CN113981065A

CN113981065A - Hypertrophic cardiomyopathy pathogenic gene MYBPC3 with c.223dupG heterozygosis missense and application thereof

Info

Publication number: CN113981065A
Application number: CN202111285657.3A
Authority: CN
Inventors: 刘哲; 梁庆渊; 赵娜娜; 赖开生; 刘昕超; 高璇; 李方玉; 侯青; 惠汝太
Original assignee: Bestnovo Beijing Medical Technology Co Ltd
Current assignee: Bestnovo Beijing Medical Technology Co Ltd
Priority date: 2021-11-02
Filing date: 2021-11-02
Publication date: 2022-01-28

Abstract

The invention relates to the technical field of human genetics and cardiovascular in internal medicine, in particular to a hypertrophic cardiomyopathy pathogenic gene MYBPC3 with c.223dupG heterozygosis, wherein compared with a reference sequence of a wild MYBPC3 gene coding DNA, the nucleotide sequence of the mutated hypertrophic cardiomyopathy pathogenic gene MYBPC3 coding DNA is SEQ ID NO. 7; at genomic position chr11:47372859, base G is repeated; the reference genomic version is GRCh 37. The invention also relates to application of the mutated hypertrophic cardiomyopathy pathogenic gene MYBPC3 in preparation of a hypertrophic cardiomyopathy detection kit. The mutant pathogenic gene MYBPC3 provided by the invention can be used as a biomarker for clinical auxiliary diagnosis; the carrier for detecting the variation provides a bearing guide and genetic counseling for the prenatal and postnatal care of a subject, reduces the birth of a child patient, and has important significance for early diagnosis of hypertrophic cardiomyopathy or auxiliary clinical diagnosis.

Description

Hypertrophic cardiomyopathy pathogenic gene MYBPC3 with c.223dupG heterozygosis missense and application thereof

Technical Field

The invention relates to the technical field of human genetics and internal medicine cardiovascular, in particular to a hypertrophic cardiomyopathy pathogenic gene MYBPC3 with c.223dupG heterozygosis and application thereof.

Background

In 1958, Teare first described in detail "Hypertrophic Cardiomyopathy (HCM)" and then the concept was evolving, and it was determined that hypertrophic cardiomyopathy is primarily characterized by high incidence of myocardial hypertrophy and sudden death. At present, HCM is considered as a myocardial disease characterized by myocardial hypertrophy, which is mainly manifested by left ventricular wall thickening, usually refers to ventricular septal or left ventricular wall thickness of more than or equal to 15mm measured by two-dimensional echocardiography, or thickness of more than or equal to 13mm measured by definite family history, usually without enlargement of left ventricular cavity, and needs to eliminate the left ventricular wall thickening caused by increased load such as hypertension, aortic stenosis and congenital aortic subcaloric diaphragm.

According to the Chinese guidelines for diagnosing and treating adult hypertrophic cardiomyopathy (2017), most HCMs are inherited in autosomal dominant form and have obvious familial characteristics, which are called as Familial Hypertrophic Cardiomyopathy (FHCM), and about 60% of adult HCM patients can detect definite pathogenic gene mutation. Molecular genetics research proves that about 40-60% of the mutations are mutations of the gene encoding the sarcomere structural protein, and the mutations of the gene encoding the sarcomere structural protein are MYBPC3 (cardiac myosin binding protein C encoding gene), MYH7, TNNT2, TNNI3, TPM1 and MYL3 in descending order.

At present, a large number of unknown MYBPC3 gene mutation sites still exist, and further, the new MYBPC3 gene mutation sites are found to have important significance for researching pathogenesis of hypertrophic cardiomyopathy, early diagnosis of hypertrophic cardiomyopathy or auxiliary clinical diagnosis.

Disclosure of Invention

The invention aims to provide a hypertrophic cardiomyopathy pathogenic gene MYBPC3 with c.223dupG heterozygosis missense and application thereof.

The technical scheme provided by the invention is as follows:

compared with a reference sequence of a wild-type MYBPC3 gene coding DNA, the nucleotide sequence of the mutant MYBPC3 coding DNA is SEQ ID NO. 7; at genomic position chr11:47372859, base G is repeated; the reference genomic version is GRCh 37.

The invention also provides application of the mutated hypertrophic cardiomyopathy pathogenic gene MYBPC3 in preparation of a hypertrophic cardiomyopathy detection kit.

Preferably, the hypertrophic cardiomyopathy detection kit comprises primers for amplifying a pathogenic gene MYBPC3, and the sequences of the primers are SEQ ID NO. 5 and SEQ ID NO. 6.

Preferably, the hypertrophic cardiomyopathy detection kit further comprises Taq DNA polymerase and PCR buffer solution.

Thirdly, the principle and the beneficial effects of the invention are as follows:

the mutant pathogenic gene MYBPC3 disclosed by the invention can be used as a biomarker for clinical auxiliary diagnosis of hypertrophic cardiomyopathy, and has important significance for early diagnosis of hypertrophic cardiomyopathy or auxiliary clinical diagnosis; the detection kit developed based on the mutant pathogenic gene MYBPC3 can detect the patient with the c.223dupG mutant pathogenic gene MYBPC3, provide the bearing guidance and genetic counseling for the test person, and reduce the birth of the child.

Drawings

FIG. 1 is a family diagram of example 3;

FIG. 2 is a Sanger sequencing graph of proband, proband mother, etc. carrying a mutated disease-causing gene MYBPC3 in the family;

FIG. 3 is a Sanger sequencing graph of the father of the proband in the family.

Detailed Description

The following is further detailed by way of specific embodiments:

example 1 hypertrophic cardiomyopathy-causing Gene MYBPC3 with c.223dupG heterozygosity

The hypertrophic cardiomyopathy pathogenic gene MYBPC3 with c.223dupG heterozygosis, and the specific mutations are shown in Table 1:

TABLE 1 specific mutation of the mutant virulence gene MYBPC3

Gene

Genomic position

Transcript number

Base change

Amino acid changes

Reference genome version

Exon number

MYBPC3

chr11:47372859

NM_000256

c.223dupG

p.Asp75GlyfsTer38

GRCh37/hg19

Exon2

(1) At genomic position chr11:47372810-chr11:47372859, the sequence of the wild-type MYBPC3 gene is SEQ ID NO: 1:

is the base before mutation at the genomic position chr11: 47372859;

at genomic position chr10:47372810-chr11:47372860, the sequence of the mutant pathogenic gene MYBPC3 is SEQ ID NO: 2:

base G, which is a repeat (dup) at genomic position chr11: 47372859;

(2) the reference sequence of the wild-type MYBPC3 gene encoding DNA is SEQ ID NO: 3:

base before mutation at position 223 of a reference sequence of DNA coding for a wild-type MYBPC3 gene.

c.223dupg: compared with the reference sequence of the coding DNA of the wild MYBPC3 gene, the nucleotide sequence of the coding DNA is SEQ ID NO. 7, and the base G of the hypertrophic cardiomyopathy pathogenic gene MYBPC3 at the 223 th site has c.223dupG heterozygosis.

(3) The wild MYBPC3 gene coding protein is SEQ ID NO:

aspartic acid (Asp, D) at position 75 of the protein encoded by the wild-type MYBPC3 gene.

p.asp75glyfster38 denotes: the mutation of aspartic acid (Asp, D) at position 75 to glycine (Gly, G) followed by a stop codon at position 37 may result in truncated expression of the protein.

Example 2 application of mutated hypertrophic cardiomyopathy-causing gene MYBPC3 in preparation of hypertrophic cardiomyopathy detection kit

This example provides a kit for detecting human MYBPC3 gene c.223dupG heterozygosis variation, including Taq DNA polymerase, PCR buffer, and MYBPC3 primer for amplifying pathogenic gene.

The specific primer information is as follows:

upstream primer (MYBPC3-E2F, SEQ ID NO: 5): 5'CTCTCCCGACTGCTAGCTG 3';

downstream primer (MYBPC3-E2R, SEQ ID NO: 6): 5'GAAAGCACCTCCTGTTCCCT 3';

length: 591 bp.

The specific steps of screening the patients with c.223dupG MYBPC3 gene mutation by using the kit are as follows: extracting DNA of a person to be detected, amplifying MYBPC3 gene by using designed primer combination (SEQ ID NO:5 and SEQ ID NO:6) to obtain PCR product, detecting the PCR product by using 1.5% agarose gel electrophoresis, detecting and verifying the amplification product to be the expected size by using 1000bp Marker as reference, and finally sequencing the PCR product. And obtaining a reference sequence from an NCBI (https:// www.ncbi.nlm.nih.gov /) database, comparing the reference sequence with a sequencing result, judging whether the MYBPC3 gene of the testee carries c.223dupG heterozygosis variation, and assisting the clinical confirmation of whether the testee has the patient with the c.223dupG MYBPC3 gene mutation.

Example 3 family verification experiment

In this example, the pathogenicity of the mutated pathogenic gene MYBPC3 was verified by family linkage analysis.

Specifically, three generations of members of a hypertrophic cardiomyopathy family are selected, wherein a proband (male, 37 years old) in the family is treated in a hospital outside the hospital of the Chinese medical academy of sciences, and the hypertrophic cardiomyopathy type 4 is clinically diagnosed.

On the premise that the proband the family voluntarily sign an informed consent, the proband and the family send 5-10mL of whole blood samples, establish a medical record database and record the data of the disease condition, the family condition and the like of the proband the family in detail. The study was approved by the ethical committee of the unit.

Description of the prior patient history:

TABLE 2 history of probands

The in vitro detection kit provided in example 2 is used for carrying out gene detection on the MYBPC3 genes of proband and the family members thereof, the detection result is shown in figures 1-3, and figure 1 is a family diagram of example 3; FIG. 2 is a Sanger sequencing graph of proband, proband mother, etc. carrying a mutated disease-causing gene MYBPC3 in the family; FIG. 3 is a Sanger sequencing graph of the father of the proband in the family.

As shown in fig. 1-3, the proband and the proband both of the clinically diagnosed hypertrophic cardiomyopathy in the family carry mutated MYBPC3 pathogenic genes; and the proband brother and proband grandfather grandmother who do not have hypertrophic cardiomyopathy do not carry the mutated MYBPC3 pathogenic gene.

This pedigree validation demonstrates the pathogenicity of the mutant MYBPC3 virulence gene for hypertrophic cardiomyopathy.

Example 4 verification experiment against out-of-family Normal persons

The mutant in-vitro detection kit for the mutant hypertrophic cardiomyopathy pathogenic gene MYBPC3 in example 2 is adopted to detect the mutation site of MYBPC3 gene c.223dupG of 1000 extrafamily normal persons, and the mutation cannot be detected as a result, so that clinical diagnosis is supported.

Example 5 verification experiment for patients with familial extrahypertrophic cardiomyopathy

In china, MYBPC3 gene was detected in patients with monogenic autosomal dominant genetic diseases such as hypertrophic cardiomyopathy, dilated cardiomyopathy, and long QT pulmonary hypertension, and the number of patients varied for each disease in a total of 2100 patients, and the results showed that a mutant MYBPC3 gene having a heterozygous missense variation of c.223dupg was detected only in 5 patients clinically diagnosed with hypertrophic cardiomyopathy, in addition to the family provided in example 3.

The experiment is verified again to show that the pathogenic gene MYBPC3 with c.223dupG heterozygosis variation can cause hypertrophic cardiomyopathy and support clinical diagnosis.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Sequence listing

<110> Baishinuo (Beijing) medical science and technology Co., Ltd

<120> hypertrophic cardiomyopathy pathogenic gene MYBPC3 with c.223dupG heterozygosis missense and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 50

<212> DNA

<213> homo sapiens

<400> 1

gaccagggat cttacgcagt cattgctggc tcctccaagg tcaagttcga 50

<210> 2

<211> 51

<212> DNA

<213> homo sapiens

<400> 2

ggaccaggga tcttacgcag tcattgctgg ctcctccaag gtcaagttcg a 51

<210> 3

<211> 3825

<212> DNA

<213> homo sapiens

<400> 3

atgcctgagc cggggaagaa gccagtctca gcttttagca agaagccacg gtcagtggaa 60

gtggccgcag gcagccctgc cgtgttcgag gccgagacag agcgggcagg agtgaaggtg 120

cgctggcagc gcggaggcag tgacatcagc gccagcaaca agtacggcct ggccacagag 180

ggcacacggc atacgctgac agtgcgggaa gtgggccctg ccgaccaggg atcttacgca 240

gtcattgctg gctcctccaa ggtcaagttc gacctcaagg tcatagaggc agagaaggca 300

gagcccatgc tggcccctgc ccctgcccct gctgaggcca ctggagcccc tggagaagcc 360

ccggccccag ccgctgagct gggagaaagt gccccaagtc ccaaagggtc aagctcagca 420

gctctcaatg gtcctacccc tggagccccc gatgacccca ttggcctctt cgtgatgcgg 480

ccacaggatg gcgaggtgac cgtgggtggc agcatcacct tctcagcccg cgtggccggc 540

gccagcctcc tgaagccgcc tgtggtcaag tggttcaagg gcaaatgggt ggacctgagc 600

agcaaggtgg gccagcacct gcagctgcac gacagctacg accgcgccag caaggtctat 660

ctgttcgagc tgcacatcac cgatgcccag cctgccttca ctggcagcta ccgctgtgag 720

gtgtccacca aggacaaatt tgactgctcc aacttcaatc tcactgtcca cgaggccatg 780

ggcaccggag acctggacct cctatcagcc ttccgccgca cgagcctggc tggaggtggt 840

cggcggatca gtgatagcca tgaggacact gggattctgg acttcagctc actgctgaaa 900

aagagagaca gtttccggac cccgagggac tcgaagctgg aggcaccagc agaggaggac 960

gtgtgggaga tcctacggca ggcaccccca tctgagtacg agcgcatcgc cttccagtac 1020

ggcgtcactg acctgcgcgg catgctaaag aggctcaagg gcatgaggcg cgatgagaag 1080

aagagcacag cctttcagaa gaagctggag ccggcctacc aggtgagcaa aggccacaag 1140

atccggctga ccgtggaact ggctgaccat gacgctgagg tcaaatggct caagaatggc 1200

caggagatcc agatgagcgg cagcaagtac atctttgagt ccatcggtgc caagcgtacc 1260

ctgaccatca gccagtgctc attggcggac gacgcagcct accagtgcgt ggtgggtggc 1320

gagaagtgta gcacggagct ctttgtgaaa gagccccctg tgctcatcac gcgccccttg 1380

gaggaccagc tggtgatggt ggggcagcgg gtggagtttg agtgtgaagt atcggaggag 1440

ggggcgcaag tcaaatggct gaaggacggg gtggagctga cccgggagga gaccttcaaa 1500

taccggttca agaaggacgg gcagagacac cacctgatca tcaacgaggc catgctggag 1560

gacgcggggc actatgcact gtgcactagc gggggccagg cgctggctga gctcattgtg 1620

caggaaaaga agctggaggt gtaccagagc atcgcagacc tgatggtggg cgcaaaggac 1680

caggcggtgt tcaaatgtga ggtctcagat gagaatgttc ggggtgtgtg gctgaagaat 1740

gggaaggagc tggtgcccga cagccgcata aaggtgtccc acatcgggcg ggtccacaaa 1800

ctgaccattg acgacgtcac acctgccgac gaggctgact acagctttgt gcccgagggc 1860

ttcgcctgca acctgtcagc caagctccac ttcatggagg tcaagattga cttcgtaccc 1920

aggcaggaac ctcccaagat ccacctggac tgcccaggcc gcataccaga caccattgtg 1980

gttgtagctg gaaataagct acgtctggac gtccctatct ctggggaccc tgctcccact 2040

gtgatctggc agaaggctat cacgcagggg aataaggccc cagccaggcc agccccagat 2100

gccccagagg acacaggtga cagcgatgag tgggtgtttg acaagaagct gctgtgtgag 2160

accgagggcc gggtccgcgt ggagaccacc aaggaccgca gcatcttcac ggtcgagggg 2220

gcagagaagg aagatgaggg cgtctacacg gtcacagtga agaaccctgt gggcgaggac 2280

caggtcaacc tcacagtcaa ggtcatcgac gtgccagacg cacctgcggc ccccaagatc 2340

agcaacgtgg gagaggactc ctgcacagta cagtgggagc cgcctgccta cgatggcggg 2400

cagcccatcc tgggctacat cctggagcgc aagaagaaga agagctaccg gtggatgcgg 2460

ctgaacttcg acctgattca ggagctgagt catgaagcgc ggcgcatgat cgagggcgtg 2520

gtgtacgaga tgcgcgtcta cgcggtcaac gccatcggca tgtccaggcc cagccctgcc 2580

tcccagccct tcatgcctat cggtcccccc agcgaaccca cccacctggc agtagaggac 2640

gtctctgaca ccacggtctc cctcaagtgg cggcccccag agcgcgtggg agcaggaggc 2700

ctggatggct acagcgtgga gtactgccca gagggctgct cagagtgggt ggctgccctg 2760

caggggctga cagagcacac atcgatactg gtgaaggacc tgcccacggg ggcccggctg 2820

cttttccgag tgcgggcaca caatatggca gggcctggag cccctgttac caccacggag 2880

ccggtgacag tgcaggagat cctgcaacgg ccacggcttc agctgcccag gcacctgcgc 2940

cagaccattc agaagaaggt cggggagcct gtgaaccttc tcatcccttt ccagggcaag 3000

ccccggcctc aggtgacctg gaccaaagag gggcagcccc tggcaggcga ggaggtgagc 3060

atccgcaaca gccccacaga caccatcctg ttcatccggg ccgctcgccg cgtgcattca 3120

ggcacttacc aggtgacggt gcgcattgag aacatggagg acaaggccac gctggtgctg 3180

caggttgttg acaagccaag tcctccccag gatctccggg tgactgacgc ctggggtctt 3240

aatgtggctc tggagtggaa gccaccccag gatgtcggca acacggagct ctgggggtac 3300

acagtgcaga aagccgacaa gaagaccatg gagtggttca ccgtcttgga gcattaccgc 3360

cgcacccact gcgtggtgcc agagctcatc attggcaatg gctactactt ccgcgtcttc 3420

agccagaata tggttggctt tagtgacaga gcggccacca ccaaggagcc cgtctttatc 3480

cccagaccag gcatcaccta tgagccaccc aactataagg ccctggactt ctccgaggcc 3540

ccaagcttca cccagcccct ggtgaaccgc tcggtcatcg cgggctacac tgctatgctc 3600

tgctgtgctg tccggggtag ccccaagccc aagatttcct ggttcaagaa tggcctggac 3660

ctgggagaag acgcccgctt ccgcatgttc agcaagcagg gagtgttgac tctggagatt 3720

agaaagccct gcccctttga cgggggcatc tatgtctgca gggccaccaa cttacagggc 3780

gaggcacggt gtgagtgccg cctggaggtg cgagtgcctc agtga 3825

<210> 4

<211> 1274

<212> PRT

<213> homo sapiens

<400> 4

Met Pro Glu Pro Gly Lys Lys Pro Val Ser Ala Phe Ser Lys Lys Pro

1 5 10 15

Arg Ser Val Glu Val Ala Ala Gly Ser Pro Ala Val Phe Glu Ala Glu

20 25 30

Thr Glu Arg Ala Gly Val Lys Val Arg Trp Gln Arg Gly Gly Ser Asp

35 40 45

Ile Ser Ala Ser Asn Lys Tyr Gly Leu Ala Thr Glu Gly Thr Arg His

50 55 60

Thr Leu Thr Val Arg Glu Val Gly Pro Ala Asp Gln Gly Ser Tyr Ala

65 70 75 80

Val Ile Ala Gly Ser Ser Lys Val Lys Phe Asp Leu Lys Val Ile Glu

85 90 95

Ala Glu Lys Ala Glu Pro Met Leu Ala Pro Ala Pro Ala Pro Ala Glu

100 105 110

Ala Thr Gly Ala Pro Gly Glu Ala Pro Ala Pro Ala Ala Glu Leu Gly

115 120 125

Glu Ser Ala Pro Ser Pro Lys Gly Ser Ser Ser Ala Ala Leu Asn Gly

130 135 140

Pro Thr Pro Gly Ala Pro Asp Asp Pro Ile Gly Leu Phe Val Met Arg

145 150 155 160

Pro Gln Asp Gly Glu Val Thr Val Gly Gly Ser Ile Thr Phe Ser Ala

165 170 175

Arg Val Ala Gly Ala Ser Leu Leu Lys Pro Pro Val Val Lys Trp Phe

180 185 190

Lys Gly Lys Trp Val Asp Leu Ser Ser Lys Val Gly Gln His Leu Gln

195 200 205

Leu His Asp Ser Tyr Asp Arg Ala Ser Lys Val Tyr Leu Phe Glu Leu

210 215 220

His Ile Thr Asp Ala Gln Pro Ala Phe Thr Gly Ser Tyr Arg Cys Glu

225 230 235 240

Val Ser Thr Lys Asp Lys Phe Asp Cys Ser Asn Phe Asn Leu Thr Val

245 250 255

His Glu Ala Met Gly Thr Gly Asp Leu Asp Leu Leu Ser Ala Phe Arg

260 265 270

Arg Thr Ser Leu Ala Gly Gly Gly Arg Arg Ile Ser Asp Ser His Glu

275 280 285

Asp Thr Gly Ile Leu Asp Phe Ser Ser Leu Leu Lys Lys Arg Asp Ser

290 295 300

Phe Arg Thr Pro Arg Asp Ser Lys Leu Glu Ala Pro Ala Glu Glu Asp

305 310 315 320

Val Trp Glu Ile Leu Arg Gln Ala Pro Pro Ser Glu Tyr Glu Arg Ile

325 330 335

Ala Phe Gln Tyr Gly Val Thr Asp Leu Arg Gly Met Leu Lys Arg Leu

340 345 350

Lys Gly Met Arg Arg Asp Glu Lys Lys Ser Thr Ala Phe Gln Lys Lys

355 360 365

Leu Glu Pro Ala Tyr Gln Val Ser Lys Gly His Lys Ile Arg Leu Thr

370 375 380

Val Glu Leu Ala Asp His Asp Ala Glu Val Lys Trp Leu Lys Asn Gly

385 390 395 400

Gln Glu Ile Gln Met Ser Gly Ser Lys Tyr Ile Phe Glu Ser Ile Gly

405 410 415

Ala Lys Arg Thr Leu Thr Ile Ser Gln Cys Ser Leu Ala Asp Asp Ala

420 425 430

Ala Tyr Gln Cys Val Val Gly Gly Glu Lys Cys Ser Thr Glu Leu Phe

435 440 445

Val Lys Glu Pro Pro Val Leu Ile Thr Arg Pro Leu Glu Asp Gln Leu

450 455 460

Val Met Val Gly Gln Arg Val Glu Phe Glu Cys Glu Val Ser Glu Glu

465 470 475 480

Gly Ala Gln Val Lys Trp Leu Lys Asp Gly Val Glu Leu Thr Arg Glu

485 490 495

Glu Thr Phe Lys Tyr Arg Phe Lys Lys Asp Gly Gln Arg His His Leu

500 505 510

Ile Ile Asn Glu Ala Met Leu Glu Asp Ala Gly His Tyr Ala Leu Cys

515 520 525

Thr Ser Gly Gly Gln Ala Leu Ala Glu Leu Ile Val Gln Glu Lys Lys

530 535 540

Leu Glu Val Tyr Gln Ser Ile Ala Asp Leu Met Val Gly Ala Lys Asp

545 550 555 560

Gln Ala Val Phe Lys Cys Glu Val Ser Asp Glu Asn Val Arg Gly Val

565 570 575

Trp Leu Lys Asn Gly Lys Glu Leu Val Pro Asp Ser Arg Ile Lys Val

580 585 590

Ser His Ile Gly Arg Val His Lys Leu Thr Ile Asp Asp Val Thr Pro

595 600 605

Ala Asp Glu Ala Asp Tyr Ser Phe Val Pro Glu Gly Phe Ala Cys Asn

610 615 620

Leu Ser Ala Lys Leu His Phe Met Glu Val Lys Ile Asp Phe Val Pro

625 630 635 640

Arg Gln Glu Pro Pro Lys Ile His Leu Asp Cys Pro Gly Arg Ile Pro

645 650 655

Asp Thr Ile Val Val Val Ala Gly Asn Lys Leu Arg Leu Asp Val Pro

660 665 670

Ile Ser Gly Asp Pro Ala Pro Thr Val Ile Trp Gln Lys Ala Ile Thr

675 680 685

Gln Gly Asn Lys Ala Pro Ala Arg Pro Ala Pro Asp Ala Pro Glu Asp

690 695 700

Thr Gly Asp Ser Asp Glu Trp Val Phe Asp Lys Lys Leu Leu Cys Glu

705 710 715 720

Thr Glu Gly Arg Val Arg Val Glu Thr Thr Lys Asp Arg Ser Ile Phe

725 730 735

Thr Val Glu Gly Ala Glu Lys Glu Asp Glu Gly Val Tyr Thr Val Thr

740 745 750

Val Lys Asn Pro Val Gly Glu Asp Gln Val Asn Leu Thr Val Lys Val

755 760 765

Ile Asp Val Pro Asp Ala Pro Ala Ala Pro Lys Ile Ser Asn Val Gly

770 775 780

Glu Asp Ser Cys Thr Val Gln Trp Glu Pro Pro Ala Tyr Asp Gly Gly

785 790 795 800

Gln Pro Ile Leu Gly Tyr Ile Leu Glu Arg Lys Lys Lys Lys Ser Tyr

805 810 815

Arg Trp Met Arg Leu Asn Phe Asp Leu Ile Gln Glu Leu Ser His Glu

820 825 830

Ala Arg Arg Met Ile Glu Gly Val Val Tyr Glu Met Arg Val Tyr Ala

835 840 845

Val Asn Ala Ile Gly Met Ser Arg Pro Ser Pro Ala Ser Gln Pro Phe

850 855 860

Met Pro Ile Gly Pro Pro Ser Glu Pro Thr His Leu Ala Val Glu Asp

865 870 875 880

Val Ser Asp Thr Thr Val Ser Leu Lys Trp Arg Pro Pro Glu Arg Val

885 890 895

Gly Ala Gly Gly Leu Asp Gly Tyr Ser Val Glu Tyr Cys Pro Glu Gly

900 905 910

Cys Ser Glu Trp Val Ala Ala Leu Gln Gly Leu Thr Glu His Thr Ser

915 920 925

Ile Leu Val Lys Asp Leu Pro Thr Gly Ala Arg Leu Leu Phe Arg Val

930 935 940

Arg Ala His Asn Met Ala Gly Pro Gly Ala Pro Val Thr Thr Thr Glu

945 950 955 960

Pro Val Thr Val Gln Glu Ile Leu Gln Arg Pro Arg Leu Gln Leu Pro

965 970 975

Arg His Leu Arg Gln Thr Ile Gln Lys Lys Val Gly Glu Pro Val Asn

980 985 990

Leu Leu Ile Pro Phe Gln Gly Lys Pro Arg Pro Gln Val Thr Trp Thr

995 1000 1005

Lys Glu Gly Gln Pro Leu Ala Gly Glu Glu Val Ser Ile Arg Asn Ser

1010 1015 1020

Pro Thr Asp Thr Ile Leu Phe Ile Arg Ala Ala Arg Arg Val His Ser

1025 1030 1035 1040

Gly Thr Tyr Gln Val Thr Val Arg Ile Glu Asn Met Glu Asp Lys Ala

1045 1050 1055

Thr Leu Val Leu Gln Val Val Asp Lys Pro Ser Pro Pro Gln Asp Leu

1060 1065 1070

Arg Val Thr Asp Ala Trp Gly Leu Asn Val Ala Leu Glu Trp Lys Pro

1075 1080 1085

Pro Gln Asp Val Gly Asn Thr Glu Leu Trp Gly Tyr Thr Val Gln Lys

1090 1095 1100

Ala Asp Lys Lys Thr Met Glu Trp Phe Thr Val Leu Glu His Tyr Arg

1105 1110 1115 1120

Arg Thr His Cys Val Val Pro Glu Leu Ile Ile Gly Asn Gly Tyr Tyr

1125 1130 1135

Phe Arg Val Phe Ser Gln Asn Met Val Gly Phe Ser Asp Arg Ala Ala

1140 1145 1150

Thr Thr Lys Glu Pro Val Phe Ile Pro Arg Pro Gly Ile Thr Tyr Glu

1155 1160 1165

Pro Pro Asn Tyr Lys Ala Leu Asp Phe Ser Glu Ala Pro Ser Phe Thr

1170 1175 1180

Gln Pro Leu Val Asn Arg Ser Val Ile Ala Gly Tyr Thr Ala Met Leu

1185 1190 1195 1200

Cys Cys Ala Val Arg Gly Ser Pro Lys Pro Lys Ile Ser Trp Phe Lys

1205 1210 1215

Asn Gly Leu Asp Leu Gly Glu Asp Ala Arg Phe Arg Met Phe Ser Lys

1220 1225 1230

Gln Gly Val Leu Thr Leu Glu Ile Arg Lys Pro Cys Pro Phe Asp Gly

1235 1240 1245

Gly Ile Tyr Val Cys Arg Ala Thr Asn Leu Gln Gly Glu Ala Arg Cys

1250 1255 1260

Glu Cys Arg Leu Glu Val Arg Val Pro Gln

1265 1270

<210> 5

<211> 19

<212> DNA

<213> homo sapiens

<400> 5

ctctcccgac tgctagctg 19

<210> 6

<211> 20

<212> DNA

<213> homo sapiens

<400> 6

gaaagcacct cctgttccct 20

<210> 7

<211> 336

<212> DNA

<213> homo sapiens

<400> 7

atgcctgagc cggggaagaa gccagtctca gcttttagca agaagccacg gtcagtggaa 60

gtggccgcag gcagccctgc cgtgttcgag gccgagacag agcgggcagg agtgaaggtg 120

cgctggcagc gcggaggcag tgacatcagc gccagcaaca agtacggcct ggccacagag 180

ggcacacggc atacgctgac agtgcgggaa gtgggccctg ccggaccagg gatcttacgc 240

agtcattgct ggctcctcca aggtcaagtt cgacctcaag gtcatagagg cagagaaggc 300

agagcccatg ctggcccctg cccctgcccc tgctga 336

Claims

1. The hypertrophic cardiomyopathy causing gene MYBPC3 with c.223dupG heterozygosis, characterized in that, compared with the reference sequence of the wild-type MYBPC3 gene coding DNA, the nucleotide sequence of the mutant hypertrophic cardiomyopathy causing gene MYBPC3 coding DNA is SEQ ID NO 7; at genomic position chr11:47372859, base G is repeated; the reference genomic version is GRCh 37.

2. Use of the mutant hypertrophic cardiomyopathy-causing gene MYBPC3 of claim 1 in preparation of a hypertrophic cardiomyopathy detection kit.

3. The use of claim 2, wherein the hypertrophic cardiomyopathy detection kit comprises primers for amplifying a disease-causing gene MYBPC3, wherein the sequences of the primers are SEQ ID NO. 5 and SEQ ID NO. 6.

4. The use of claim 3, wherein the hypertrophic cardiomyopathy detection kit further comprises Taq DNA polymerase and PCR buffer.