CN112442528B

CN112442528B - LOXHD1 gene mutant and application thereof

Info

Publication number: CN112442528B
Application number: CN201910812834.5A
Authority: CN
Inventors: 彭智宇; 孙宇; 向嘉乐; 陈森; 谢文; 李丹; 张红云
Original assignee: Tongji Medical College of Huazhong University of Science and Technology; BGI Shenzhen Co Ltd
Current assignee: Tongji Medical College of Huazhong University of Science and Technology; BGI Shenzhen Co Ltd
Priority date: 2019-08-30
Filing date: 2019-08-30
Publication date: 2022-08-12
Anticipated expiration: 2039-08-30
Also published as: CN115820654A; CN112442528A

Abstract

The invention provides a gene mutant related to non-syndromic deafness and application thereof. The gene mutations provided have a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation, as compared to the wild-type LOXHD1 gene. The gene mutation is a new related pathogenic mutation of non-syndromic deafness, and whether the biological sample suffers from non-syndromic deafness can be effectively detected by detecting whether the mutation exists in the biological sample. The gene mutation further expands and perfects the detection and research of hereditary hearing loss diseases, and provides a new detection site, a new detection method and a new detection way for the diagnosis and treatment of the diseases.

Description

LOXHD1 gene mutant and application thereof

Technical Field

The invention relates to the field of biology, in particular to a gene mutant and application thereof, and more particularly relates to gene mutation, nucleic acid, polypeptide, a biological model, a medicament for treating non-syndrome deafness, a kit for detecting non-syndrome deafness, a construct and a recombinant cell.

Background

Deafness (HL) is the most common disease with sensory dysfunction, and the onset of a considerable number of deafness patients is related to genetic factors. The molecular mechanism of deafness is determined by means of gene detection, prenatal gene diagnosis and intervention measures are further adopted, and the method is an effective means for reducing the incidence rate of deafness and is also one of the fundamental ways for preventing and treating deafness. Hereditary hearing loss can be classified into Syndromic Hearing Loss (SHL) and non-syndromic hearing loss (NSHL) depending on whether there are other clinical phenotypes that are concurrent.

Non-syndromic deafness refers to the unique symptom of deafness in the affected individuals, and has no other genetic damage sexual organ dysfunction, and accounts for about 70% of the non-syndromic deafness in congenital hereditary deafness, wherein 75-80% of the non-syndromic deafness is Autosomal Recessive (AR). To date, more than 100 loci (loci) have been associated with autosomal recessive deafness, these loci being designated as DFNB + numeric forms. The non-syndromic deafness caused by different pathogenic genes has obvious differences in the onset age, hearing loss degree, progressiveness and the like. The determination of the pathogenic gene of the deafness helps to select a proper hearing intervention means for the patient, and the life quality of the deafness patient is better improved.

With the development of sequencing technology, more and more genes related to hereditary hearing loss are identified, which provides a basis for the molecular diagnosis of hereditary hearing loss, so that more hereditary hearing losses can be diagnosed and treated. However, due to the strong genetic heterogeneity of hereditary hearing loss, a large number of pathogenic genes are still unidentified, so that the research on the aspect has a large space, and the research on the aspect of enhancing the gene identification is still needed.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, the invention aims to provide a LOXHD1 gene mutant and application thereof.

LOXHD1 is deafness causing gene corresponding to DFNB77 locus, and lipoxygenase homology domain 1 protein (lipoxygenase homology domain 1) encoded by the gene is mainly expressed in hair cells of cochlea and plays an important role in maintaining normal cell functions. Previous functional tests of animal models show that individuals with homozygous deleterious mutations develop an extremely severe deafness phenotype with early onset.

The deafness caused by pathogenic mutation of LOXHD1 gene is very rare, and only thirty families have been reported in the world. Patients in different reports have multifaceted phenotypic differences, suggesting the possible presence of environmental factors or the influence of genetic regulatory mechanisms; the reported cases also have partial mutations with unclear pathogenicity. Therefore, the research on LOXHD1 gene-related autosomal recessive non-syndromic deafness is still to be conducted, and the discovery of new mutants will help the further research on the corresponding pathogenic mechanism and clinical features.

Aiming at one autosomal recessive non-syndromic deafness Trio family (parents plus probands) collected by the inventor, pathogenic mutation detection and verification are carried out by a method of multi-gene capture sequencing Panel detection, family analysis and Sanger sequencing verification; at the same time, the copy number variation occurring in the sample DNA was verified by qPCR method. Furthermore, the inventor finds a new pathogenic locus of an autosomal recessive non-synthetic deafness pathogenic gene LOXHD1, and the mutant locus can be used for early screening carriers of autosomal recessive non-synthetic deafness pathogenic mutation and further carrying out early intervention treatment before the carriers are attacked; the kit can also be used for molecular diagnosis of autosomal recessive non-synthetic deafness patients and differential diagnosis of related diseases, is quick, accurate, efficient, simple and convenient, has high early diagnosis rate, and can provide scientific basis for early diagnosis and differential diagnosis of autosomal recessive non-synthetic deafness and development of autosomal recessive non-synthetic deafness treatment drugs according to detection results.

In a first aspect of the invention, the invention provides a genetic mutation having a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation, as compared to the wild-type LOXHD1 gene. The inventor firstly finds that the c.5331+1G > C mutation and/or the c.1973_2437+2del mutation of LOXHD1 gene are closely related to the onset of non-syndromic deafness, so that whether the biological sample suffers from non-syndromic deafness can be effectively detected by detecting whether the gene mutation occurs in the biological sample.

In a second aspect, the invention provides a nucleic acid having a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation, as compared to the wild-type LOXHD1 gene. The inventor firstly finds that the c.5331+1G > C mutation and/or the c.1973_2437+2del mutation of LOXHD1 gene are closely related to the onset of non-syndromic deafness, so that whether a biological sample suffers from non-syndromic deafness can be effectively detected by detecting the existence of the nucleic acid in the biological sample.

In a third aspect of the invention, the invention provides a polypeptide expressed from a nucleic acid according to the second aspect of the invention. It was found by studies that c.5331+1G > C mutation in LOXHD1 gene resulted in mRNA that was unstable or susceptible to degradation, resulting in a synthesized protein that was different from or did not express the protein or polypeptide expressed by the wild-type LOXHD1 gene. The polypeptide is closely related to the onset of non-syndrome deafness, so that whether the biological sample suffers from non-syndrome deafness can be effectively detected by detecting whether the polypeptide exists in the biological sample.

In a fourth aspect of the invention, the invention provides the use of a reagent for detecting a gene mutation, which is a gene mutation according to the first aspect of the invention, or a nucleic acid, which is a nucleic acid according to the second aspect of the invention, or a polypeptide, which is a polypeptide according to the third aspect of the invention, in the manufacture of a kit or a device for diagnosing non-syndromic deafness. As mentioned above, the gene mutation, the nucleic acid, the polypeptide are closely related to the onset of non-syndrome deafness, and further the reagent capable of detecting the gene mutation, the nucleic acid or the polypeptide can be used for preparing a kit or equipment, and the obtained kit or equipment can effectively screen out biological samples suffering from non-syndrome deafness, especially autosomal recessive non-syndrome deafness.

In a fifth aspect of the invention, there is provided the use of a biological model for screening for a drug, the biological model carrying at least one of: (1) mutations in the aforementioned genes; (2) the nucleic acid as described above; (3) expressing the polypeptide as described above. It should be noted that "a biological model carries a mutation in a gene according to the first aspect of the present invention" means that the biological model of the present invention carries a LOXHD1 gene having a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation, as compared to the wild-type LOXHD1 gene; "the biological model carries the nucleic acids described above" means that the biological model of the invention carries a nucleic acid sequence which has a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation compared with the LOXHD1 gene; "biological models carry the aforementioned polypeptides" means that the biological models of the invention carry polypeptides which are expressed with the c.5331+1G > C mutation and/or the c.1973_2437+2del mutation of the LOXHD1 gene compared to the wild-type LOXHD1 gene. The biological model thus provided can be effectively used as a model for the study related to non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

In a sixth aspect, the present invention provides the use of an agent which specifically alters a genetic mutation or a nucleic acid, said nucleic acid being a nucleic acid according to the second aspect of the invention, in the manufacture of a medicament for the treatment of non-syndromic deafness. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, particularly autosomal recessive non-syndromic deafness, and thus, a drug prepared from an agent that specifically alters the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

In a seventh aspect of the present invention, there is provided a medicament for the treatment of non-syngenic deafness, said medicament comprising: an agent which specifically alters a genetic mutation according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, and thus, a medicament comprising an agent that specifically alters the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

In an eighth aspect of the invention, there is provided a construct comprising a mutation in a gene according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is to be noted that "the construct comprises a mutation of a gene according to the first aspect of the invention" means that the construct of the invention has a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation compared to the wild type LOXHD1 gene; by "the construct comprises a nucleic acid according to the second aspect of the invention" is meant that the construct of the invention comprises a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation in comparison to the wild type LOXHD1 gene. Thus, the recombinant cells obtained by transforming the receptor cells with the constructs according to the embodiments of the present invention can be effectively used as a model for research related to non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

In a ninth aspect, the present invention provides a recombinant cell obtained by transforming a recipient cell with a construct according to the eighth aspect of the present invention or expressing a polypeptide according to the third aspect of the present invention. The recombinant cell of the present invention can be effectively used as a model for the research related to non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

In a tenth aspect of the invention, the invention provides a kit for detecting non-syndromic deafness, said kit comprising reagents for detecting a mutation in a gene according to the first aspect of the invention, and/or reagents for detecting a nucleic acid according to the second aspect of the invention, and/or reagents for detecting a polypeptide according to the third aspect of the invention. The gene mutation, the nucleic acid and the polypeptide are closely related to the pathogenesis of non-syndrome deafness, and further can be used for effectively screening biological samples suffering from non-syndrome deafness, especially autosomal recessive non-syndrome deafness by using a kit containing a reagent capable of effectively detecting the nucleic acid or the gene mutation or the polypeptide.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

fig. 1 shows a diagram of a family of recessive genetic non-synthetic deafness Trio provided according to an embodiment of the present invention.

FIG. 2 illustrates a graph of pure tone audiometry results for a patient in the family of patients of FIG. 1, provided in accordance with an embodiment of the present invention.

Fig. 3 shows a representative Sanger sequencing validation peak plot of the c.5331+1G > C mutation site of the LOXHD1 gene for all family members in the patient family shown in fig. 1 provided according to one embodiment of the present invention.

Figure 4 shows a graph of qPCR validation results of copy number variation of the LOXHD1 gene for all family members of the patient family shown in figure 1, provided in accordance with one embodiment of the present invention.

Detailed Description

The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

The mainstream method for molecular diagnosis of hereditary hearing loss has been changed from the traditional single-gene sequencing one by one to the polygene capture sequencing Panel. More than 200 hereditary deafness polygene capture sequencing Panel registered in the National Center for Biotechnology Information (NCBI) database, and the corresponding detection range comprises dozens or even hundreds of deafness related genes. Compared with single gene sequencing, the method for sequencing by multi-gene capture has the advantages of wide detection range, low unit cost and capability of comprehensively checking a large-range target area at one time. At the same time, the method can also detect large fragment deletions/duplications at the exon level, i.e. Copy Number Variations (CNV), thus covering more possible pathogenic mechanisms.

Aiming at one autosomal recessive non-syndromic deafness Trio family (parents plus probands) collected by the inventor, pathogenic mutation detection and verification are carried out by a method of multi-gene capture sequencing Panel detection, family analysis and Sanger sequencing verification; at the same time, the copy number variation occurring in the sample DNA was verified by qPCR method. Furthermore, the inventor finds a new pathogenic locus of an autosomal recessive non-synthetic deafness pathogenic gene LOXHD1, namely c.5331+1G > C mutation of LOXHD1 gene. The mutation is located at a classical shearing position, has no record in a plurality of public databases and belongs to a strong low-frequency mutation; and the mutation and the number 15 to number 17 exon deletion copy number variation of the same gene on the other chromosome of the patient form a compound heterozygosis (in trans), and both sites are mutated, which can cause the occurrence of autosomal recessive non-syndromic deafness. In addition, since the two sites are recessive mutations, when any site is homozygous mutated, non-syndromic deafness can be caused.

Herein, the term "non-syndromic deafness" is also commonly referred to in the art as "non-syndromic hereditary deafness", which refers to deafness being the only symptom of an individual's onset, not accompanied by other genetically impaired organ dysfunction.

The term "autosomal recessive non-syndromic deafness", also commonly referred to in the art as "autosomal recessive non-syndromic hereditary deafness" or as "non-syndromic autosomal recessive deafness" or "non-syndromic autosomal recessive hereditary deafness", means that hereditary deafness is controlled by recessive alleles that occur on autosomes, i.e., both alleles are required to appear recessive before the patient becomes ill.

Furthermore, it should be noted that the mutation sites on the LOXHD1 gene provided herein can be used as markers for non-syndromic deafness, more specifically autosomal recessive non-syndromic deafness; or the presence of these mutation sites is used to indicate that the biological sample suffers from non-syndromic deafness, more specifically from autosomal recessive non-syndromic deafness. This does not mean that "non-syndromic deafness" or "autosomal recessive non-syndromic deafness" is a restriction as a site of this mutation in the LOXHD1 gene. That is, if the disease characterized by this mutation site in the LOXHD1 gene is to be specifically indicated or indicated, it is known that it is indicative that the biological sample is afflicted with non-syndromic deafness, more specifically autosomal recessive non-syndromic deafness; but can just as well be informed directly, depending on the specific purpose or on the subject, that genetic deafness, or rather deafness, is present.

Herein, the DNA sequence (e.g.including intron sequences, exon sequences, etc.), RNA sequence, information on the encoded protein, etc. of the wild-type LOXHD1 gene are included in the NCBI database and can be obtained by referring to the following websites: https:// www.ncbi.nlm.nih.gov/gene/125336. The c.5331+1G > C mutation, c.1973_2437+2del mutation, shown herein was determined with reference to the sequence of the wild-type LOXHD1 gene in the NCBI database.

Herein, the c.5331+1G > C mutation shown refers to the mutation of base G at position 1 to C occurring in intron 34 of the wild-type LOXHD1 gene.

Meanwhile, for the convenience of viewing, a part of nucleic acid sequences of the wild-type LOXHD1 gene are provided as follows, and the c.5331+1G > C mutation is corresponding to the 507 th base G mutation of the part of wild-type LOXHD1 gene sequence (SEQ ID NO:1) to be C, namely, the bold and framed base G in the following SEQ ID NO:1 can be mutated to be C:

the coding DNA of the part of the wild-type LOXHD1 gene (NCBI Reference Sequence: NG-016646.2 corresponding to NCBI database accession number) has a nucleotide Sequence (SEQ ID NO:1) from 151831 to 151230 as shown below, wherein the underlined and bolded bases in SEQ ID NO:1 are the positions matched by primers SEQ ID NO:7 and SEQ ID NO: 8:

The inventors found that the LOXHD1 gene mutant had a c.5331+1G > C mutation compared to the wild type LOXHD1 gene, i.e., the 1 st base G of the 34 th intron of the LOXHD1 mutant was mutated to C and the 507 th base G corresponding to the reference sequence (SEQ ID NO: 1) was mutated to C, relative to the wild type LOXHD1 gene. Thus, the encoded product has a disrupted donor site (donor site) at the classical cleavage site on intron 34 compared to the wild type, thereby affecting normal cleavage.

The c.5331+1G > C mutation and the 15 th to 17 th exon deletion of the same gene on the other chromosome (NG _016646.2(LOXHD1_ v001): c.1973_2437+2del) copy number variation form a compound heterozygosity (in trans), which leads to the occurrence of autosomal recessive non-syndromic deafness. Here, "exon deletion copy number variation from No. 15 to No. 17" means: deletion of the sequence from exon nos. 15 to 17, and reduction of copy number resulted in copy number variation, indicated as c.1973_2437+2del mutation.

Also for ease of review, the partial wild type LOXHD1 gene sequence corresponding to the c.1973-2437 +2del mutation is provided below, and the c.1973-2437 +2del mutation corresponds to the deletion of the exon 15 to 17 of the partial wild type LOXHD1 gene sequence (SEQ ID NO:2), underlined sequence deletion in SEQ ID NO:2 below:

The nucleic acid sequence of the part of wild type LOXHD1 gene (corresponding to NCBI database accession number: NG _016646.2) has the following nucleotide sequence (SEQ ID NO:2) from 89601 to 95900, and the bold bases are the matching positions of the primers SEQ ID NO:3 to SEQ ID NO: 6:

it should be noted that the mutation sites and sequences given above are all referred to the contents included in the NCBI database, and it should be understood by those skilled in the art that the mutation sites and sequences shown may be slightly different or changed due to the update of the database or the difference of the database, and the differences or changes can be found by giving the contents of the database, and are also included in the protection scope of the present invention.

Furthermore, as will be understood by those skilled in the art, the location of the wild-type LOXHD1 gene sequence as used herein is based on the sequence of the wild-type LOXHD1 gene in the human genome, but may differ when the wild-type LOXHD1 gene is present in other species, and the wild-type LOXHD1 gene of that species may be aligned with the wild-type LOXHD1 gene in the human genome to obtain the corresponding location in the wild-type LOXHD1 gene of that species.

Gene mutation

In one aspect of the invention, the invention features a genetic mutation. According to an embodiment of the invention, there is a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation compared to the wild-type LOXHD1 gene. The inventors found that c.5331+1G > C mutation and/or c.1973_2437+2del mutation of LOXHD1 gene are closely related to the onset of non-syndromic deafness (e.g., autosomal recessive non-syndromic deafness), and thus whether a biological sample suffers from non-syndromic deafness can be effectively detected by detecting whether the above gene mutation occurs in the biological sample.

A gene mutation generally refers to a change in the structural base pair composition or arrangement of genes. Herein, a genetic mutation refers to a mutation occurring in the LOXHD1 gene. The gene mutation can be detected or otherwise identified as a mutation site in the LOXHD1 gene, as part of the LOXHD1 gene or all of the LOXHD1 gene. Of course, it can be said that the gene mutation can be selected. The gene mutation can be detected by using an antibody, a probe, a primer, a mass spectrometric detection reagent and the like which are commonly used in the field.

Nucleic acids

In yet another aspect of the invention, a nucleic acid is provided. According to an embodiment of the invention, the nucleic acid has the following mutations compared to the wild type LOXHD1 gene: c.5331+1G > C mutation and/or c.1973_2437+2del mutation. The inventors have found that the c.5331+1G > C mutation and/or the c.1973_2437+2del mutation of the LOXHD1 gene are closely related to the onset of non-syndromic deafness, and thus whether a biological sample suffers from non-syndromic deafness can be effectively detected by detecting the presence or absence of the above-mentioned nucleic acids in the biological sample.

For the purposes of the present description and claims, reference to nucleic acids will be understood by those skilled in the art to include virtually either or both of the complementary strands. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to the sequence of the LOXHD1 gene actually includes the complement thereof. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.

It is to be noted that the coding sequence of the wild-type LOXHD1 gene can be obtained from the following website: https:// www.ncbi.nlm.nih.gov/gene/125336.

The c.5331+1G > C mutation and/or the c.1973_2437+2del mutation referred to herein are located in the coding sequence corresponding to the above-mentioned website.

Polypeptides

In another aspect of the invention, the invention features a polypeptide. According to an embodiment of the invention, the polypeptide is expressed from a nucleic acid as described above. As described above, the c.5331+1G > C mutation and/or c.1973_2437+2del mutation of LOXHD1 gene are closely related to the onset of non-syndromic deafness, and the protein expressed by the mutant gene is closely related to the onset of non-syndromic deafness, so that whether a biological sample suffers from non-syndromic deafness can be effectively detected by detecting the presence of the polypeptide in the biological sample.

Use of reagent for detecting nucleic acid, gene mutation and polypeptide in preparation of kit or equipment

In a further aspect of the invention, the invention provides the use of a reagent for a mutation in a gene as hereinbefore described or a nucleic acid as hereinbefore described or a polypeptide as hereinbefore described in the manufacture of a kit or device. According to an embodiment of the invention, the kit or device is for diagnosing non-syndromic deafness. As mentioned above, the nucleic acid, the gene mutation, the polypeptide are closely related to the onset of non-syndromic deafness, and then the reagent for detecting the nucleic acid or the gene mutation or the polypeptide is used for preparing a kit or a device, and the obtained kit or device can effectively screen out biological samples suffering from non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

According to an embodiment of the invention, the non-syndromic deafness is autosomal recessive non-syndromic deafness.

According to an embodiment of the invention, the reagent comprises at least one of an antibody specific for at least one of the nucleic acid, the genetic mutation and the polypeptide, a probe, a primer and a mass spectrometric detection reagent. For example, the inventors can detect the presence of the above mutation in a test sample by the specific binding of an antibody specifically recognizing the polypeptide to the polypeptide, i.e., the presence of the above polypeptide is detected by the interaction of a specific antibody with an antigen; the inventors can also identify the presence of the nucleic acid or gene mutation by designing in advance a probe that specifically recognizes the nucleic acid or gene mutation and complementarily pairing the probe with a nucleic acid fragment in which the site of the nucleic acid or gene mutation is located; the inventors can also design specific primers for amplifying the exons in which the gene mutations are located, and then determine whether the gene mutations exist through gene amplification and sequencing; the inventors also determined by mass spectrometry the presence of the polypeptide expressed by the c.5331+1G > C mutation and/or the c.1973_2437+2del mutation. According to the specific embodiment of the invention, at least one of the antibody, the probe, the primer and the mass spectrometry detection reagent can specifically and highly sensitively screen out the nucleic acid or the gene mutation or the polypeptide, and further specifically and highly sensitively screen out a biological sample suffering from non-syndrome type deafness, especially suffering from autosomal recessive non-syndrome type deafness, and further can be effectively used for preparing a kit or equipment for screening the biological sample suffering from non-syndrome type deafness, especially suffering from autosomal recessive non-syndrome type deafness.

Biological model

In another aspect of the invention, the invention provides the use of a biological model for screening for a drug. According to an embodiment of the invention, the biological model carries at least one of the following: (1) the nucleic acid as described above; (2) mutations in the aforementioned genes; (3) expressing the polypeptide as described above. It is to be noted that "the biological model carries the nucleic acid as described above" means that the biological model of the present invention carries a nucleic acid sequence of a mutant LOXHD1 gene having a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation compared to the wild-type LOXHD1 gene; "the biological model carries the aforementioned gene mutation" means that the biological model of the present invention carries the LOXHD1 gene having the c.5331+1G > C mutation and/or the c.1973_2437+2del mutation as compared with the wild-type LOXHD1 gene. "biological models carry the aforementioned polypeptides" means that the biological models of the invention carry polypeptides expressed with a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation compared to the wild-type LOXHD1 gene. The biological model according to the embodiments of the present invention can be effectively used as a model for the related studies of non-syndromic deafness, especially autosomal recessive non-syndromic deafness. These biological models may be cell models or animal models.

Use of agents for the manufacture of a medicament

In a further aspect of the invention, the invention proposes the use of an agent which specifically alters a nucleic acid as described above or a mutation in a gene as described above, in the manufacture of a medicament for the treatment of non-syndromic deafness. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, and thus, drugs prepared from these agents capable of specifically altering the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

According to embodiments of the invention, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease. For example, the CRISPR-Cas9 realizes genome modification mainly through three ways of gene knockout, introduction of special variation and site-directed transgene, based on the method of CRISPR-Cas9, the inventors can design sgRNA and synthesize gRNA of the sequence, then co-express the gRNA and d Cas9 in cells, and mediate d Cas9 protein to be combined with a target DNA region through the gRNA, thereby realizing repair or change of a specific site.

Medicine for treating non-syndromic deafness

In another aspect of the invention, the invention provides a medicament for treating non-syndromic deafness. According to an embodiment of the invention, the medicament comprises: an agent which specifically alters the aforementioned nucleic acid or the aforementioned gene mutation. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, particularly autosomal recessive non-syndromic deafness, and thus, a medicament comprising an agent that specifically alters the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

According to embodiments of the invention, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease. For example, the CRISPR technology is a technology for modifying a targeted gene by using an RNA-guided Cas protein, CRISPR-Cas9 mainly realizes genome modification through three ways of gene knockout, introduction of a special variation and site-directed transgene, and based on a method of CRISPR-Cas9, the inventors can design sgRNA and synthesize gRNA of the sequence, co-express the gRNA and dCas9 in a cell, and mediate dCas9 protein to be combined with a target DNA region through the gRNA, thereby realizing repair or modification of a specific site.

Construct and recombinant cell

In yet another aspect of the invention, the invention features a construct. According to an embodiment of the invention, the construct comprises the nucleic acid or the genetic mutation as described above. It is to be noted that by "the construct comprises a nucleic acid as described above" is meant that the construct of the invention comprises a nucleic acid having a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation, compared to the wild type LOXHD1 gene. By "the construct comprises a mutation of a gene as described above" is meant that the construct of the invention has a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation compared to the wild type LOXHD1 gene. Thus, the recombinant cells obtained by transforming the receptor cells with the constructs according to the embodiments of the present invention can be effectively used as a model for research related to non-syndromic deafness, especially autosomal recessive non-syndromic deafness. The type of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell or a mammalian cell, and the recipient cell is preferably derived from a mammal.

The term "construct" as used in the present invention refers to a genetic vector comprising a specific nucleic acid sequence and capable of transferring the nucleic acid sequence of interest into a host cell to obtain a recombinant cell. According to an embodiment of the present invention, the form of the construct is not particularly limited. According to an embodiment of the present invention, it may be at least one of a plasmid, a phage, an artificial chromosome, a Cosmid (Cosmid), and a virus, and is preferably a plasmid. The plasmid is used as a genetic carrier, has the characteristics of simple operation, capability of carrying larger fragments and convenience for operation and treatment. The form of the plasmid is not particularly limited, and may be a circular plasmid or a linear plasmid, and may be either single-stranded or double-stranded. The skilled person can select as desired. The term "nucleic acid" used in the present invention may be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, the length of which is not subject to any particular limitation. For constructs used to construct recombinant cells, it is preferred that the nucleic acid be DNA, as DNA is more stable and easier to manipulate than RNA.

In yet another aspect of the invention, a recombinant cell is provided. According to an embodiment of the invention, said recombinant cell is obtained by transforming a recipient cell with a construct as described above or expressing a polypeptide as described above. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a model for research related to non-syndromic deafness, in particular autosomal recessive non-syndromic deafness.

According to the embodiment of the present invention, the kind of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell, a mammalian cell, and preferably, the recipient cell is derived from a non-human mammal.

Kit for detecting non-syndromic deafness

In another aspect of the invention, the invention provides a kit for detecting non-syndromic deafness. According to an embodiment of the invention, the kit comprises reagents for detecting the nucleic acid, and/or for detecting the mutation of the gene, and/or for detecting the polypeptide. As described above, the nucleic acids, gene mutations and polypeptides described above are closely related to the onset of non-syndromic deafness, and thus can be used in a kit comprising reagents effective for detecting the nucleic acids described above or the gene mutations described above or the polypeptides described above, to effectively screen a biological sample suffering from non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

Method for screening biological samples for non-syndromic deafness

In addition to the above, the present invention also provides a method of screening a biological sample for non-syndromic deafness. According to an embodiment of the invention, the method comprises the steps of:

extracting a nucleic acid sample from a biological sample;

determining a nucleic acid sequence of the nucleic acid sample based on the nucleic acid sample;

determining whether the biological sample has non-syndromic deafness based on whether the nucleic acid sequence of the nucleic acid sample, or a complement thereof, has a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation as compared to the wild-type LOXHD1 gene, wherein the nucleic acid sequence of the nucleic acid sample, or a complement thereof, having a c.5331+1G > C mutation and/or a c.1973_2437+2del mutation as compared to the wild-type LOXHD1 gene is indicative of the biological sample having non-syndromic deafness. By the method for screening the biological sample suffering from non-syndromic deafness, particularly autosomal recessive non-syndromic deafness can be effectively screened.

First, a nucleic acid sample is extracted from a biological sample. According to the embodiment of the present invention, the type of the biological sample is not particularly limited as long as a nucleic acid sample reflecting whether or not the LOXHD1 gene of the biological sample is mutated can be extracted from the biological sample. According to an embodiment of the present invention, the biological sample may be at least one selected from human blood, skin, and subcutaneous tissue. Therefore, the sampling and detection can be conveniently carried out, and the efficiency of screening the biological sample with non-syndromic deafness can be further improved. The term "nucleic acid sample" as used herein is to be understood in a broad sense according to embodiments of the present invention and may be any sample that reflects the presence or absence of a mutation in the LOXHD1 gene in a biological sample, such as whole genomic DNA extracted directly from the biological sample, a portion of the whole genome that contains the LOXHD1 gene coding sequence, total RNA extracted from the biological sample, or mRNA extracted from the biological sample. According to one embodiment of the invention, the nucleic acid sample is whole genomic DNA. Therefore, the source range of the biological sample can be expanded, and a plurality of information of the biological sample can be determined simultaneously, so that the efficiency of screening the biological sample with non-syndromic deafness can be improved. In addition, according to an embodiment of the present invention, for using RNA as the nucleic acid sample, extracting the nucleic acid sample from the biological sample may further include: extracting an RNA sample from the biological sample, preferably the RNA sample is mRNA; and obtaining a cDNA sample by reverse transcription reaction based on the obtained RNA sample, the obtained cDNA sample constituting a nucleic acid sample. Thus, the efficiency of screening biological samples suffering from non-syndromic deafness using RNA as a nucleic acid sample can be further improved.

Next, after obtaining the nucleic acid sample, the nucleic acid sample may be analyzed, thereby enabling determination of the nucleic acid sequence of the obtained nucleic acid sample. According to embodiments of the present invention, the method and apparatus for determining the nucleic acid sequence of the resulting nucleic acid sample are not particularly limited. According to embodiments of the present invention, the nucleic acid sequence of a nucleic acid sample may be determined by a sequencing method. Methods and apparatuses that may be used to perform sequencing according to embodiments of the present invention are not particularly limited. According to embodiments of the present invention, second generation sequencing techniques may be employed, as well as third generation and fourth generation or more advanced sequencing techniques. According to embodiments of the invention, a nucleic acid sequence may be sequenced using at least one of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and a single molecule sequencing device. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data can be improved. Thus, according to embodiments of the present invention, determining the nucleic acid sequence of the nucleic acid sample may further comprise: firstly, aiming at the obtained nucleic acid sample, constructing a nucleic acid sequencing library; and sequencing the obtained nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data. According to some embodiments of the invention, the resulting nucleic acid sequencing library may be sequenced using at least one selected from the group consisting of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and single molecule sequencing devices. In addition, according to embodiments of the present invention, a nucleic acid sample may be screened to enrich for LOXHD1 gene exons, and the screening enrichment may be performed before, during, or after the construction of a sequencing library. Exon-targeted sequence enrichment systems such as: the capture chip of the Huada major autonomous exon, and other exons or target region capture platforms such as active SureSelect, Nimblegen and the like enrich target fragments. According to one embodiment of the present invention, constructing a nucleic acid sequencing library for a nucleic acid sample further comprises: performing PCR amplification on the nucleic acid sample by using at least one primer selected from LOXHD1 gene specific primers; and constructing a nucleic acid sequencing library aiming at the obtained amplification products. Therefore, the LOXHD1 gene exon can be enriched through PCR amplification, so that the efficiency of screening biological samples with non-syndromic deafness can be further improved. According to the embodiment of the present invention, the sequence of LOXHD1 gene-specific primers is not particularly limited, and can be obtained by, for example, on-line design using Primer3.0 with reference to the human genome sequence database GRCh37.1/hg19, such as UCSC (http:// genome. UCSC. edu /), Primer3(version 0.4.0, http:// Primer3.ut. ee /) can be applied to design and synthesize primers for candidate genes (synthetic by Biotech), and Primer-BLAST (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST /) can be used to verify the Primer specificity.

With regard to the methods and procedures for constructing sequencing libraries for nucleic acid samples, those skilled in the art may make appropriate selections based on different sequencing techniques, and with regard to the details of the procedures, see the manufacturers of sequencing instruments such as the protocols provided by Illumina, see, for example, the Multiplexing Sample Preparation Guide (Part # 1005361; Feb 2010) or Paired-End Sample Preparation Guide (Part # 1005063; Feb 2010), incorporated herein by reference. The method and apparatus for extracting a nucleic acid sample from a biological sample according to an embodiment of the present invention are not particularly limited, and may be performed using a commercially available nucleic acid extraction kit.

It should be noted that the term "nucleic acid sequence" used herein should be understood in a broad sense, and may be complete nucleic acid sequence information obtained by assembling sequencing data obtained by sequencing a nucleic acid sample, or may be nucleic acid sequences directly obtained by using sequencing data (reads) obtained by sequencing a nucleic acid sample, as long as the nucleic acid sequences contain the coding sequence of the corresponding LOXHD1 gene.

Finally, after determining the nucleic acid sequence of the nucleic acid sample, the reference sequences corresponding to the nucleic acid sequences of the obtained nucleic acid sample are aligned, and when the obtained nucleic acid sequence has the aforementioned mutation, the biological sample is indicated to suffer from non-syndromic deafness. Thus, by the method for screening a biological sample suffering from non-syndromic deafness according to the embodiment of the present invention, a biological sample suffering from non-syndromic deafness can be effectively screened. The method and apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to embodiments of the present invention are not particularly limited and may be performed using any conventional software, and according to embodiments of the present invention, alignment may be performed using SOAPALIGNER/SOAP 2.

It should be noted that the use of the "method for screening a biological sample suffering from non-syndromic deafness" according to the embodiment of the present invention is not particularly limited, and for example, the method can be used as a screening method for non-diagnostic purposes, such as scientific research or other applications.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 determination of autosomal recessive non-syndromic deafness-causing mutations

1. Sample collection

The inventor collects the Trio family (parents + probands) of Chinese Han family autosomal recessive non-syndromic deafness patients, and the family chart is shown in figure 1. Where, o indicates a normal female, □ indicates a normal male, ● indicates a female patient, and the arrow indicates a proband.

As shown in FIG. 1, the family includes 3 members, the parents are normal persons (i.e. I-1 and I-2 in the family map), and the daughter is a deaf patient (i.e. II-1 in the family map) and accords with the autosomal recessive inheritance pattern.

The pure tone audiometry results of patients in this family are shown in fig. 2. In fig. 2, the abscissa indicates the frequency of pure tones, the ordinate indicates the hearing level, and if the hearing is normal, the threshold curve should be floating around 0, and going down indicates a hearing loss. As shown in FIG. 2, the pure tone audiometry results showed that the patient II-1 had moderate-severe deafness in the left ear and moderate deafness in the right ear, and the hearing curve showed a high-frequency steep descending pattern.

The inventors collected peripheral blood samples from all members of the family, added EDTA for anticoagulation, and stored at-80 ℃. All blood samples were signed with informed consent.

2. DNA extraction

Taking peripheral blood of all members of the family, extracting the genomic DNA of peripheral blood leucocyte by QIAmp BLOOD kit (Qiagen, Hilden, Germany), and measuring the concentration and purity of the DNA by using a QubitFluorometer and agarose gel electrophoresis, wherein the obtained genomic DNA OD260/OD280 of each sample is between 1.7 and 2.0, the concentration is not less than 50 ng/microliter, and the total amount is not less than 3 micrograms.

3. Capture sequencing

Samples of all pedigree members were sequenced using chip capture technology in combination with the high throughput sequencing technology of Illumina Hiseq 2500. The capture range of the corresponding custom capture chip (Agilent, Santa Clara, CA, USA) comprises a total of 2268 exons and adjacent regions of 127 known deafness-related genes, the total length of the capture region being 619 Kb. The method mainly comprises the steps of ultrasonic breaking, library preparation and machine sequencing.

And after the sequencing data is downloaded, performing mutation detection, annotation and database comparison by using an internal customization process, and determining candidate pathogenic sites according to the means such as crowd frequency, software prediction results, family analysis and the like. Meanwhile, the region with the sequencing depth deviating from the normal range is manually inspected, and qPCR method is adopted to verify the suspected copy number variation.

As a result, a heterozygous c.5331+1G > C mutation is found in the LOXHD1 gene of the patient, and the copy number variation of the heterozygous deletion is suspected to be caused by the abnormal depth from No. 15 exon to No. 17 exon of the gene. Pedigree analysis showed that the patient's mother and father were heterozygous to carry the c.5331+1G > C mutation and the suspected copy number variation of the same region, respectively.

According to the recessive inheritance pattern of the LOXHD1 gene-related deafness, if the copy number variation is verified as true positive by qPCR and the c.5331+1G > C mutation is verified as true positive by Sanger, the two variants forming the compound heterozygosity can be confirmed as the pathogenic cause of the deafness of the patient.

4. qPCR validation of copy number variation

Designing and synthesizing specific primers according to No. 15 exons and No. 17 exons at two ends of a suspected heterozygous deletion area, wherein the primer information is as follows:

Exon 15 forward primer: TGATTGTCTGCCTGCTCCAC (SEQ ID NO:3)

Exon 15 downstream primer: GCTGTCACTGGGTAGCAACT (SEQ ID NO:4)

Exon 17 forward primer: GTGATTGGGCATGACAGCAC (SEQ ID NO:5)

Exon 17 downstream primer: GTTGGCGGGAAAGGTGTACT (SEQ ID NO:6)

qPCR verification was performed using the above specific primers, and the data volume of the amplification primers was quantified using the Power SYBR Green PCR Master Mix (ABI) connected real-time system. As shown in fig. 4, the quantification results showed that the patient and father LOXHD1 gene exon regions No. 15 to No. 17 confirmed the presence of heterozygous deletion copy number variation compared to the normal control samples.

Example 2 sequencing validation by Sanger method

All family members (including patients and hearing-normal parents) LOXHD1 genes in the family of autosomal recessive non-syngeneic deafness patients described in example 1 were tested separately: designing a primer aiming at the c.5331+1G > C mutation of the LOXHD1 gene, obtaining a related sequence of a mutation site by a PCR amplification, product purification and sequencing method, and verifying whether the c.5331+1G > C mutation of the LOXHD1 gene is detected in a sample according to whether a sequence determination result belongs to a mutant type or a wild type.

The method comprises the following specific steps:

1. DNA extraction

According to the DNA extraction method described in example 1, genomic DNA in peripheral venous blood of a subject was extracted for use.

2. Primer design and PCR reaction

Firstly, specific primers aiming at c.5331+1G > C mutation of LOXHD1 gene are designed by referring to a human genome reference sequence GRCh37/hg19, and the specific sequences are as follows:

an upstream primer: GGTGGAGAGTTGCTGAGAGC (SEQ ID NO:7)

A downstream primer: CTGAAGGAAGCCCACACCAC (SEQ ID NO:8)

Then, preparing a PCR reaction system of each DNA sample according to the following mixture ratio and carrying out PCR reaction:

reaction system (20 μ l):

name of reagent	Single reaction Standard quantity (. mu.L)
		ddH ₂ O	17.30
10×Buffer	2.50
		dNTP(2.5mM)	2.00
Primer-F(10p)	1.00
		Primer-R(10p)	1.00
Taq enzyme (5U/q)	0.20
		Total	24

PCR reaction conditions

Thus, PCR amplification products of the genomic DNA samples of each subject were obtained.

3. Sanger sequencing

And (3) purifying the PCR product obtained in the step (2), directly performing DNA sequencing, and performing sequencing by using an ABI3730XL sequencer.

Based on the sequencing results, fig. 3 shows representative Sanger sequencing validation peak plots for the c.5331+1G > C mutation sites of the LOXHD1 gene of all family members in the patient family shown in fig. 1. As shown in FIG. 3, in the Trio family of autosomal recessive non-syndromic deafness patients of the present invention, both the patients and the normal hearing mothers were heterozygous carriers of the c.5331+1G > C mutation of LOXHD1 gene, and the father of the patients was homozygous wild type, indicating that the mutation of the patients originated from the mothers.

Figure 4 shows a graph of qPCR validation results for copy number variation of the LOXHD1 gene for all family members in the patient family shown in figure 1. The ordinate in FIG. 4 represents the Relative Quantification (RQ) results of qPCR. As shown in fig. 4, the RQ values of the samples corresponding to the father with normal hearing were half of those of the control sample, which indicates that two people carry the copy number variation of the deletion of the LOXHD 1115 exon to the 17 exon region, and the copy number of the sample corresponding to the mother of the patient is normal, which indicates that the copy number variation of the patient is from the father with normal hearing.

Combining the above information, it can be confirmed that the compound heterozygous genotype composed of the LOXHD1 c.5331+1G > C mutation and another copy number variation is the pathogenic cause of the deafness patient II-1 in the recessive non-syndromic deafness family.

Example 3 detection kit

Preparing a detection kit which comprises primers capable of detecting c.5331+1G > C mutation of LOXHD1 gene and is used for screening biological samples susceptible to autosomal recessive nonsynthesized deafness. The corresponding primers are LOXHD1 gene exon-specific primers, and the sequences are shown in SEQ ID NO. 7 and SEQ ID NO. 8 in example 2.

The method for screening the biological sample susceptible to autosomal recessive nonsynthetic deafness by using the kit comprises the following specific steps:

The DNA of the subject was extracted according to the method described in step 2 of example 1, and PCR reaction was carried out using the extracted DNA as a template and exon-specific primers of the LOXHD1 gene as described above (see example 2 for PCR reaction system and reaction conditions, and PCR products were purified according to a method conventional in the art, and the purified products were sequenced.

And then, by observing whether the sequence obtained by sequencing has c.5331+1G > C mutation or not, whether the LOXHD1 gene mutant exists in the DNA of a person to be tested can be effectively detected, so that whether the person to be tested is susceptible to autosomal recessive non-synthetic deafness or not can be effectively detected, and further, a biological sample susceptible to autosomal recessive non-synthetic deafness can be screened from the person to be tested.

Furthermore, the kit can also be used for specific amplification of primer sequences of SEQ ID NO. 3-SEQ ID NO. 6 aiming at the No. 15 exon and No. 17 exon regions of the LOXHD1 gene and screening biological samples susceptible to non-synthetic deafness.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen Hua Dagene GmbH, Huazhong university college of science and technology, affiliated conjunction Hospital

<120> LOXHD1 gene mutant and application thereof

<130> PIDC3192818

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 1400

<212> DNA

<213> Artificial Sequence

<220>

<223> wild type LOXHD1 gene

<400> 1

ttttaagttg atttcacatc catttggtct ccatcacagt tttgtgagat tgcagggcta 60

gtgttattct ccagaccaca ggtaaggaaa ccaagttcta gaaaggaact aggactattc 120

taggtgactg gtagaatgag attagaaccc agcactgata cctcttggtt cggggccatt 180

tctactagcc aaactcactt aacccagtct ttcaggaaca catctgggat gcaagagatg 240

ggctggtgga gagttgctga gagcagaggg gctgctgagt aaaggcctaa tcttctccct 300

caccccaaac ctggcctctg gcctggccca ccccaaccct ccccaatggc cagcttccct 360

tcttcatgcc cctcctctcc acccccaggt ttgagcggga gcagaacgac accttcatca 420

tggagatcct agacattgct ccattcacca agatgcggat ccggattgat ggcctgggca 480

gtcggccgga gtggttcctg gagagggtaa aatgtctaga ccctcactct tccttccagc 540

caccacccac cccttcccct ggttcctctg gcttgtcaat ggaccttgtt aaagcacaaa 600

tgtcactgta gaggatcatt acatgaaccc agcccatatg atccagtatg ccctttggca 660

tgaattaatc agagaatgtc gttttattta tttgtgtcca gtgagaactg aagcaactgt 720

caggtaatta aacaagagct gtcaacgtta cgtggacaga gacctgagaa aggggagggg 780

tggtgtgggc ttccttcagg acagcagctg ggagggttga gagaggagga gcaaggcctg 840

gggcagagag aggctgccat ggtgggaact tcaggcagga tggcagaaag cttactgggg 900

cctctgtgat cacggagtta ggcagctgct tctttttcca ttgtgggcct ctgagtctga 960

gcttggccgt cagcaccctg cctgaggaac ctggatcctt aagctctcag ttgggctgaa 1020

gccagccttg gggatgggat gctgggatct tcaaggagca acagcagcgt gggatttctt 1080

agttctgcct ccatcctccc gcttttccca gcatacatat gcatgggcac atatgcacac 1140

acatacatgc acatggccac agactcagtt tccaccaaga aaggaaggca gctgctcctt 1200

ctcaggacct ctcatcactt cctcaccttc cccagctgtg cggctctgtg ccttcaggct 1260

gcccagagga gagtcattaa cacttgctgc tccagggcag agagaagagc gtccacggca 1320

tagggccaag ctgcactcat tttgatgaga accactgtga tgttaggagt ccaagggctt 1380

tccatgctaa gagtggctcc 1400

<210> 2

<211> 6300

<212> DNA

<213> Artificial Sequence

<220>

<223> wild type LOXHD1 gene

<400> 2

ggtctccttc ccaagaccat gtgacatcat cctacccatt ccccaaggag ttccctgccc 60

tccttccaat ctcagccaaa caccactgcc tccgggaagt cctcctttcc cactccaggc 120

taggatgttt tgctagatgc tcccatagaa tcatttcact ttgctaaagt caaagctctg 180

ggcctccata gtgactctgc atgaatgggt gaagctttga ttgtctgcct gctccaccca 240

aagagctaac attcccccat ttgcccacca ggtggttgga caaggataag gatgatgggc 300

agctggtccg agagttgcta cccagtgaca gcagcgcgac actgaagagt gagttgtcct 360

gatgaccagg tgctgggtgt gcccttggtg agacaggggc cttccctcag ctaagccctt 420

caagaaaaca cgagcacttc atgtttcaca gaggtggcag tggggaggga ggagagggag 480

gctccgaggg agtgtctgga gagttcctgc ctgtgctcct gcacacagtc tctttgtggc 540

ctcaggtgtg aggccctgaa tgcatatggg tcaacgagag tgatgagcag taatgctggc 600

caatggtgcc aagcattggc agtacctgtc attcaggcct taagaagaga aatattttga 660

agggactgta aaatagggac tttaaaaatg ccaagtatca tcttggaggc cttagagttt 720

tccttactgg tgacatttct tccattgctt tggtttgatc atgagcttta gacaaaatta 780

aaagaaactt atctctagaa tccttgacat taccaacacc tcatgtttgt catttattat 840

ctcatttgag ctctgcaata atcccagaag atggtcaggg ttgatgttgt ccatgggtca 900

gatggagaaa cttagaaccg gaagagctga agatattttt atttttgttt atttgtttat 960

ttttgaaaca gggtcttact ctgtcaacga ggctggagtg cagtggtgtg attttggctc 1020

attgcagcct cagcctccta ggctcaggtg atcctcctgt ctcagcctcc tgagtagcta 1080

gggcaatagg tgtacatcac cacacctggc taatttttat attttttttc tacagatggg 1140

gtctctttat gttgtccagg ctggtctcaa actcctgggt tcaaatgatc cacccacctt 1200

ggccacccaa agtgctggga ttagaggcat gagccacggc acccggcagc taaagatatt 1260

tgtatctgac ctcttctaag gtcagactgc tgactttgaa ctagagtgtc ccatttctgg 1320

tctcagaatt acagaattta agatctggga aggatcccag gagataagat gcctgtggca 1380

aaaggacccc tattccccct ccacaacccc agcaaaccca gttgtgtagt cagtgatggg 1440

gctgggacca gtacccaggg tatctctgtc tatgtcactg tccttcccag tccagcaagc 1500

ccctatttca ccatgtggac aggacctcct gaccccctgc ttcctcagtc agagcgtctg 1560

aaagcgttta gatcaagctt gtccaaccca cagcccgcac gcatgtggcc cacgacggct 1620

ttgaatgtgg cccaacacaa atttgtaaac tttcttaaaa cataaaactt ttttgcaatt 1680

tttttaactc atcagctatc atttgtatta gtgtattttt tgtgtggccc aagacaattc 1740

ttcttcttcc agtgtggccc agggaaacca aaagattgaa cacccctggt tgagatggaa 1800

aatagtacaa gaaagaggtc tccttcccag tctctgctgc tacatctttc agcaagaata 1860

gaggccattt cctcaagtgc ccttgggtgg cactaatgga gctgatctgg agcagacctg 1920

caggtctggc cttctccagg gctggtccct aggcaaggtg tgctcagctg actttctcca 1980

aatccttctg cctagtggga ggaccctacg gtgtcagtga gtggcaggcc tgggagtgag 2040

catcactcac ctttccagtg cttcctcctc tttgcccaag acacacaccc aggaacaagc 2100

ctggaggact tggggtcttg ccttgtatta ttccaggact caccttttcc tcgggtgttt 2160

ttgtccctga agaccgataa tgcagacatt cctggctgat aaaatggagt gacaccctcg 2220

tggtggccca gtgaagagca gggggtttca agtccacatg agagtttcac tcctggcgac 2280

ctcttaactg ttgccatctt gcaccaaaca catgacattc tgaggctcag attccttgcc 2340

tgtgaaactg gggtcagaat ccttagcaat aataccatgt gtataatgct ctagacactg 2400

tctggaaagg ttgatccttc ctttgtctca gtttccttgt ccactgtcag agaagctaga 2460

ccagatgatt gtgggaaatc ctttcaggct cttatgtttt gatgttcttg cttgtgattt 2520

acacgctttc ctgctctaag cccattcaca ccttctggag cagacagaga acctactaga 2580

attctgccat tacagttgag gagacctcac agagatggaa ggaacccctg ccccaagttg 2640

cagggctgct tagaacagga gcctggattt tcaattccca gcgtgtgttc cccacaaacc 2700

tccagctcca ggctgccctc ctatacacgc accctgcttc ctgtcacccc ctgcactaac 2760

cccttccctt cctccctctg ccttgggctg ttcagacttt cgctatcaca tcagcttgaa 2820

gactggggat gtctctgggg ccagcacgga ttctagagtc tacatcaagc tctatgggga 2880

taaatctgac accatcaagc aagttcttct tgtctctgac aacaacctca aagactactt 2940

tgaacgtggc cgggtggatg agttcaccct cgagaccctg aacattggaa atgtaagtct 3000

ccttcccaag accatgtgac atcatcccac ccatttccga acacacattc acacgtgtcc 3060

acacacacat atgtccacac acagacacac acgcacacac tcatgtacat aagggtaaac 3120

acattttgaa gagaaaaagc acacttggga atagtgagtg aggtgtgtag ttttttagct 3180

gtgacctaga gcagctgaag atatgtaaac agtagtgatg cttccagagc ctctttgggg 3240

ctggaatgtg tatttttagt ggcattgcct caacatttta tttacctaca tatccaagac 3300

caatgtacct gggtcacaga cactggagaa ggagactgaa cgcagggaag gaaaagagaa 3360

gggaggacta agaaaagggg ctaaaaatac ttcccaattt caaacttgag tgtgcatcag 3420

aattggggcc aggaagcttg tttcagtgca cacttctggg ccacacctga gagattctgt 3480

cttgggagat ggaacccaag agcctccaga tcaaggctcc aggtgactct gctgcaagtg 3540

gtctaagcac ttcatcaaag agaaagctga acagtaaagc agcaaagaca gactttaatc 3600

agtaatctac cactgccatc aggaaaagag gccagtgtga actgaaccca acttaggttt 3660

gtgcagaggt ttgcaaacct ctttaaaggg aggatgaggg aataagggga gggtaatcaa 3720

gggctcagta gagtcagggg gaaaacatga aaagcagtaa tggggaggtc agcacatgtg 3780

ggttgtggaa cccatctggg tttgctaact gatgctttat ggcatgaggg tcttatcctt 3840

caagagtctg gcagacagaa gccctaccct caggtgttgg ctggaaccaa cagtaaatta 3900

ttttgacagc cttgagtttt ctaaggcaag cacagtaagg gggattaggg tcactctagg 3960

gatgtggcct tgagctgtta gaaactgtgt tagtgttttg ttcaagtctt tataggccaa 4020

gattgaggct gagaaagggt tcaggagcct ggctagagtt tggccaaggt gagaatcttc 4080

cttgacatca cctggagaaa cacagttcta aatcttggac ttgaggattg gggatgtctc 4140

tagaaatgcc tgagctggga tttttgttac tacctgctgc tcccagggtg tggcttggtg 4200

gaaatggaga tggtaacaag ccctctacct ggaacctcat ctttcctgcc ccttccctct 4260

ctgggagtcc caccctattt caggtcctag gaatctcttc tcccatcaaa actcactcca 4320

gggaaagatc tcatgttagt catttatacc ttgaggttaa tgaacttaaa tcaatgtttt 4380

catttatcaa gatgtattta cattttaagc tgaatcaata attgcagagt gaaaatgctg 4440

ttccctttac taaaggattt tgggcagcag ctggcgggta agttagacct ctaggaagag 4500

tagggtggca gtgggagggc atttaagctt cttcctgagt ttccgaaacc ccctcaacaa 4560

gcagcatggc caagaggctg ggagcatggg ctctggctgc caaccgcata tttgagaccc 4620

atttccactt acctgccata tgtaagttat ttaacctctg tttgcctccg ttttctcatt 4680

cataacaaca tgagatacta atggggttgc tattagtatt aaatatgtga ataacaccca 4740

catgctcata ctaagtgctg agtaaatgct actgaacaat tagtctatgt caggtgtgaa 4800

gtgttgtaga actgagctag tgtctgccct tagggagcat ccagtcatat cagacactta 4860

cctctgtctt taccctttca gccaatccct ccctgggact ttcatagtcc tggcaccaca 4920

gaagaacaac aaaactcttc cctgtccctt gacatgcaca cagagggctc tcaggctttg 4980

taagcttagc tggttttctt ctgataattc caggggactg ggctgcatgc acttagctct 5040

gacgttgttg ccattaccag ctgcaaagag gcacttagga ctcagaagag caagagcagg 5100

ctcgcatgga cagttttcta aatctggcct tttggcacca gactcatggc taacatcacc 5160

tcttcaaacc attgcagaga gaatctcagg gctggaaggg ttctcaaagg ccatctgata 5220

attccatctg atgttaaaat tgctctgtat acagcatttc aaaaagaaaa aacataaaag 5280

caatccaaac attgaaaaac caagtacata taaggatggt gatatgatca tctgcactcc 5340

cctctatgtt gcccatgggg gcaaagatgt taaaatgcaa aatcgcaaag caattataga 5400

gtgttattgg aaaaagaaaa gtgttccttg ggtccaagag tgagcagagg aattggacac 5460

agaaccgcag agtcctgaga ggttgcctgc atagtctgtc accttcagga tgggtgatat 5520

tctgtcacct tcaggatggg tatgttgaag aaatgcagaa atatatacaa ctgtgtattg 5580

ttcaaaacca aaccaaatca ataacacagt tattggaagg tgatggcaaa cattttaaac 5640

atttgctttc tcacatggcc atgacctaac atgattaagt actagtggag ctttcaaatt 5700

ttgtgtcacc tccactcccc tcttgtttct cactatggcc ctgggaggtg tgctgggctt 5760

aggagaaggg aatggtggct acaggcaggt gaggtgatgc cctggtgccc cagctggctg 5820

atggtggggc aggaatggga ttccagcttt cccatggatc ttccctctcc tggggactgg 5880

agacctgggt tgtgttttgt gctggtgttt ggggaggtag ggatgggatc atggaggttt 5940

ctacacactg gctccttgct caccctcact cgggtttcct tcagatcaac cggctggtga 6000

ttgggcatga cagcactggc atgcatgcca gctggttcct gggcagcgtt cagatccgtg 6060

tgccccgtca aggcaagcag tacacctttc ccgccaaccg ctggctggac aagaaccagg 6120

ctgacgggcg cctggaggtg gagctgtatc ccagcgaggt ggtggagatc cagaaatgta 6180

tggaggaggc tgtggtggga ccacccattg tttcccatgg gggatggggc tgaggggaag 6240

gaggagggac catggggcaa agcaggtctt gctgacaagt gctgctggta gggtcctgca 6300

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> No. 15 exon upstream primer

<400> 3

tgattgtctg cctgctccac 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> No. 15 exon downstream primer

<400> 4

gctgtcactg ggtagcaact 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> exon 17 upstream primer

<400> 5

gtgattgggc atgacagcac 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> No. 17 exon downstream primer

<400> 6

gttggcggga aaggtgtact 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> upstream primer

<400> 7

ggtggagagt tgctgagagc 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> downstream primer

<400> 8

ctgaaggaag cccacaccac 20

Claims

1. An application of a reagent for detecting LOXHD1 gene mutation in preparing an auxiliary diagnostic kit for autosomal recessive non-syndromic deafness, wherein the accession number of a wild type LOXHD1 gene in an NCBI database is NG _016646.2, and the LOXHD1 gene mutation is c.5331+1G > C mutation and c.1973_2437+2del mutation.

2. Use according to claim 1, wherein said reagents comprise probes and/or primers specific for the detection of said gene mutation.

3. The use of claim 1, wherein said reagents comprise specific primers for detecting the c.5331+1G > C mutation of the LOXHD1 gene, the sequences of said specific primers being as follows:

an upstream primer: GGTGGAGAGTTGCTGAGAGC the flow of the air in the air conditioner,

a downstream primer: CTGAAGGAAGCCCACACCAC are provided.