CN113881767A

CN113881767A - Mutant gene capable of causing myocardial hypertrophy and application thereof

Info

Publication number: CN113881767A
Application number: CN202111381689.3A
Authority: CN
Inventors: 刘哲; 梁庆渊; 赵娜娜; 赖开生; 刘昕超; 高璇; 李方玉; 侯青; 惠汝太
Original assignee: Bosinor Beijing Medical Laboratory Co ltd
Current assignee: Bosinor Beijing Medical Laboratory Co ltd
Priority date: 2021-11-22
Filing date: 2021-11-22
Publication date: 2022-01-04
Anticipated expiration: 2041-11-22
Also published as: CN113881767B

Abstract

The invention relates to the technical field of human genetics and cardiovascular of internal medicine, in particular to a mutant gene capable of causing cardiac hypertrophy, wherein when the transcript number is NM-001128855 compared with a reference sequence of a wild GTPBP3 gene coding DNA of which the reference genome version is GRCh37, the nucleotide sequence of the mutant gene GTPBP3 is SEQ ID NO. 5, and a base GGGCCTCGCA is deleted at a genomic position chr19: 17448463; when the transcript number is NM-133644, the nucleotide sequence of the mutant gene GTPBP3 is SEQ ID NO. 7, and the base A is mutated into the base G at chr19: 17451888. The invention also relates to application of the mutant gene capable of causing myocardial hypertrophy in preparation of a detection kit. The mutant gene capable of causing myocardial hypertrophy provided by the invention can be used as a biomarker for clinical auxiliary diagnosis; the carrier of the variation is detected, the prenatal and postnatal care guidance and genetic counseling are provided for the testee, the birth of the child patient is reduced, and the kit has important significance for early diagnosis of combined oxidative phosphorylation deficiency disease or auxiliary clinical judgment.

Description

Mutant gene capable of causing myocardial hypertrophy and application thereof

Technical Field

The invention relates to the technical field of human genetics and internal medicine cardiovascular, in particular to a mutant gene capable of causing myocardial hypertrophy and application thereof.

Background

Mitochondrial DNA (mtDNA) is the only DNA molecule present in the human cytoplasm, independent of the genome outside the nuclear chromosome, with self-replicating, transcription and coding functions, but is also regulated by nuclear DNA. It has been found that mtDNA mutation is involved in various diseases, such as myocardial disease, diabetes, hearing loss, etc.

The GTPBP3 gene has a full length of 44kb, is located at 19p 13.11-19 p12, consists of 9 exons and 8 introns, is highly conserved, has a mitochondrial targeting sequence, is widely expressed in various tissues, particularly in cells with vigorous metabolism, is a nuclear modification gene determined by the first research and related to mitochondrial tRNA modification, and plays an important role in the translation process.

The GTPBP3 gene is related to combined oxidative phosphorylation deficiency which affects cardiovascular system and has phenotype of cardiomyopathy, and the disease can cause myocardial hypertrophy as reported in literature.

At present, a large number of unknown GTPBP3 gene mutation sites still exist, and further, the discovery of new GTPBP3 gene mutation sites is of great significance for researching pathogenesis of combined oxidative phosphorylation deficiency, early diagnosis of combined oxidative phosphorylation deficiency or auxiliary clinical judgment.

Disclosure of Invention

The invention aims at providing a mutant gene capable of causing myocardial hypertrophy and application thereof aiming at combined oxidative phosphorylation deficiency.

The technical scheme provided by the invention is as follows:

compared with a reference sequence of a wild GTPBP3 gene coding DNA of which the reference genome version is GRCh37, when the transcript number is NM-001128855, the nucleotide sequence of the mutant gene GTPBP3 is SEQ ID NO. 5, and the nucleotide GGGCCTCGCA is deleted at the chr19:17448463 position of the genome; when the transcript number is NM-133644, the nucleotide sequence of the mutant gene GTPBP3 is SEQ ID NO. 7, and the base A is mutated into the base G at chr19: 17451888.

The invention also provides application of the mutant gene capable of causing myocardial hypertrophy in preparation of a detection kit.

Preferably, the detection kit comprises primers SEQ ID NO 1-SEQ ID NO 4.

Preferably, the detection kit further comprises Taq DNA polymerase and PCR buffer.

Thirdly, the principle and the beneficial effects of the invention are as follows:

the mutant gene disclosed by the invention can be used as a biomarker for clinical auxiliary diagnosis of combined oxidative phosphorylation deficiency, and has important significance for early diagnosis of combined oxidative phosphorylation deficiency or auxiliary clinical judgment; the detection kit developed based on the mutant gene can detect the patient with the mutant gene which can cause the cardiac hypertrophy, provide the guidance for good prenatal and postnatal care and genetic counseling for the subject and reduce the birth of the infant.

Drawings

FIG. 1 is a family diagram of example 3;

FIG. 2 is a Sanger sequencing plot of proband, proband father, et al, carrying the c.43-52 del heterozygous missense variation (GTPBP3: p.Gly15AspfsTer22 het) in example 3;

FIG. 3 is a Sanger sequencing chart of proband mothers et al in the family of example 3 who did not carry the c.43-52 del heterozygous missense variation (GTPBP3: p.Gly15AspfsTer22 het);

FIG. 4 is a Sanger sequencing chart of the proband, proband mother, et al of the pedigree of example 3 carrying a c.1106A > G heterozygous missense variation (GTPBP3: p.Asp369Gly het);

FIG. 5 is a Sanger sequencing graph of Proben father et al, who did not carry the c.1106A > G heterozygous missense variation (GTPBP3: p.Asp369Gly het) in the pedigree.

Detailed Description

The following is further detailed by way of specific embodiments:

example 1 mutant genes that lead to myocardial hypertrophy

The mutant genes which can cause myocardial hypertrophy are shown in the following table 1:

TABLE 1 results of specific detection of mutant genes which may cause cardiac hypertrophy

(1) When the transcript number is NM-001128855, the sequence of the wild-type GTPBP3 gene at the genomic position chr19:17448420-chr19:17448473 is as follows:

wherein the content of the first and second substances,

is the base of wild GTPBP3 gene at chr19:17448463 genome.

The sequence of the mutant gene GTPBP3 at the corresponding position in the genomic position is:

ATGTGGCGGGGGCTTTGGACCCTGGCGGCCCAAGCGGCACGTGGG。

(2) when the transcript number is NM-001128855, the reference sequence of the DNA for encoding the wild-type GTPBP3 gene is as follows:

the base before mutation at the 43 th-52 th position of the DNA reference sequence for encoding the wild type GTPBP3 gene.

c.43 — 52 del: the base of mutant gene GTPBP3 at position 43-52 is deleted compared with the reference sequence of DNA encoding wild type GTPBP3 gene whose reference genome version is GRCh 37.

(3) When the transcript number is NM-001128855, the amino acid sequence of the wild-type GTPBP3 gene is as follows:

the wild GTPBP3 gene encodes the 15 th glycine (Gly, G) of the protein amino acid sequence.

p.Gly15AspfsTer22 denotes: compared with the amino acid sequence of a wild GTPBP3 gene, the 15 th glycine (Gly, G) of the amino acid of the mutant gene GTPBP3 is mutated into aspartic acid (Asp, D), and the specific amino acid sequence is SEQ ID NO. 6.

(4) When the transcript number is NM-133644, the sequence of the wild-type GTPBP3 gene at the genomic position chr19:17451871-chr19:17451920 is as follows:

is the base of wild GTPBP3 gene at chr19:17451888 genome.

(5) When the transcript number is NM-133644, the sequence of the mutant gene GTPBP3 at the corresponding position of the genome position is as follows:

is the base of the mutant gene GTPBP3 at the genome chr19: 17451888.

(6) Transcript number NM-133644, and the reference sequence of DNA encoding wild-type GTPBP3 gene is:

the base before the 1106 th mutation of the DNA reference sequence for encoding the wild type GTPBP3 gene.

c.1106A > G represents: compared with the reference genome version of the wild GTPBP3 gene coding DNA of GRCh37, the 1106 th base A of the mutant gene GTPBP3 is mutated into a base G, and the specific nucleotide sequence is SEQ ID NO. 7.

(6) When the transcript number is NM-133644, the amino acid sequence of the wild-type GTPBP3 gene is as follows:

is the amino acid sequence of wild GTPBP3 geneAspartic acid at position 369 (Asp, D).

p.asp369gly represents: compared with the amino acid sequence of a wild GTPBP3 gene, the 369 th aspartic acid (Asp, D) of the amino acid sequence of the mutant gene GTPBP3 is mutated into glycine (Gly, G), and the specific nucleotide sequence is SEQ ID NO: 8.

Example 2 detection kit of mutant genes that cause cardiac hypertrophy

The kit for detecting the mutant gene capable of causing myocardial hypertrophy comprises Taq DNA polymerase, PCR buffer solution, primers and the like. The specific primers are as follows:

upstream primer (chr19:17448463, GTPBP3-E1F, SEQ ID NO: 1):

5'TCCCGCTCTCCCTTGCACCAG 3'；

downstream primer (chr19:17448463, GTPBP3-E1R, SEQ ID NO: 2):

5'ACGGAAGAACGCGAATGATTGCT 3'；

length: 363 bp.

Upstream primer (chr19:17451888, GTPBP3-E7F, SEQ ID NO: 3):

5'CACCCAGTGCCTTCAATTGCT 3'；

downstream primer (chr19:17451888, GTPBP3-E7R, SEQ ID NO: 4):

5'CCGACCTTTTACAACCATCCCT 3'；

length: 466 bp.

The method for screening the mutant pathogenic gene GTPBP3 by using the kit comprises the following specific steps: extracting DNA of a person to be detected, amplifying the GTPBP3 gene by using a designed primer combination (SEQ ID NO:1-SEQ ID NO:4) to obtain a PCR product, detecting the PCR product by using 1.5% agarose gel electrophoresis, detecting and verifying the amplification product to be the expected size by using 1000bp Marker as reference, and finally sequencing the PCR product. Obtaining a reference sequence from an NCBI (https:// www.ncbi.nlm.nih.gov /) database and comparing the reference sequence with a sequencing result, judging whether the GTPBP3 gene of a patient carries c.43_52del and c.1106A > G heterozygous missense variation, and assisting the clinical confirmation of the combined oxidative phosphorylation deficiency.

Example 3 family verification experiment

In this example, the pathogenicity of a mutant gene that can cause cardiac hypertrophy was verified by a family linkage analysis method.

Specifically, three generations of members of a familial combined oxidative phosphorylation deficiency family were selected, in which proband (female, 23 years old) was clinically diagnosed as combined oxidative phosphorylation deficiency.

On the premise that the proband the family voluntarily sign an informed consent, the proband and the family send 5-10mL of whole blood samples, establish a medical record database and record the data of the disease condition, the family condition and the like of the proband the family in detail. The study was approved by the ethical committee of the unit.

The in vitro detection kit provided in example 2 was used to perform gene detection on GTPBP3 genes of proband their families, the results are shown in fig. 1-5, and fig. 1 is a family map of example 3; FIG. 2 is a Sanger sequencing plot of proband, proband father, et al, carrying the c.43-52 del heterozygous missense variation (GTPBP3: p.Gly15AspfsTer22 het) in example 3; FIG. 3 is a Sanger sequencing chart of proband mothers et al in the family of example 3 who did not carry the c.43-52 del heterozygous missense variation (GTPBP3: p.Gly15AspfsTer22 het). FIG. 4 is a Sanger sequencing chart of the proband, proband mother, et al of the pedigree of example 3 carrying a c.1106A > G heterozygous missense variation (GTPBP3: p.Asp369Gly het); FIG. 5 is a Sanger sequencing graph of Proben father et al, who did not carry the c.1106A > G heterozygous missense variation (GTPBP3: p.Asp369Gly het) in the pedigree.

As shown in FIGS. 1-5, proband carries suspected pathogenic variation of combined oxidative phosphorylation deficiency of autosomal recessive inheritance, namely GTPBP3 gene c.43_52del heterozygous missense variation (GTPBP3: p.Gly15AspfsTer22 het) and GTPBP3 gene c.1106A > G heterozygous missense variation (GTPBP3: p.Asp369Gly het), families verify that the above variations are inherited from the mother and father respectively, and proband are compound heterozygotes of the above variations; the above variations are conditional on the appearance of a clinical phenotype in the proband.

Example 4 verification experiment against out-of-family Normal persons

The mutation was not detected in 1000 out-of-family normal persons by using the combined oxidative phosphorylation deficiency detection kit of example 2 and detecting the GTPBP3 gene.

Example 5-validation of familial-Ex-familial genetic Combined oxidative phosphorylation deficiency patients

In china, GTPBP3 gene was detected in patients with genetic diseases such as combined oxidative phosphorylation deficiency, hypertrophic cardiomyopathy, dilated cardiomyopathy, and long QT, and the number of patients was varied for each disease in a total of 3100 patients, and the results showed that mutant GTPBP3 gene was detected only in 2 patients clinically diagnosed with combined oxidative phosphorylation deficiency, in addition to the pedigree provided in example 3.

The experiment is verified again to show that the mutant GTPBP3 pathogenic gene can cause combined oxidative phosphorylation deficiency, and supports clinical diagnosis.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Sequence listing

<110> Baishinuo (Beijing) medical laboratory Co., Ltd

<120> mutant gene capable of causing cardiac hypertrophy and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> homo sapiens

<400> 1

tcccgctctc ccttgcacca g 21

<210> 2

<211> 23

<212> DNA

<213> homo sapiens

<400> 2

acggaagaac gcgaatgatt gct 23

<210> 3

<211> 21

<212> DNA

<213> homo sapiens

<400> 3

cacccagtgc cttcaattgc t 21

<210> 4

<211> 22

<212> DNA

<213> homo sapiens

<400> 4

ccgacctttt acaaccatcc ct 22

<210> 5

<211> 108

<212> DNA

<213> homo sapiens

<400> 5

atgtggcggg ggctttggac cctggcggcc caagcggcac gtgattgtgc acgcgccgga 60

gcagcggcgc accagccccc ggctccggcg ccaccatctt cgcgctaa 108

<210> 6

<211> 35

<212> PRT

<213> homo sapiens

<400> 6

Met Trp Arg Gly Leu Trp Thr Leu Ala Ala Gln Ala Ala Arg Asp Cys

1 5 10 15

Ala Arg Ala Gly Ala Ala Ala His Gln Pro Pro Ala Pro Ala Pro Pro

20 25 30

Ser Ser Arg

35

<210> 7

<211> 1575

<212> DNA

<213> homo sapiens

<400> 7

atgtggcggg ggctttggac cctggcggcc caagcggcac gtgggcctcg cagattgtgc 60

acgcgccgga gcagcggcgc accagccccc ggctccggcg ccaccatctt cgcgctaagc 120

tctggccaag gccgctgcgg catcgcagtg atccggacca gcggccccgc cagcggccac 180

gccctccgaa ttctcacagc accccgagac ctgccccttg ctcgccacgc cagcctgcgc 240

ctgctcagcg atccccgctc cggggagcct ctggaccgcg cactggtgct ctggttccca 300

ggtccccaga gtttcaccgg tgaggactgc gtggagttcc acgtgcatgg aggcccggca 360

gtggtgagcg gcgtcctgca ggccttgggc agcgtgccag ggcttcgacc ggcggaggca 420

ggcgagttca ccagacgggc gttcgccaat gggaagctga acctgaccga agtggagggg 480

ctggcggacc ttatccacgc ggaaacagag gcgcagcggc ggcaggccct caggcagctg 540

gacggagagc tgggccacct ctgccgtggc tgggccgaga ccctcaccaa agctctggcc 600

cacgtggagg cctatatcga tttcggcgag gatgacaacc tggaggaggg ggtcctggag 660

caaggtgggt ctacctggtg gtgggggagg aagacacctc atatcagccc tcaaaggctc 720

ccctcactgt ctctctctgc ctgccttctc tcacccacag ccgacatcga agtacgggca 780

ctgcaggtgg ccctgggtgc acatctacga gatgccaggc gcgggcagag gctccgctca 840

ggggtgcacg tagtggtcac tggacccccc aatgcgggca agagcagcct agtgaacctg 900

ctcagtcgga agcctgtgtc catcgtgtcc ccggagccag ggaccacccg tgacgtgctg 960

gagaccccag tcgacctggc cggatttcct gtgctgctga gcgacacggc tgggttgcgg 1020

gagggcgtgg ggcccgtgga gcaggagggc gtgcggcgcg cccgggagag gctagagcag 1080

gctgacctca ttctggccat gctgggtgct tctgacctgg cctctccctc cagttgcaac 1140

ttcctggcca ccgtcgtagc ctctgtggga gcccagagcc ccagtgacag cagccagcgc 1200

ctcctcctgg tgctgaacaa gtcggacctg ctgtccccgg agggcccagg tcccggtcct 1260

gacctgcccc cgcacctgct gctgtcctgt ctgacgggag aggggctgga cggcctcctg 1320

gaggcgctga ggaaggagct agctgcagtg tgtggggacc cgtccacaga tcccccgctg 1380

ctgacccgag caaggcacca gcaccacctc cagggttgcc tggatgccct cggccactac 1440

aagcagtcaa aagacctggc cctggcggca gaggcgctgc gggtggcccg gggtcacctg 1500

acccggctca caggtggagg gggtaccgag gagatcctgg acatcatctt ccaggacttc 1560

tgtgtgggca agtga 1575

<210> 8

<211> 524

<212> PRT

<213> homo sapiens

<400> 8

Met Trp Arg Gly Leu Trp Thr Leu Ala Ala Gln Ala Ala Arg Gly Pro

1 5 10 15

Arg Arg Leu Cys Thr Arg Arg Ser Ser Gly Ala Pro Ala Pro Gly Ser

20 25 30

Gly Ala Thr Ile Phe Ala Leu Ser Ser Gly Gln Gly Arg Cys Gly Ile

35 40 45

Ala Val Ile Arg Thr Ser Gly Pro Ala Ser Gly His Ala Leu Arg Ile

50 55 60

Leu Thr Ala Pro Arg Asp Leu Pro Leu Ala Arg His Ala Ser Leu Arg

65 70 75 80

Leu Leu Ser Asp Pro Arg Ser Gly Glu Pro Leu Asp Arg Ala Leu Val

85 90 95

Leu Trp Phe Pro Gly Pro Gln Ser Phe Thr Gly Glu Asp Cys Val Glu

100 105 110

Phe His Val His Gly Gly Pro Ala Val Val Ser Gly Val Leu Gln Ala

115 120 125

Leu Gly Ser Val Pro Gly Leu Arg Pro Ala Glu Ala Gly Glu Phe Thr

130 135 140

Arg Arg Ala Phe Ala Asn Gly Lys Leu Asn Leu Thr Glu Val Glu Gly

145 150 155 160

Leu Ala Asp Leu Ile His Ala Glu Thr Glu Ala Gln Arg Arg Gln Ala

165 170 175

Leu Arg Gln Leu Asp Gly Glu Leu Gly His Leu Cys Arg Gly Trp Ala

180 185 190

Glu Thr Leu Thr Lys Ala Leu Ala His Val Glu Ala Tyr Ile Asp Phe

195 200 205

Gly Glu Asp Asp Asn Leu Glu Glu Gly Val Leu Glu Gln Gly Gly Ser

210 215 220

Thr Trp Trp Trp Gly Arg Lys Thr Pro His Ile Ser Pro Gln Arg Leu

225 230 235 240

Pro Ser Leu Ser Leu Ser Ala Cys Leu Leu Ser Pro Thr Ala Asp Ile

245 250 255

Glu Val Arg Ala Leu Gln Val Ala Leu Gly Ala His Leu Arg Asp Ala

260 265 270

Arg Arg Gly Gln Arg Leu Arg Ser Gly Val His Val Val Val Thr Gly

275 280 285

Pro Pro Asn Ala Gly Lys Ser Ser Leu Val Asn Leu Leu Ser Arg Lys

290 295 300

Pro Val Ser Ile Val Ser Pro Glu Pro Gly Thr Thr Arg Asp Val Leu

305 310 315 320

Glu Thr Pro Val Asp Leu Ala Gly Phe Pro Val Leu Leu Ser Asp Thr

325 330 335

Ala Gly Leu Arg Glu Gly Val Gly Pro Val Glu Gln Glu Gly Val Arg

340 345 350

Arg Ala Arg Glu Arg Leu Glu Gln Ala Asp Leu Ile Leu Ala Met Leu

355 360 365

Asp Ala Ser Asp Leu Ala Ser Pro Ser Ser Cys Asn Phe Leu Ala Thr

370 375 380

Val Val Ala Ser Val Gly Ala Gln Ser Pro Ser Asp Ser Ser Gln Arg

385 390 395 400

Leu Leu Leu Val Leu Asn Lys Ser Asp Leu Leu Ser Pro Glu Gly Pro

405 410 415

Gly Pro Gly Pro Asp Leu Pro Pro His Leu Leu Leu Ser Cys Leu Thr

420 425 430

Gly Glu Gly Leu Asp Gly Leu Leu Glu Ala Leu Arg Lys Glu Leu Ala

435 440 445

Ala Val Cys Gly Asp Pro Ser Thr Asp Pro Pro Leu Leu Thr Arg Ala

450 455 460

Arg His Gln His His Leu Gln Gly Cys Leu Asp Ala Leu Gly His Tyr

465 470 475 480

Lys Gln Ser Lys Asp Leu Ala Leu Ala Ala Glu Ala Leu Arg Val Ala

485 490 495

Arg Gly His Leu Thr Arg Leu Thr Gly Gly Gly Gly Thr Glu Glu Ile

500 505 510

Leu Asp Ile Ile Phe Gln Asp Phe Cys Val Gly Lys

515 520

Claims

1. A mutant gene which can cause cardiac hypertrophy and is characterized in that when the transcript number is NM-001128855, the nucleotide sequence of the mutant gene GTPBP3 is SEQ ID NO. 5, and the genome position chr19:17448463 lacks base GGGCCTCGCA, compared with the reference sequence of the coding DNA of the wild type GTPBP3 gene of which the reference genome version is GRCh 37; when the transcript number is NM-133644, the nucleotide sequence of the mutant gene GTPBP3 is SEQ ID NO. 7, and the base A is mutated into the base G at chr19: 17451888.

2. Use of the mutant gene according to claim 1 for the preparation of a test kit.

3. The use of claim 2, wherein the detection kit comprises primers SEQ ID NO 1-SEQ ID NO 4.

4. The use of claim 3, wherein the test kit further comprises Taq DNA polymerase and PCR buffer.