment shows that the number of developmental malformations of the zebra fish in the rescue experiment group is remarkably reduced (fig. 2I, J), and further proves the role of the dip2ca gene in development.

(2) Phenotypic analysis of the cardiovascular system of zebrafish revealed that the dip2ca-MO group exhibited a range of cardiac malformation characteristics: (1) pericardial edema; (2) prolongation of cardiac vessels, dysfunction of cardiac vessel cyclization and reduced cardiac contractility (fig. 3A-C); rescue experiments clearly reversed the cardiac phenotype and overall morphology of dip2ca-MO, further demonstrating the role of dip2ca in development (fig. 3D).

5. Statistical analysis

5.1RNA extraction

MO1 (targeting exon 4-intron 4 splicing region), MO2 (targeting ATG site) and MO3 were injected into multiple zebrafish embryonic single-cell to two-cell cells, and 4ng of each cell was injected to obtain E4I4-MO group zebrafish, ATG-MO group zebrafish and Control-MO group zebrafish.

Total RNA from 24h embryos was extracted using Trizol method, and the tissues or cells were homogenized and added to 1.5ml centrifuge tubes. Chloroform of 0.2 times the same volume was added, and the mixture was shaken and mixed for 30 seconds. Centrifuge at 15000g for 3min at room temperature. The supernatant was transferred to another clean centrifuge tube. Equal volume of isopropanol was added to the supernatant and mixed on a shaker for 30 s. Centrifugation at 15000g for 5min at room temperature resulted in RNA pellet formation on the side of the bottom of the centrifugation and the supernatant was carefully aspirated off. Cleaning: 1ml of 75% ethanol was added to the centrifuge tube containing the RNA pellet and mixed on a shaker for 30 seconds. Centrifuge at 15000g for 1min at room temperature. The supernatant was carefully aspirated. The washing step is repeated. The centrifuge tube was inverted on filter paper to dry the RNA.

Reverse transcription of RNA

The RNA product was subjected to Reverse transcription using the OneScript Reverse Transcriptase kit, and the Reverse transcription product was subjected to PCR amplification. The primer has a dip2ca gene specificity amplification primer pair with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO. 4:

and (3) PCR reaction conditions: 94 ℃ for 2min, (94 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 1.5min) x 25-30 cycles.

6. Statistical analysis

The sequence of the detection probe is shown in SEQ ID NO. 8. All experiments were performed in at least three replicates and statistical analysis was performed using SPSS23.0 software. Statistically significant is defined as P < 0.05. Zebra fish phenotypic ratio data were analyzed using the t-test.

As shown in FIG. 4, the ordinate represents the expression level of dip2ca mRNA, and the expression level of Control-MO group zebra fish is 1, it can be seen that the expression levels of dip2ca mRNA of E4I4-MO group zebra fish and ATG-MO group zebra fish are greatly reduced, and MO1 and MO2 can be considered to play an effective inhibition role on the dip2ca gene of zebra fish, and can be used for the construction of the zebra fish CHD model.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, it is possible to make several improvements and modifications to the present invention without departing from the principle of the present invention, and those improvements and modifications are also included in the scope of the present invention as claimed.

<110> institute of cardiovascular disease of Guangdong province

Application of <120> DIP2C gene in congenital heart disease diagnosis product

<160>8

<210>1

<211>8121

<212>DNA

<213> Artificial sequence

<220>

<223> DIP2C Gene

<400>1

1 gcgcccgccg cccgcctccc gcgcccgcgc cgccgcctcc tcctcggtgc ggttccgccg

61 ggcgcgagga gccgccgaga cctccgcctg cgaacaaaga ggaggccgtg cggggcgcgg

121 cgcccgcgga gcatggcgga ccgcagcctg gagggcatgg cgctgcccct ggaggtgcgg

181 gcgcgcctgg ccgagctgga gctggagctg tcggaaggtg acatcacaca aaaaggatat

241 gaaaagaaga ggtcaaagtt aattggagcc taccttccgc agcctccgac agcgaatgga

301 gctgccgtgg ttcggtgtag actgcagcac agtgaaggag cgccgaggag aacattccgc

361 tctgcccaca tcggggtgtg cgacgtccga gaagctgcgg ctcgggagcg ggtggccagc

421 accgcaggga accggcctct gttttacttt cgtttcgggg tggaccaagc tttgccgcaa

481 gaacgccggg ctcctgtcac tccttcctcc gcctctcgct accaccgccg acggtcttca

541 gggtcacgag atgagcgcta tcggtcagac gtccacacgg aagctgtcca ggcggctctg

601 gccaaacaca aagagcggaa gatggcagtg cctatgcctt ccaaacgcag gtccctggtc

661 gtgcagacct cgatggacgc ctacacccct ccagatacct cttctggctc agaagatgaa

721 ggctcagtgc agggggactc ccagggcacc cccacctcca gccagggcag catcaatatg

781 gagcactgga tcagccaggc catccacggc tccaccacgt ccaccacctc ctcgtcctct

841 acgcagagcg ggggcagcgg ggctgcccac aggctggcgg acgtcatggc tcagacccac

901 atagaaaatc attctgcacc tcctgacgta accacgtaca cctcagagca ctcgatacag

961 gtggagagac cgcagggttc cacggggtcc cggacagcgc ccaagtacgg caacgccgag

1021 ctcatggaga ccggggatgg agtaccagta agtagccggg tgtcagcaaa aatccagcag

1081 cttgtcaata ccctcaaacg accgaaacga ccacctttac gagaattctt tgtcgatgac

1141 tttgaagaat tattagaagt tcaacaaccg gatccgaacc aaccaaagcc ggagggggcc

1201 cagatgctgg ccatgcgcgg agagcagctg ggcgtggtca cgaactggcc gccgtcgctg

1261 gaggccgcac tgcagaggtg gggcaccatc tcgcccaagg cgccctgcct gaccaccatg

1321 gacaccaacg ggaagcccct ctacatcctc acttacggca agctgtggac aagaagtatg

1381 aaggtcgctt acagcattct acacaaatta ggcacaaagc aggaacccat ggtccggcct

1441 ggagataggg tggcactggt gttccccaac aatgatccgg ctgccttcat ggcggctttc

1501 tacggctgcc tgctggccga ggtggtcccc gtgcccatcg aggtgccgct caccaggaag

1561 gacgcaggga gccagcagat aggtttcttg cttggaagct gtggagttac tgtagccttg

1621 actagtgacg cctgccataa aggacttcca aaaagcccaa cgggagagat cccacagttt

1681 aaaggttggc caaagctgct gtggtttgtc acagagtcta aacatctctc caaaccgccc

1741 cgagactggt tcccacacat taaagatgcc aataacgaca ctgcgtatat tgagtacaag

1801 acgtgtaagg atggcagtgt gctgggtgtg acggtgacga ggactgcgct gctgacacac

1861 tgccaggccc tgacgcaggc gtgtggctac acggaagctg aaaccattgt gaatgtgctg

1921 gatttcaaga aggacgtcgg gctctggcat ggcatcctga caagcgtcat gaacatgatg

1981 catgtgatca gcatcccgta ctcgctgatg aaggtgaacc ctctctcctg gatccagaag

2041 gtctgccagt acaaagcaaa agtggcgtgt gtgaaatcga gggatatgca ttgggcatta

2101 gtagcacaca gagatcagag agacatcaac ctctcctctc tgcgaatgct gatagtggcg

2161 gacggcgcga acccctggtc tatttcttct tgcgatgcat ttctcaatgt cttccaaagt

2221 aaaggccttc gacaggaggt catctgtcct tgtgccagct cgccagaggc cctcactgtg

2281 gccatccgga ggcccacgga tgacagtaac cagcccccgg gccggggtgt cctctccatg

2341 catggactga cctatggggt cattcgtgtg gactcggaag agaagctgtc cgtgctcacc

2401 gtgcaggatg tcggcctcgt gatgcctgga gccatcatgt gttcagtgaa gccagacggg

2461 gttcctcagc tgtgcagaac ggatgagatc ggggagctgt gtgtgtgtgc agttgcgacg

2521 ggcacgtcct actatggcct ctctggcatg accaagaaca cctttgaggt gtttcccatg

2581 acaagctccg gggctccgat cagtgaatac ccattcataa ggacaggctt gctggggttc

2641 gtgggtcccg gaggcctcgt cttcgtggtg ggcaagatgg atggcctcat ggtggtcagc

2701 gggcgcaggc acaacgccga cgacatcgtg gccactgcgc tggccgtaga acccatgaag

2761 tttgtctacc ggggaaggat agccgtgttc tcggtgaccg tgctgcacga cgagaggatc

2821 gtgatcgtgg ctgagcagag gcctgactcc acggaagagg acagtttcca gtggatgagc

2881 cgtgtgctgc aggcgattga cagtatacat caagttggag tttattgcct ggccttggtg

2941 ccagcaaaca ccctccccaa aaccccgctt ggtgggatcc atttatcaga aacaaaacag

3001 ctttttctgg agggctctct gcacccctgc aatgtcctaa tgtgccccca cacctgcgtc

3061 acaaacttgc ctaagcctcg acagaagcag ccagaaatcg gccctgcctc tgtgatggtg

3121 gggaacctgg tctctgggaa gagaatcgcc caggccagtg gcagagacct gggtcagatc

3181 gaagataacg accaggcacg caagttcctg ttcctctcag aggtcttgca gtggagagca

3241 cagaccaccc cggaccacat cctctacacg ctgctcaact gtcggggtgc gatagcgaac

3301 tcgctgacct gcgtgcagct gcacaagaga gctgagaaga tcgccgtgat gctgatggag

3361 aggggccacc ttcaggacgg cgaccacgtg gccttggtct accccccagg aatagacctg

3421 atagcagcgt tttatggttg cctgtacgca ggctgtgtgc caataaccgt ccgtcccccg

3481 cacccacaga acatcgcgac gacgttgcct accgtcaaga tgattgtgga ggtgagtcgc

3541 tctgcctgtc tgatgacgac acagctgatc tgtaagttgc tgcggtccag ggaggcggcg

3601 gcggctgtgg acgtcaggac gtggcccctc atcctggaca cagatgattt gccaaagaag

3661 cggcctgccc agatctgcaa accttgcaac ccagacactc ttgcatatct cgacttcagc

3721 gtgtccacaa ctgggatgct agctggcgta aagatgtctc acgcagccac cagtgccttc

3781 tgccgttcca ttaagctgca gtgtgaactt tacccctcta gagaagtggc catctgcctg

3841 gacccttact gtggactggg atttgtcctc tggtgcctct gcagtgtgta ttctgggcac

3901 cagtccatcc tgatcccgcc ctctgagctg gaaaccaacc ccgccttgtg gcttcttgcc

3961 gtgagtcagt acaaagtccg agacacgttt tgctcctact ccgtgatgga gctgtgcacc

4021 aaggggctgg gctcgcaaac agagtccctc aaggcgcgag ggctggactt gtcccgagtg

4081 aggacctgcg tggttgtggc ggaagagagg cctcggatcg cactcacaca gtcgttctca

4141 aagctgttta aggacctggg ccttcacccg cgggccgtca gcacctcgtt cggttgcagg

4201 gtgaacctgg cgatttgctt gcagcctcac aggctgtgga ccctggccga gcagggaacc

4261 tcaggacctg acccaaccac tgtctacgtg gacatgagag ccctgagaca cgacagagtc

4321 cgcttagtgg aaagaggatc ccctcatagt ctgcccctga tggaatcggg aaagatactt

4381 ccaggggttc ggattataat tgccaaccca gaaacaaaag gaccgctggg ggactcacac

4441 cttggagaga tttgggttca cagtgcccac aatgccagcg gttatttcac tatttacgga

4501 gacgaatccc tccagtcaga tcacttcaac tcaagactaa gttttggaga cacccagacc

4561 atctgggcac gcacaggcta cttggggttc ctgcggagaa ctgagctcac agatgcaaat

4621 ggagagcgcc atgatgccct ctacgtggta ggggcactgg acgaagccat ggagctgcgg

4681 ggcatgcggt accacccaat cgacattgag acctcggtca tcagagccca taaaagcgtt

4741 acggaatgtg ctgtgtttac ctggacaaat ttgttggtgg ttgtggttgagctggatggg

4801 tcggaacaag aagccttgga cctggttccc ttggtgacca acgtggtcct ggaggagcac

4861 tacctgatcg tcggagtggt ggtcgtggtg gacatcggcg tcatccccat caactcccgt

4921 ggggagaagc agcgcatgca cctgcgagac gggtttttgg cagaccagct agaccccatc

4981 tatgtggcct acaacatgta gtctcgtctc ttggcttcca tggacttttc tagagatgta

5041 gacattgttc tccgtgtcca ctgaagcgtg cagacacagg gcaacactca ccagaataca

5101 gccatttgtg gtgagagtgg aggaggaaga ggaggaggaa gaggacttct cacagcagcc

5161 acgattggca tgggggtgaa atgtgaattt accactgaat ttcgctcaga aggactttgg

5221 attactgcct tcagtttgtt ggaaaagccc atttcaaaac tttcttttct tttctttctt

5281 ttttaattat tggataataa gtgctttctt cgtaaatgtg gtattttgtt aagccgaaat

5341 agcaattaaa aaaatatcct gccctccaga tgggttcttt taaacaattt atgtagtgtg

5401 acaaagaatt gttttctctg ttttaatgtg tcatgaaatc ttaatgacat ggatctgtta

5461 ctaatttaag ccattgctag atctcatcct tttaggaaag tttgaggtac gagaaaacct

5521 tccaaatagc accttccaat tagataatag cagctttctt tgtcagaaat gtgctgaaga

5581 aacaaaggct ggtatacggc cttcgaagtt agtatagaat gagaagaaat tataaataag

5641 gtgtatttcg gcaattatct tgcaaatatc tttgtactaa actaaaaaga taaaataagt

5701 taacttcctc aatatgtaat tatgtacaaa acgtttaatt tattttgatc tctttagaac

5761 tataaaagag aaaaacattc aagaatatta aagtcttgta atgtttgcta atataaaaaa

5821 gtgttgtatt atcttgcgtg gatagtatca caacaaatat atatatatga aatataaatt

5881 cactaatgaa caaaggagat tttaaagttt aagatgcaga acttgtcact tgcatggtgt

5941 gccccccgta ctcacataca ctctgctgtt gccagcagtc gcagaccgca ggagccctgt

6001 ctaaaagttt cttctagaac cagagaccag caagtgaaat tattgccatc tcaaggatgg

6061 caaaagaatt caaagctcaa tgtgcactat ttttttcttt gctgtgggac aacagtgaat

6121 gtgtttatgc cagcgtgtgc tgatgatact gaggggcttt aggttggcaa atagcactgt

6181 tttcttagct gcaagaattc attgcacaat gtttttcatc atttttgtta atgtcatctt

6241 tttttggtcc ttgctacgaa aaggaatgcg attctgtggt cattcgcact gggttgcatt

6301 gattccccct ctgatggcca atgtggagtg gacaaagtgt ccggaactca catcggtgat

6361 cgtcccctcg tcttaagacc cagcccgctc tgtgtgagcc tctggggctc cctcgctcag

6421 tgagcacagt tccccggggg ttcatgccag agctccggct gaagcaagaa gtcctccagc

6481 tgcgtcgttt gccgcctgtg gacgagtgcg ccccagtttc tgccctggca gctcctggcc

6541 acaccttctc agagctcacc tgtgcacttc taaattgaat tggcccacgg tgtccaacca

6601 agaaggagca tctgcactcc gagaaagatg tgttctgtaa ctgccccagt gtgaccccgc

6661 agtggctctc ggtgctagat atgcatgact aagattgatg ctgggcaaaa tgtagatgat

6721 ctttcattat gttgtgggca gcgtctttct ctgcctttgc tatatgcagt cagcagtaag

6781 ccttttgcta aaagagtttt gtttgacttc tgagatccaa ggctgattgt tgttaaaaaa

6841 aaaaaaaaaa aaaaagtggc acatttaaaa aaatgtgtct gcatatgtgg tgcatccttc

6901 catctccaca aaccatttga ttcttgaaat attgtttgac ctcattgctg tgtgtgaata

6961 tttctccaca tgcttcagat gcacattcct agtctctgct tcctaagggg ggaaccacca

7021 cacattgggg ggaaaaaaga cattttccta cacccaccca ccttgttgaa agggaggtag

7081 gtttggggct tcaggccagg cactgactat gaaacattag ctgcagtgtg caggacagct

7141 ttgaggtcca gctgaagtca ggaagcaaaa caaatgtaga tgtcacttca aacataattt

7201 caactgtcac cagatcaact ctacattcaa ggagtgtgga cgctgcagtg cagttgtgag

7261 ggcagttagc agccgcctct tctgcatcct gtcaactctg attagttaga gtttaggctc

7321 aaaagagttg gtggactgag attgaaattt ggttgtgcaa gagaaaggaa aggagacact

7381 tagtaccacc agtttcagca ataaagaagg gtcattctgt attcaaaatt gtactgtaga

7441 taaatcattc atgagattgt aaaaaatgtt tgtcttgtga ccttgtgctt ttgaagtcag

7501 acaaaaccgt gtaatcaact tgcacaaaaa gagggtacac agtgaacata taaacacaga

7561 cctaatcaaa caggagcaga ttcctcatgg tgcttgttta ttatatatat ttaatcctgc

7621 ttgacacttt acccaaggga gatggtccct tttatcagtt gaatgttagc agcgttattt

7681 cagagtgtgg tgactggtta gagaaactca tgtactcaac cagccacagt ttcaaacaaa

7741 atttttatgt gcaaaggaca gcaaccttct tgtatgttaa accaccagta cgctttgtac

7801 atctgtgata acgcctgttt tatattcaaa tgaacaaata aaagctttta tttttgttgc

7861 tctgaaaata gcagtttctt aattggtccc ctggaaagat gtctgggaca gctttaatcc

7921 cgggaaggaa gtgactccta cagggaaatg tatctgactc tgtttacata atttgttgca

7981 ttacttagta cagataatca tactttgaaa aatgtttaaa ttttgatgtg ggcatttatt

8041 gctaaaaata attcctatgg caacaaatgt tttgtgaaat gtttttttta attcttttaa

8101 atatatctaa atatatttgt tc

<210>2

<211>1556

<212>PRT

<213> Artificial sequence

<220>

<223> DIP2C Gene expression product

<400>2

1 MADRSLEGMA LPLEVRARLA ELELELSEGD ITQKGYEKKR SKLIGAYLPQ PPRVDQALPQ

61 ERRAPVTPSS ASRYHRRRSS GSRDERYRSD VHTEAVQAAL AKHKERKMAV PMPSKRRSLV

121 VQTSMDAYTP PDTSSGSEDE GSVQGDSQGT PTSSQGSINM EHWISQAIHG STTSTTSSSS

181 TQSGGSGAAH RLADVMAQTH IENHSAPPDV TTYTSEHSIQ VERPQGSTGS RTAPKYGNAE

241 LMETGDGVPV SSRVSAKIQQ LVNTLKRPKR PPLREFFVDD FEELLEVQQP DPNQPKPEGA

301 QMLAMRGEQL GVVTNWPPSL EAALQRWGTI SPKAPCLTTM DTNGKPLYIL TYGKLWTRSM

361 KVAYSILHKL GTKQEPMVRP GDRVALVFPN NDPAAFMAAF YGCLLAEVVP VPIEVPLTRK

421 DAGSQQIGFL LGSCGVTVAL TSDACHKGLP KSPTGEIPQF KGWPKLLWFV TESKHLSKPP

481 RDWFPHIKDA NNDTAYIEYK TCKDGSVLGV TVTRTALLTH CQALTQACGY TEAETIVNVL

541 DFKKDVGLWH GILTSVMNMM HVISIPYSLM KVNPLSWIQK VCQYKAKVAC VKSRDMHWAL

601 VAHRDQRDIN LSSLRMLIVA DGANPWSISS CDAFLNVFQS KGLRQEVICP CASSPEALTV

661 AIRRPTDDSN QPPGRGVLSM HGLTYGVIRV DSEEKLSVLT VQDVGLVMPG AIMCSVKPDG

721 VPQLCRTDEI GELCVCAVAT GTSYYGLSGM TKNTFEVFPM TSSGAPISEY PFIRTGLLGF

781 VGPGGLVFVV GKMDGLMVVS GRRHNADDIV ATALAVEPMK FVYRGRIAVF SVTVLHDERI

841 VIVAEQRPDS TEEDSFQWMS RVLQAIDSIH QVGVYCLALV PANTLPKTPL GGIHLSETKQ

901 LFLEGSLHPC NVLMCPHTCV TNLPKPRQKQ PEIGPASVMV GNLVSGKRIA QASGRDLGQI

961 EDNDQARKFL FLSEVLQWRA QTTPDHILYT LLNCRGAIAN SLTCVQLHKR AEKIAVMLME

1021 RGHLQDGDHV ALVYPPGIDL IAAFYGCLYA GCVPITVRPP HPQNIATTLP TVKMIVEVSR

1081 SACLMTTQLI CKLLRSREAA AAVDVRTWPL ILDTDDLPKK RPAQICKPCN PDTLAYLDFS

1141 VSTTGMLAGV KMSHAATSAF CRSIKLQCEL YPSREVAICL DPYCGLGFVL WCLCSVYSGH

1201 QSILIPPSEL ETNPALWLLA VSQYKVRDTF CSYSVMELCT KGLGSQTESL KARGLDLSRV

1261 RTCVVVAEER PRIALTQSFS KLFKDLGLHP RAVSTSFGCR VNLAICLQGT SGPDPTTVYV

1321 DMRALRHDRV RLVERGSPHS LPLMESGKIL PGVRIIIANP ETKGPLGDSH LGEIWVHSAH

1381 NASGYFTIYG DESLQSDHFN SRLSFGDTQT IWARTGYLGF LRRTELTDAN GERHDALYVV

1441 GALDEAMELR GMRYHPIDIE TSVIRAHKSV TECAVFTWTN LLVVVVELDG SEQEALDLVP

1501 LVTNVVLEEH YLIVGVVVVV DIGVIPINSR GEKQRMHLRD GFLADQLDPI YVAYNM

<210>3

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> DIP2C Gene-specific amplification primer 1

<400>3

agggcagcatcaatatggagc

<210>4

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> DIP2C Gene-specific amplification primer 2

<400>4

ctctgcgtagaggacgagg

<210>5

<211>25

<212>DNA

<213> Artificial sequence

<220>

<223>MO1

<400>5

tctagaatcaggtgtgaagctcacc

<210>6

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>MO2

<400>6

gcggtccgccattgtccgttcaaa

<210>7

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>MO3

<400>7

cctcttacctcagttacaatttata

<210>8

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> detection Probe

<400>8

ccagcaaacaccctccccaaaacc

Claims

The application of the DIP2C gene in a detection product of congenital heart disease.
2. The use of claim 1, wherein said product comprises a reagent for detecting congenital heart disease by detecting the expression level of DIP2C gene, DIP2C gene, mutation in DIP2C gene or mutation in the expression product of DIP2C gene in a biological sample.
3. The use of claim 2, wherein the product is detected by at least one of direct nucleic acid sequencing, nucleic acid hybridization, nucleic acid amplification, nucleic acid probe technology, or immunoassay.
4. Use according to claim 2, wherein the product comprises a formulation, a chip or a kit.
5. Use according to claim 3, wherein the test sample of the product is peripheral blood.
6. The use of claim 4, wherein the kit comprises at least one pair of DIP2C gene-specific amplification primer pairs, a PCR reaction solution, and at least one nucleic acid probe.
7. The use according to claim 6, wherein the nucleic acid probe is SYBR Green I, a Taqman probe, a molecular beacon, a hybridization probe or a composite probe.
8. The use of claim 6, wherein said pair of DIP2C gene-specific amplification primers has the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No. 4.
9. A method for constructing an animal model of congenital heart disease, comprising administering a DIP2C inhibitor to a culture system, wherein the culture system comprises a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system. .
10. The method of claim 9, wherein a dip2ca gene inhibitor is injected into zebrafish embryos, said inhibitor being an antisense morpholine antisense oligonucleotide having the sequence of SEQ ID No.5 or SEQ ID No. 6.