CN109943569B - Isolated nucleic acid encoding IFNLR1 mutant and application thereof - Google Patents

Abstract

The invention relates to a gene mutant and application thereof. In particular, the invention relates to application of a reagent for detecting mutation sites in preparation of a biological sample for screening non-syndrome type autosomal dominant hereditary hearing loss, an isolated IFNLR1 mutant nucleic acid, an isolated polypeptide, a system for screening the biological sample for non-syndrome type autosomal dominant hereditary hearing loss, a kit for screening the biological sample for non-syndrome type autosomal dominant hereditary hearing loss, a construct and a recombinant cell. Wherein the isolated IFNLR1 mutant encoding nucleic acid has a c.296G > A mutation compared to the wild type IFNLR1 gene. By detecting whether the new mutant exists in a biological sample, whether the biological sample is susceptible to the ADNSHL disease can be effectively detected.

Description

Isolated nucleic acid encoding IFNLR1 mutant and uses thereof

Technical Field

The invention relates to a gene mutant and application thereof. In particular, the invention relates to an isolated nucleic acid encoding an IFNLR1 mutant and application thereof, and more particularly relates to an isolated nucleic acid encoding an IFNLR1 mutant, an isolated polypeptide, a system for screening a biological sample susceptible to non-syndrome autosomal dominant hereditary hearing loss, a kit for screening a biological sample susceptible to non-syndrome autosomal dominant hereditary hearing loss, a construct, a recombinant cell and a method for constructing a drug screening model.

Background

Non-syndromic deafness is one of hereditary deafness, and means that deafness is the only symptom of an individual with disease, has no other genetically impaired sexual organ dysfunction, and accounts for about 70% of hereditary deafness. According to the different genetic methods, it is generally classified into autosomal Dominant (DFNA), autosomal recessive (DFNB), sex-linked (sex-linked) and mitochondrial inherited (mitogenic inherited) deafness.

As with other hereditary diseases, autosomal dominant deafness (ADNSHL), which is a non-syndromic type, is a familial disease. In clinical phenotype, the patients are usually delayed to develop the disease, but the onset ages of the patients are different, the onset ages of the patients are mostly concentrated in a certain age stage in the same family, the deafness degree is gradually increased, and finally the deafness is severe or extremely severe sensorineural deafness, even total deafness. Because deafness occurs only in the late stage of learning speech, the speech function of a patient can be normally formed, but as the hearing function is reduced, partial speech function can be lost. The hearing loss characteristics are also not nearly identical, with most ADNSHL patients presenting with an initial high frequency hearing loss first and a few with their own specific phenotype. Since phenotypes and genotypes are heterogeneous to some extent, characteristic phenotypes tend to help us make reasonable predictions to predict a patient's genotype.

At present, 36 genes are reported to be related to ADNSHL, but a considerable part of unknown pathogenic gene sites still exist. Thus, early diagnosis of ADNSHL is under investigation.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. To this end, it is an object of the present invention to propose a method capable of efficiently screening a biological sample for non-syndromic autosomal dominant hereditary hearing loss (ADNSHL).

It should be noted that the invention determines new mutation of non-syndromic autosomal dominant deafness gene by means of exon sequencing combined with candidate gene mutation verification, and is specifically completed based on the following work of the inventor:

the genetic deaf family of Chinese Han people with continuous 3 generations of diseases is collected, 6 samples in the family are selected, and variation data of the samples are obtained through a whole exon sequencing technology. Meanwhile, the genetic markers are used for carrying out linkage localization and haplotype analysis on 15 samples in the family, and the pathogenic gene of the family is localized in the chr1: p34.1-1p36.12 interval. Combining the results of sequencing and linkage analysis of the whole exon, a heterozygous missense mutation on the gene IFNLR1 is found in the positioning region: c.296G > A (p.Arg99His). Then, IFNLR1c.296G > A (p.Arg99His) shows a phenomenon of phenotype-genotype cosegregation in all members of the family studied by a PCR-Sanger sequencing method, which indicates that the variation is probably pathogenic variation of the study.

Since IFNLR1 expresses Interferon lambda receptor 1 (Interferon lambda receptor 1), it is involved in recognition of cytokines and interferons in the extracellular environment, intracellular signaling, and the like. In rodents, IFNLR1 is widely expressed in the inner ear helices (organ of Corti), the cochlear nerve, the spiral ganglion and the vestibular epithelium of the inner ear. Therefore, the inventor discovers that IFNLR1 plays an important role in normal development and function of hair cells and swim bladder through research on zebra fish with the IFNLR1 gene knocked out. Thus, the IFNLR1 gene may be associated with the auditory nervous system, and mutations in this gene are associated with the development of ADNSHL. The whole exon sequencing technology is proved to be a powerful and effective means for reducing rare single-gene disease candidate genes and even finding pathogenic genes thereof, and the success rate of screening disease-related variation is greatly improved only by sequencing whole exons of a few individuals (including patients and normal controls).

Thus, according to a first aspect of the invention, there is provided an isolated nucleic acid encoding an IFNLR1 mutant. According to an embodiment of the invention, the nucleic acid has at least a c.296G > A mutation compared to the wild-type IFNLR1 gene. The inventor surprisingly finds that the mutant is closely related to the onset of the ADNSHL, so that whether the biological sample is susceptible to the ADNSHL can be effectively detected by detecting whether the mutant exists in the biological sample.

According to a second aspect of the invention, there is also provided an isolated polypeptide. According to an embodiment of the invention, the isolated polypeptide has at least a p.arg99his mutation. In the present invention, mutations are expressed using methods commonly used in the art. Arg99his indicates that amino acid Arg at position 99 of the protein level is changed to His. By detecting whether the polypeptide is expressed in the biological sample, whether the biological sample is susceptible to the ADNSHL disease can be effectively detected.

According to a third aspect of the invention, the invention provides a use of a reagent for detecting a mutation site in preparation of a biological sample for screening autosomal dominant deafness susceptible to non-syndromic syndrome. According to an embodiment of the invention, the mutation site comprises the c.296G > A mutation in the IFNLR1 gene. In the present invention, mutations are expressed using methods commonly used in the art. The c.296G > A mutation indicates that the 296 th nucleotide of cDNA is changed from G to A. The inventor surprisingly discovers that the 296 th nucleotide of the cDNA is changed into A from G, the mutation site is closely related to the occurrence of ADNSHL, so that whether a biological sample is susceptible to ADNSHL can be effectively detected by detecting whether the mutation site exists in the biological sample, according to the embodiment of the invention, the nucleic acid of the mutant further enriches the pathogenic mutation map of the IFNLR1 gene, further deeply explains the molecular pathogenesis of ADNSHL deafness, and provides scientific basis for early pathogenic gene screening and intervention treatment of ADNSHL.

According to the specific embodiment of the invention, the application of the reagent for detecting the mutation site in the preparation of the biological sample for screening the autosomal dominant deafness susceptible to non-syndromic syndrome further comprises the following additional technical characteristics:

according to some embodiments of the invention, the mutation site comprises a p.arg99his mutation in the polypeptide encoded by the IFNLR1 gene.

According to some embodiments of the invention, the agent comprises a nucleic acid probe or primer.

According to some embodiments of the invention, the nucleic acid probe or primer has the sequence of SEQ ID NO:3 and SEQ ID NO: 4.

According to some embodiments of the invention, the agent comprises an isolated nucleic acid encoding an IFNLR1 mutant, which has at least a c.296g > a mutation compared to the wild-type IFNLR1 gene.

According to some embodiments of the invention, the nucleic acid is DNA.

According to some embodiments of the invention, the agent comprises an isolated polypeptide having at least a p.arg99his mutation.

According to some embodiments of the invention, the polypeptide is encoded by an isolated nucleic acid encoding an IFNLR1 mutant.

According to a fourth aspect of the invention, the invention also provides the use of the reagent for detecting the mutation site in the preparation of a system for screening a biological sample susceptible to non-syndromic autosomal dominant deafness. According to an embodiment of the invention, the mutation site comprises the c.296G > A mutation in the IFNLR1 gene, and the system comprises: a nucleic acid sequence determining device connected with the nucleic acid extracting device and used for analyzing the nucleic acid sample so as to determine the nucleic acid sequence of the nucleic acid sample; a judging means connected to said nucleic acid sequence determining means so as to have a c.296G > A mutation compared to the wild-type IFNLR1 gene based on the nucleic acid sequence of said nucleic acid sample or a complementary sequence thereof. The inventor surprisingly found that the system can be used for detecting the ADNSHL disease at the gene level, and is helpful for more accurately screening biological samples susceptible to the ADNSHL disease.

According to a fifth aspect of the present invention, there is also provided a kit for screening a biological sample susceptible to non-syndromic autosomal dominant deafness. According to an embodiment of the invention, the kit comprises: a reagent suitable for detecting an IFNLR1 gene mutant, wherein said IFNLR1 gene mutant has a c.296G > A mutation compared to the wild type IFNLR1 gene. Therefore, the kit can be used for detecting the IFNLR1 gene mutant with high precision, so that the gene level detection of the ADNSHL disease is carried out, and the kit is favorable for more accurately screening biological samples susceptible to the ADNSHL disease.

According to a sixth aspect of the invention, the invention also provides a construct. According to an embodiment of the invention, the construct comprises the aforementioned isolated nucleic acid encoding an IFNLR1 mutant. Therefore, the recombinant cell obtained by transforming the receptor cell with the construct of the invention can be effectively used for screening the medicine for treating ADNSHL.

According to a seventh aspect of the present invention, there is also provided a recombinant cell. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the expression of the aforementioned construct. According to some embodiments of the invention, the recombinant cells of the invention can be used to effectively screen drugs for treating ADNSHL.

The beneficial effects obtained by the invention are as follows: the invention discovers that the c.296G > A mutation on the IFNLR1 gene can be related to nonsynthesized autosomal dominant deafness (ADNSHL) by a whole exome sequencing, linkage positioning and bioinformation analysis method, confirms the pathogenic variation on the IFNLR1 gene by a family endophenotype-genotype coseparation experiment and the genetic verification of a large-sample-amount normal population, and discovers the association between the IFNLR1 gene and an auditory system by a mouse model and a zebra fish model. The discovery widens the clinical diagnosis and detection/screening range of hereditary hearing loss, lays an important foundation for the research of the pathogenesis of ADNSHL, and possibly provides a brand-new theoretical basis for the treatment of the ADNSHL patient, thereby providing more support and reference for the clinical diagnosis of the ADNSHL patient. In addition, the cloning of the new ADNSHL pathogenic gene, the combination of genetic or epigenetic modification factors to regulate gene expression and the construction of a corresponding animal model can provide important clues for revealing the pathogenesis of the ADNSHL, and further clarify the pathological mechanism of human auditory system abnormality.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1: a schematic diagram of a system and its components for screening a biological sample susceptible to ADNSHL disease according to one embodiment of the present invention is shown, wherein:

a is a schematic representation of a system for screening a biological sample susceptible to ADNSHL disorders according to an embodiment of the present invention,

b is a schematic view of a nucleic acid extraction apparatus according to an embodiment of the present invention,

and C is a schematic diagram of a nucleic acid sequence determination apparatus according to an embodiment of the present invention.

FIG. 2 is a schematic diagram: a family map containing 3 families of patients with ADNSHL disease is shown, according to one embodiment of the present invention.

FIG. 3 shows a comparative analysis chart of IFNLR1 gene homology according to an embodiment of the present invention.

Figure 4 shows a Sanger validated peak plot according to one embodiment of the present invention.

Fig. 5 shows a pure tone audiogram of an ADNSHL patient according to an embodiment of the present invention.

Detailed Description

The following describes embodiments of the present invention in detail. The following described embodiments are exemplary, are intended to be illustrative of the present invention, and are not to be construed as limiting the invention.

IFNLR1 mutant

According to one aspect of the invention, the invention provides an isolated nucleic acid encoding an IFNLR1 mutant. According to an embodiment of the invention, the nucleic acid has at least a c.296G > A mutation compared to the wild-type IFNLR1 gene.

It is to be noted that the isolated nucleic acid of the invention encodes an IFNLR1 mutant, which may also be referred to as "IFNLR 1 mutant-encoding nucleic acid", i.e. the nucleic acid may be understood as the nucleic acid substance corresponding to the gene encoding the IFNLR1 mutant, i.e. the type of nucleic acid is not particularly limited and may be any polymer comprising deoxyribonucleotides and/or ribonucleotides corresponding to the gene encoding IFNLR1, including but not limited to DNA, RNA or cDNA. According to a particular embodiment of the invention, the nucleic acid encoding the IFNLR1 mutant is DNA. According to the embodiment of the invention, the inventor determines new mutants of IFNLR1 gene, the mutants are closely related to the occurrence of ADNSHL disease, so that whether a biological sample is susceptible to the ADNSHL disease can be effectively detected by detecting whether the mutants exist in the biological sample, and whether the organism is susceptible to the ADNSHL disease can be effectively predicted by detecting whether the mutants exist in the organism.

For the purposes of the present description and claims, reference to a nucleic acid is understood by those skilled in the art to include virtually any one, or both, of the complementary double strands. For convenience, in the specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to SEQ ID NO 1 actually includes the complement thereof. It will also be appreciated by those skilled in the art that one strand may be used to detect the other strand and vice versa.

These nucleic acids encoding IFNLR1 gene mutants are novel mutations in the causative gene of ADNSHL disease determined by the inventors of the present application by high-throughput exome sequencing combined with candidate gene mutation verification, and reports on the association of the causative mutations with ADNSHL disease are not found in the prior art.

Compared with the wild IFNLR1 gene, the IFNLR1 gene mutant discovered by the inventor has c.296G > A mutation, namely, the 296 th base G is mutated into A.

The website of the IFNLR1 gene nucleic acid sequence is as follows:http://grch37.ensembl.org/Homo_ sapiens/Transcript/Summarydb＝core；g＝ENSG00000185436；r＝1:24483620- 24513738；t＝ENST00000374421，

the IFNLR1 gene has 7 exons, and the mutation c.296G > A is positioned on the third exon, so that the 99 th arginine of the third exon is mutated into histidine.

The corresponding wild IFNLR1 gene has the nucleic acid sequence of SEQ ID NO 1:

ATGGCGGGGCCCGAGCGCTGGGGCCCCCTGCTCCTGTGCCTGCTGCAGGCCGCTCCAGGGAGGCCCCGTCTGGCCCCTCCCCAGAATGTGACGCTGCTCTCCCAGAACTTCAGCGTGTACCTGACATGGCTCCCAGGGCTTGGCAACCCCCAGGATGTGACCTATTTTGTGGCCTATCAGAGCTCTCCCACCCGTAGACGGTGGCGCGAAGTGGAAGAGTGTGCGGGAACCAAGGAGCTGCTATGTTCTATGATGTGCCTGAAGAAACAGGACCTGTACAACAAGTTCAAGGGACGCGTGCGGACGGTTTCTCCCAGCTCCAAGTCCCCCTGGGTGGAGTCCGAATACCTGGATTACCTTTTTGAAGTGGAGCCGGCCCCACCTGTCCTGGTGCTCACCCAGACGGAGGAGATCCTGAGTGCCAATGCCACGTACCAGCTGCCCCCCTGCATGCCCCCACTGGATCTGAAGTATGAGGTGGCATTCTGGAAGGAGGGGGCCGGAAACAAGACCCTATTTCCAGTCACTCCCCATGGCCAGCCAGTCCAGATCACTCTCCAGCCAGCTGCCAGCGAACACCACTGCCTCAGTGCCAGAACCATCTACACGTTCAGTGTCCCGAAATACAGCAAGTTCTCTAAGCCCACCTGCTTCTTGCTGGAGGTCCCAGAAGCCAACTGGGCTTTCCTGGTGCTGCCATCGCTTCTGATACTGCTGTTAGTAATTGCCGCAGGGGGTGTGATCTGGAAGACCCTCATGGGGAACCCCTGGTTTCAGCGGGCAAAGATGCCACGGGCCCTGGAACTGACCAGAGGGGTCAGGCCGACGCCTCGAGTCAGGGCCCCAGCCACCCAACAGACAAGATGGAAGAAGGACCTTGCAGAGGACGAAGAGGAGGAGGATGAGGAGGACACAGAAGATGGCGTCAGCTTCCAGCCCTACATTGAACCACCTTCTTTCCTGGGGCAAGAGCACCAGGCTCCAGGGCACTCGGAGGCTGGTGGGGTGGACTCAGGGAGGCCCAGGGCTCCTCTGGTCCCAAGCGAAGGCTCCTCTGCTTGGGATTCTTCAGACAGAAGCTGGGCCAGCACTGTGGACTCCTCCTGGGACAGGGCTGGGTCCTCTGGCTATTTGGCTGAGAAGGGGCCAGGCCAAGGGCCGGGTGGGGATGGGCACCAAGAATCTCTCCCACCACCTGAATTCTCCAAGGACTCGGGTTTCCTGGAAGAGCTCCCAGAAGATAACCTCTCCTCCTGGGCCACCTGGGGCACCTTACCACCGGAGCCGAATCTGGTCCCTGGGGGACCCCCAGTTTCTCTTCAGACACTGACCTTCTGCTGGGAAAGCAGCCCTGAGGAGGAAGAGGAGGCGAGGGAATCAGAAATTGAGGACAGCGATGCGGGCAGCTGGGGGGCTGAGAGCACCCAGAGGACCGAGGACAGGGGCCGGACATTGGGGCATTACATGGCCAGGTGA

the corresponding encoded wild-type polypeptide is SEQ ID NO 2, SEQ ID NO:

MAGPERWGPLLLCLLQAAPGRPRLAPPQNVTLLSQNFSVYLTWLPGLGNPQDVTYFVAYQSSPTRRRWREVEECAGTKELLCSMMCLKKQDLYNKFKGRVRTVSPSSKSPWVESEYLDYLFEVEPAPPVLVLTQTEEILSANATYQLPPCMPPLDLKYEVAFWKEGAGNKTLFPVTPHGQPVQITLQPAASEHHCLSARTIYTFSVPKYSKFSKPTCFLLEVPEANWAFLVLPSLLILLLVIAAGGVIWKTLMGNPWFQRAKMPRALELTRGVRPTPRVRAPATQQTRWKKDLAEDEEEEDEEDTEDGVSFQPYIEPPSFLGQEHQAPGHSEAGGVDSGRPRAPLVPSEGSSAWDSSDRSWASTVDSSWDRAGSSGYLAEKGPGQGPGGDGHQESLPPPEFSKDSGFLEELPEDNLSSWATWGTLPPEPNLVPGGPPVSLQTLTFCWESSPEEEEEARESEIEDSDAGSWGAESTQRTEDRGRTLGHYMAR

application of reagent for detecting mutation sites in preparation of biological samples for screening autosomal dominant deafness susceptible to non-syndromic syndrome

According to another aspect of the invention, the invention provides a use of a reagent for detecting a mutation site in the preparation of a biological sample for screening autosomal dominant deafness susceptible to non-syndromic type, wherein the mutation site comprises c.296G > A mutation on IFNLR1 gene. The inventor finds that the c.296G > A mutation site on the IFNLR1 gene is closely related to the incidence of the ADNSHL disease, so that whether a biological sample is susceptible to the ADNSHL disease or not can be effectively detected by detecting whether the mutation site exists in the biological sample, and whether the organism is susceptible to the ADNSHL disease or not can be effectively predicted by detecting whether the mutants exist in the organism or not.

According to some embodiments of the invention, the mutation site comprises a p.arg99his mutation in the polypeptide encoded by the IFNLR1 gene.

According to some embodiments of the invention, the agent comprises a nucleic acid probe or primer having the sequence of SEQ ID NO:3 and SEQ ID NO: 4.

According to some embodiments of the invention, the agent comprises an isolated nucleic acid encoding an IFNLR1 mutant, which nucleic acid has at least a c.296g > a mutation as compared to the wild-type IFNLR1 gene. Wherein in a preferred embodiment, the nucleic acid is DNA.

According to some embodiments of the invention, the agent comprises an isolated polypeptide having at least a p.arg99his mutation; wherein in a preferred embodiment of the invention said polypeptide is encoded by an isolated nucleic acid encoding an IFNLR1 mutant.

System and kit for screening biological samples susceptible to non-syndromic autosomal dominant hereditary hearing loss

According to another aspect of the present invention, there is provided a system capable of efficiently carrying out the above method for screening a biological sample susceptible to ADNSHL disorders.

Referring to fig. 1, the system 1000 for screening a biological sample susceptible to ADNSHL disease according to an embodiment of the present invention includes: a nucleic acid extraction apparatus 100, a nucleic acid sequence determination apparatus 200, and a determination apparatus 300.

According to an embodiment of the present invention, the nucleic acid extraction apparatus 100 is used to extract a nucleic acid sample from a biological sample. As described above, according to the embodiment of the present invention, the type of the nucleic acid specimen is not particularly limited, and in the case of using RNA as the nucleic acid specimen, the nucleic acid extraction apparatus further comprises an RNA extraction unit 101 and a reverse transcription unit 102, wherein the extraction unit 101 is used for extracting the RNA specimen from the biological sample, and the reverse transcription unit 102 is connected to the RNA extraction unit 101 for performing a reverse transcription reaction on the RNA specimen to obtain a cDNA specimen, and the obtained cDNA specimen constitutes the nucleic acid specimen.

According to an embodiment of the present invention, the nucleic acid sequence determining apparatus 200 is connected to the nucleic acid extracting apparatus 100 for analyzing the nucleic acid sample to determine the nucleic acid sequence of the nucleic acid sample. As indicated above, sequencing methods can be used to determine the nucleic acid sequence of a nucleic acid sample. Thus, according to one embodiment of the present invention, the nucleic acid sequence determination apparatus 200 may further include: a library construction unit 201 and a sequencing unit 202. The library construction unit 201 is used for constructing a nucleic acid sequencing library aiming at a nucleic acid sample; the sequencing unit 202 is connected to the library construction unit 201 and is configured to sequence the nucleic acid sequencing library to obtain a sequencing result consisting of a plurality of sequencing data. As mentioned above, IFNLR1 gene exon can be enriched by PCR amplification, and the efficiency of screening biological samples of non-syndromic autosomal dominant deafness can be further improved. Thus, the library construction unit 201 may further comprise a PCR amplification module (not shown in the figure) in which at least one primer selected from IFNLR1 gene exon-specific primers is disposed, so as to perform PCR amplification on the nucleic acid sample using at least one primer selected from IFNLR1 gene exon-specific primers. According to the embodiment of the present invention, the sequence of the IFNLR1 gene exon specific primer is not particularly limited, and can be obtained by reference to the human genome sequence database GRCh37.1/hg19 and online design using Primer3.0, for example. According to a preferred embodiment of the invention, the primer specific to the exon of the IFNLR1 gene has the nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO: 4. According to an embodiment of the invention, the sequencing unit 202 may comprise at least one selected from the group consisting of hipseq 2000, SOLiD, 454 and a single molecule sequencing device. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data are improved.

According to an embodiment of the present invention, the determining means 300 is connected to the nucleic acid sequence determining means 200 and is adapted to compare the nucleic acid sequences of the nucleic acid samples so as to determine whether the biological sample is susceptible to the ADNSHL disease based on the difference between the nucleic acid sequences of the nucleic acid samples and the corresponding wild-type gene sequences. Specifically, the c.296G > A mutation is contained in the nucleic acid sequence of the nucleic acid sample or the complementary sequence thereof compared with the wild-type IFNLR1 gene, and the biological sample is judged to be susceptible to the ADNSHL disease. As described above, the apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to the embodiments of the present invention is not particularly limited, and may be operated using any conventional software, for example, according to the embodiments of the present invention, alignment may be performed using SOAPALIGNER/SOAP 2.

Thus, the method for screening a biological sample for ADNSHL disease can be effectively performed by using the system, and a biological sample susceptible to ADNSHL disease can be effectively screened.

According to a further aspect of the invention, the invention provides a kit for screening a biological sample susceptible to ADNSHL disease. According to an embodiment of the present invention, the kit for screening a biological sample susceptible to an ADNSHL disorder comprises: a reagent suitable for detecting an IFNLR1 gene mutant, wherein the IFNLR1 gene mutant has a c.296G > A mutation compared to the wild type IFNLR1 gene. With the kit according to an embodiment of the present invention, a biological sample susceptible to ADNSHL disease can be effectively screened. In this context, the term "reagent suitable for detecting a mutant of the IFNLR1 gene" is to be understood in a broad sense, i.e.both a reagent for detecting a gene coding for a mutant of IFNLR1 and a reagent for detecting at least one of the mutants of the IFNLR1 protein, for example an antibody recognizing a specific site may be used. According to one embodiment of the invention, the reagent is a nucleic acid probe. Thus, a biological sample susceptible to ADNSHL disease can be efficiently screened.

Construct and recombinant cell

According to yet another aspect of the invention, the invention also provides a construct. According to an embodiment of the invention, the construct comprises the isolated nucleic acid as described above. It is to be noted that the phrase "the construct comprises the isolated nucleic acid as described above" means that the construct of the present invention comprises a nucleic acid sequence of an IFNLR1 gene mutant having a c.296G > A mutation as compared with the wild-type IFNLR1 gene. Thus, the recombinant cells obtained by transforming the receptor cells with the constructs of the present invention can be effectively used as a model for studies related to non-syndromic autosomal dominant deafness. The type of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell or a mammalian cell, and the recipient cell is preferably derived from a mammal.

The term "construct" as used in the present invention refers to a genetic vector comprising a specific nucleic acid sequence and capable of transferring the nucleic acid sequence of interest into a host cell to obtain a recombinant cell. According to an embodiment of the present invention, the form of the construct is not particularly limited. According to an embodiment of the present invention, it may be at least one of a plasmid, a phage, an artificial chromosome, a Cosmid (Cosmid), and a virus, and is preferably a plasmid. The plasmid is used as a genetic vector, has the characteristics of simple operation, capability of carrying larger fragments and convenience for operation and treatment. The form of the plasmid is not particularly limited, and may be a circular plasmid or a linear plasmid, and may be either single-stranded or double-stranded. One skilled in the art can select as desired. The term "nucleic acid" used in the present invention may be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, the length of which is not subject to any particular limitation. For constructs used to construct recombinant cells, it is preferred that the nucleic acid be DNA, as DNA is more stable and easier to manipulate than RNA.

According to another aspect of the present invention, the present invention also provides a recombinant cell. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct described above. Thus, the recombinant cell of the invention can effectively express the IFNLR1 gene mutant carried by the construction body. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a model for studies related to ADNSHL disorders. According to an embodiment of the present invention, the kind of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell, a mammalian cell, and preferably, the recipient cell is derived from a non-human mammal.

It is to be noted that the features and advantages described in the method section for screening a biological sample susceptible to ADNSHL, above, are equally applicable to a system or kit for screening a biological sample susceptible to ADNSHL, and will not be described herein again.

Method for constructing drug screening model

According to another aspect of the invention, the invention also provides a method for constructing a drug screening model. According to an embodiment of the invention, the method comprises: allowing at least a portion of the cells of the animal to express the aforementioned polypeptide. According to an embodiment of the invention, the animal is a mouse, pig, dog, primate, zebrafish. According to some embodiments of the invention, using the animal model of the invention, a drug for treating ADNSHL can be effectively screened.

The method for constructing a drug screening model according to the present invention is not particularly limited, as long as at least a part of cells of an animal expresses the aforementioned polypeptide. For example, the aforementioned constructs of the invention can be transferred to a recipient animal (non-human) by genetic transformation, such that at least a portion of the cells of the animal express the aforementioned polypeptide.

Method for screening biological sample of non-syndromic autosomal dominant hereditary hearing loss

According to another aspect of the present invention, there is provided a method of screening a biological sample susceptible to ADNSHL disease. According to an embodiment of the present invention, the method of screening a biological sample susceptible to an ADNSHL disorder may comprise the steps of:

first, a nucleic acid sample is extracted from a biological sample. According to the embodiment of the present invention, the type of the biological sample is not particularly limited as long as a nucleic acid sample reflecting the presence or absence of a mutation in the IFNLR1 gene of the biological sample can be extracted from the biological sample. According to an embodiment of the present invention, the biological sample may be at least one selected from human blood, skin, and subcutaneous tissue. Therefore, the sampling and the detection can be conveniently carried out, so that the efficiency of screening the biological sample of the ADNSHL disease can be further improved. According to the embodiment of the present invention, the term "nucleic acid sample" used herein should be understood broadly, and can be any sample capable of reflecting whether the IFNLR1 gene has mutation, such as whole genome DNA directly extracted from a biological sample, or a part of the whole genome containing the IFNLR1 gene coding sequence, total RNA extracted from a biological sample, or mRNA extracted from a biological sample. According to one embodiment of the invention, the nucleic acid sample is whole genomic DNA. Therefore, the source range of the biological sample can be expanded, and a plurality of kinds of information of the biological sample can be determined at the same time, so that the efficiency of screening the biological sample for the ADNSHL disease can be improved. In addition, according to an embodiment of the present invention, for using RNA as the nucleic acid sample, extracting the nucleic acid sample from the biological sample may further include: extracting an RNA sample from the biological sample, preferably the RNA sample is mRNA; and obtaining a cDNA sample by reverse transcription reaction based on the obtained RNA sample, the obtained cDNA sample constituting a nucleic acid sample. This can further improve the efficiency of screening a biological sample for ADNSHL disease using RNA as a nucleic acid sample.

Next, after obtaining the nucleic acid sample, the nucleic acid sample may be analyzed, thereby enabling determination of the nucleic acid sequence of the obtained nucleic acid sample. According to embodiments of the present invention, the method and apparatus for determining the nucleic acid sequence of the resulting nucleic acid sample are not particularly limited. According to embodiments of the present invention, the nucleic acid sequence of a nucleic acid sample may be determined by a sequencing method. Methods and apparatuses that may be used to perform sequencing according to embodiments of the present invention are not particularly limited. According to embodiments of the present invention, second generation sequencing techniques may be employed, as well as third generation and fourth generation or more advanced sequencing techniques. According to a specific example of the present invention, the nucleic acid sequence may be sequenced using at least one selected from Hiseq2000, SOLiD, 454, and a single molecule sequencing device. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized, and the efficiency of detecting and analyzing the nucleic acid sample is further improved. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data can be improved. Thus, according to embodiments of the present invention, determining the nucleic acid sequence of the nucleic acid sample may further comprise: firstly, aiming at the obtained nucleic acid sample, constructing a nucleic acid sequencing library; and sequencing the obtained nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data. According to some embodiments of the invention, the resulting nucleic acid sequencing library may be sequenced using at least one selected from Hiseq2000, SOLiD, 454, and a single molecule sequencing device. In addition, according to the embodiment of the present invention, the nucleic acid sample can be screened to enrich the IFNLR1 gene exon, and the screening enrichment can be performed before, during or after the construction of the sequencing library. According to one embodiment of the present invention, constructing a nucleic acid sequencing library for a nucleic acid sample further comprises: carrying out PCR amplification on a nucleic acid sample by using an IFNLR1 gene exon specific primer; and constructing a nucleic acid sequencing library aiming at the obtained amplification products. Therefore, IFNLR1 gene exon can be enriched through PCR amplification, and the efficiency of screening biological samples susceptible to the cone rod malnutrition can be further improved. According to the embodiment of the present invention, the sequence of the primer specific to the exon of the IFNLR1 gene is not particularly limited, and can be obtained by on-line design using Primer3.0 with reference to the human genome sequence database GRCh37.1/hg19, for example. According to a preferred embodiment of the invention, the primer specific to the exon of the IFNLR1 gene has the sequence as shown in SEQ ID NO:3 and SEQ ID NO: 4. The inventors have surprisingly found that by using SEQ ID NO:3 and SEQ ID NO:4, the primers can obviously and effectively complete the amplification of the exon sequences where the corresponding gene mutations are located in a PCR reaction system. Note that SEQ ID NO:3 and SEQ ID NO:4 was unexpectedly obtained by the present inventors after having performed a hard work.

Regarding the methods and procedures for constructing sequencing libraries for nucleic acid samples, a person skilled in the art may make appropriate selections according to different sequencing techniques, and for details of the procedures, see for example the protocol provided by the manufacturer of the sequencing instrument, e.g. Illumina corporation, multiple Sample Preparation Guide (Part #1005361 feb2010) or Paired-End Sample Preparation Guide (Part # 1005063. The method and apparatus for extracting a nucleic acid sample from a biological sample according to an embodiment of the present invention are not particularly limited, and may be performed using a commercially available nucleic acid extraction kit.

The term "nucleic acid sequence" as used herein is to be understood in a broad sense, and may be complete nucleic acid sequence information obtained by assembling sequencing data obtained by sequencing a nucleic acid sample, or may be nucleic acid sequence information obtained by directly using sequencing data (reads) obtained by sequencing a nucleic acid sample, as long as the nucleic acid sequence contains a coding sequence corresponding to the IFNLR1 gene.

Finally, after determining the nucleic acid sequence of the nucleic acid sample, the reference sequences corresponding to the nucleic acid sequences of the resulting nucleic acid sample are aligned to indicate that the biological sample is predisposed to ADNSHL when the resulting nucleic acid sequence has at least one of the aforementioned mutations. Thus, by the method of screening a biological sample susceptible to ADNSHL disease according to an embodiment of the present invention, a biological sample susceptible to ADNSHL disease can be effectively screened. The method and apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to embodiments of the present invention are not particularly limited and may be performed using any conventional software, and according to embodiments of the present invention, alignment may be performed using SOAPALIGNER/SOAP 2.

The use of the "method for screening a biological sample for ADNSHL disorder" according to the embodiment of the present invention is not particularly limited, and for example, the method can be used as a screening method for non-diagnostic purposes.

The present invention is described below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. Unless otherwise indicated, the techniques used in the examples are conventional and well known to those skilled in the art, and may be performed according to the third edition of the molecular cloning, laboratory Manual, or related products, and the reagents and products used are also commercially available. Various procedures and methods not described in detail are conventional methods well known in the art, and the sources, trade names, and components of the reagents used are indicated at the time of first appearance, and the same reagents used thereafter are the same as those indicated at the first appearance, unless otherwise specified.

Example 1 sequencing of Whole exome to determine the causative Gene and the site of mutation

1. Sample collection

The inventors collected a continuous 3-generation onset genetic deafness family of chinese han (family figure 2) consisting of 24 members, of which 10 patients were diagnosed and 9 existing patients (diagnosis figure 3), and collected peripheral blood samples from the family members, wherein the collected blood samples were 9 (II: 2, II 3, 4, II; normal human blood human samples collected 14 examples (I: 2,ii. 2mL of peripheral blood sample is collected from each sample, EDTA is added for anticoagulation, and the sample is preserved at-80 ℃.

Wherein figure 2 shows a family atlas wherein o represents a normal female, \9633, a normal male, \9679, a female patient, \9632, a male patient,

indicating a male patient who has died.

Pure tone audiometry is a standardized subjective behavioral response audiometry that tests hearing acuity, and includes air conduction and bone conduction threshold tests. Can reflect the hearing level of the minimum sound of each frequency which can be heard by a subject in a quiet environment, understand whether the hearing is normal or not and the degree and the nature of hearing loss, and serve as a diagnosis and processing basis. Some patients are older and are diagnosed for pure-tone audiometry.

The present examples examined pure-tone audiometry at different hertz for 9 patients in the family (II: 2, II 3, II 4, II. The test results show that the hearing loss of the patients generally appears in 10-20 years, and the patients show an aggravation phenomenon with the increase of the age, and the hearing loss is firstly shown in high frequency, and finally shows the full-spelling severe and extremely severe deafness with the increase of the age. Taking a patient (II: 3,ii. Where the abscissa of fig. 5 represents frequency in Hertz (HZ) and the ordinate hearing value in dB, it can be derived from the test results of fig. 5 that the older the same individual, the lower the hearing value at the same frequency.

2. Whole exon capture sequencing and variation analysis

Based on an Illumina Hiseq2000 high-throughput sequencing platform, the inventor selects samples in a family to perform whole exon sequencing and data analysis by adopting a NimbleGen SeqCap EZ outer Library V3.0 chip.

Because the line is an autosomal dominant inheritance family, the selection rule of the sample is as follows:

1) Selecting the sick individuals with distant relativity as cases (research cases);

2) Normal parents of Case served as controls (control);

3) Preferentially selecting a control with an affinity relation with two or more cases or selecting a control with the closest affinity relation with one of the cases;

4) Avoiding phenotypically normal siblings of case as control and phenotypically normal progeny of case as control;

5) 4-5 cases (the number of cases is large, and false positive and false negative rates can be reduced by combining combined analysis) or 3-4 cases +1control are selected.

Based on the above criteria, 6 samples from the pedigree (II: 1, II 4, iii 5, iii:

2.1 sample preparation

Peripheral Blood samples of the above 6 specimens (II: 1, II 4, iii.

2.2 library construction and sequencing

Each genomic DNA sample was randomly fragmented into fragments of about 150-200bp using adaptive high-focus ultrasound (Covaris) and then the library was prepared by ligation of adaptors at both ends of the fragments according to the manufacturer's instructions (see: http:// www. Illumina. Com./Illumina/Solexa Standard library Specification, incorporated herein by reference in its entirety). The library is purified, subjected to linear amplification of Ligation-mediated PCR (LM-PCR) and hybridization enrichment with a capture reagent NimbleGen SeqCap EZ Exome (64M) kit, subjected to linear amplification of LM-PCR, and subjected to on-machine sequencing after qualified library detection, so as to obtain original sequencing data. Sequencing is carried out according to an Illumina standard protocol of clustering and sequencing, wherein a sequencing platform is Illumina Genome Analyzer II, the reading length is 90bp, and the average sequencing depth of a sample is 100 x.

2.3 mutation detection and screening

The sequencing output data are sequentially subjected to preliminary statistical analysis, SNP detection and annotation and prediction of amino acid substitution, and the method mainly comprises the following steps:

2.3.1 basic data analysis statistics

Performing basic data analysis statistics on data generated by sequencing: analyzing the length of the measured sequences, counting the number of reads and the yield of data, comparing the reads sequence with a reference genome sequence, counting the Coverage (Coverage) and the sequencing Depth (Depth) of the target region compared to the genome reads to be referred to, and the like. And obtaining sample basic information captured by the exon according to the statistical result of the basic data, and judging whether the data meets the requirements.

2.3.2SNP detection and Indel detection

The high quality raw reads of each sample were aligned to the reference Genome (hg 19) by SOAPaligner (v 2.21) and Burrows-Wheeler Aligner (BWA, v0.7.10) alignment software, then SNP and Indel were detected using Genome Analysis Toolkit (GATK, v 3.3-0) software, variation annotation was performed on the detected variations using Variable Effect Predictor (VEP), and frequency databases such as 1KG/ESP/HapMap/ExAC and information such as OMIM, GO, KEGG, hazard prediction were added. According to the prevalence rate of non-syndromic autosomal dominant hereditary hearing loss (ADNSHL), high frequency (1 KG/ESP/HapMap/ExAC > 0.005) and variation of intron regions are filtered out. Then, according to linkage analysis and a family genetic pattern, the variation shared by patients in a linkage location region and not possessed by normal people in the family is screened out, and finally 10 candidate variations are screened out.

2.3.3Sanger sequencing

The 10 candidate variations were verified by Sanger sequencing, and PCR primers for amplifying the region of the mutation were designed using Primer3 (http:// frodo. Wi. Mit. Edu/Primer3 /). The amplified fragments were sequenced using ABI3100 (Applied Biosystems, foster City, calif.) genetic Analyzer using ABI BigDye Terminator cycle sequencing kit v3.1 (Applied Biosystems, foster City, calif.).

It was verified that a missense mutation c.296G > A (p.Arg99His) on the IFNLR1 gene cosegregates genotype and phenotype in the family.

Moreover, as shown in fig. 3, IFNLR1 gene homology comparison analysis shows that IFNLR1p. Arg99his is highly conserved in a plurality of species, including humans (h.sapiens), chimpanzees (p.troglodytes), macaques (m.mulatta), wolfs (c.lupus), cattle (b.taurus), mice (m.musculus), and rats (r.norvegicus).

Example 2Sanger sequencing of the pathogenic mutations of ADNSHL

The IFNLR1 gene obtained by the detection of the example 1 is respectively detected, a primer is designed aiming at the sequence of the mutation site related to the gene, then the related sequence of the mutation is obtained by a PCR amplification, product purification and sequencing method, and the correlation between the gene and the ADNSHL disease is verified according to the determination of whether the sequence determination result belongs to a mutant type or a wild type, whether the mutation is a heterozygous mutation or a homozygous mutation, and whether the sequence and the phenotype are in coseparation in a family.

1. DNA extraction

Collecting 10ml of peripheral venous Blood, extracting genomic DNA by adopting an OMEGA Blood DNA Midi Kit whole Blood DNA extraction Kit, measuring the concentration and purity of the DNA by using a spectrophotometer and a gel electrophoresis method, and diluting to 200 ng/mul;

2. primer design and PCR reaction

Candidate Gene Genomic DNA Standard sequence was derived from UCSC (http:// genome. UCSC. Edu /), primers for candidate genes were designed and synthesized using Primer3 (version 0.4.0, http:// Primer3.Ut. Ee /), synthesized by Biotech, and Primer-BLAST (http:// www.ncbi. Nlm. Nih. Gov/tools/Primer-BLAST /) was used to verify Primer specificity.

The primer sequences are as follows:

forward primer (SEQ ID NO: 3): 5' AGTGGCTGCCTGTCTGGA-3

Reverse primer (SEQ ID NO: 4): 5' TGGTGCTCAACTGAAAATAATGA-3

And (3) carrying out candidate nucleotide variation mutation detection on the family members and the normal control population:

and (3) PCR amplification: amplifying the extracted DNA specimen by using the designed primer;

1) PCR reaction system

2) And (3) PCR reaction conditions:

3. sequencing

Analysis of PCR products: subjecting the PCR product to electrophoresis in 1.5% agarose gel (selecting appropriate voltage according to the size of the amplified fragment), and analyzing the electrophoretogram;

after a sample with a single band type and high concentration is selected and purified by a PCR product, the PCR amplification product is analyzed by sequencing by an automatic gene analyzer 3500 of the American ABI company, a sequencing diagram is analyzed, and mutation is analyzed by comparing the sequencing diagram with a standard sequence. The pathogenic gene and pathogenic mutation were identified, indicating that base 296 of the coding region of IFNLR1 gene was altered G → A (FIG. 4).

Example 3

The IFNLR1 gene expresses Interferon lambda receptor 1 (Interferon lambda receptor 1) protein, and is involved in recognition of cytokines and interferons in extracellular environment, intracellular signal transduction, and the like, and IFNLR1 is widely expressed in rodent in the vestibular epithelium of inner ear helices, cochlear nerves, spiral ganglia, and inner ear. The functions include antiviral activity, antiproliferative action, anticancer activity, and molecular expression and immune response of MHC (major histocompatibility complex) complex I/II, etc. To date, the role of IFNLR1 in the auditory system has not been discovered.

In order to further research the function of IFNLR1 in the auditory system, the invention researches the expression and distribution of IFNLR1 in the inner ear of a mouse by means of a mouse model and a fluorescent labeling method, and finds that the IFNLR1 gene shows wide expression in cochlea and spiral organ.

By utilizing a zebra fish model, IFNLR1 gene mutant zebra fish and wild zebra fish are subjected to contrast research, and the IFNLR1, hair cells and swim bladder normal development and function are found to play an important role, and deletion of the zebra fish hair cells can be caused by knocking out IFNLR1 gene deletion. Therefore, IFNLR1c.296G > A (p.Arg99His) causes the development of non-syndromic autosomal dominant deafness (ADNSHL).

Example 4 detection kit

A test kit comprising primers suitable for detecting IFNLR1 gene mutants for screening biological samples susceptible to non-syndromic autosomal dominant deafness was prepared, wherein the specific sequences of the primers are shown in example 1.

The method for screening the biological sample susceptible to non-syndrome autosomal dominant hereditary hearing loss by using the kit comprises the following specific steps: extracting the DNA of a subject to be tested according to the method described in step 1 of example 2, performing PCR reaction with the exon-specific primers using the extracted DNA as a template, purifying the PCR product according to a conventional method in the art, sequencing the purified product, and then observing whether the sequence obtained by sequencing has at least one mutation selected from the genes, thereby effectively detecting whether the subject is susceptible to non-syndrome autosomal dominant hereditary hearing loss, and further, screening a biological sample susceptible to non-syndrome autosomal dominant hereditary hearing loss from the subject.

In the description of the specification, reference to the description of "one embodiment," "some embodiments," "an example," "a specific example," or "some examples" or the like means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> general Hospital of the liberation force of people in China, shenzhen Hua Dashengshengscience institute

<120> isolated nucleic acid encoding IFNLR1 mutant and uses thereof

<130> PIDC3174935

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1476

<212> DNA

<213> Artificial sequence

<400> 1

atggcggggc ccgagcgctg gggccccctg ctcctgtgcc tgctgcaggc cgctccaggg 60

aggccccgtc tggcccctcc ccagaatgtg acgctgctct cccagaactt cagcgtgtac 120

ctgacatggc tcccagggct tggcaacccc caggatgtga cctattttgt ggcctatcag 180

agctctccca cccgtagacg gtggcgcgaa gtggaagagt gtgcgggaac caaggagctg 240

ctatgttcta tgatgtgcct gaagaaacag gacctgtaca acaagttcaa gggacgcgtg 300

cggacggttt ctcccagctc caagtccccc tgggtggagt ccgaatacct ggattacctt 360

tttgaagtgg agccggcccc acctgtcctg gtgctcaccc agacggagga gatcctgagt 420

gccaatgcca cgtaccagct gcccccctgc atgcccccac tggatctgaa gtatgaggtg 480

gcattctgga aggagggggc cggaaacaag accctatttc cagtcactcc ccatggccag 540

ccagtccaga tcactctcca gccagctgcc agcgaacacc actgcctcag tgccagaacc 600

atctacacgt tcagtgtccc gaaatacagc aagttctcta agcccacctg cttcttgctg 660

gaggtcccag aagccaactg ggctttcctg gtgctgccat cgcttctgat actgctgtta 720

gtaattgccg cagggggtgt gatctggaag accctcatgg ggaacccctg gtttcagcgg 780

gcaaagatgc cacgggccct ggaactgacc agaggggtca ggccgacgcc tcgagtcagg 840

gccccagcca cccaacagac aagatggaag aaggaccttg cagaggacga agaggaggag 900

gatgaggagg acacagaaga tggcgtcagc ttccagccct acattgaacc accttctttc 960

ctggggcaag agcaccaggc tccagggcac tcggaggctg gtggggtgga ctcagggagg 1020

cccagggctc ctctggtccc aagcgaaggc tcctctgctt gggattcttc agacagaagc 1080

tgggccagca ctgtggactc ctcctgggac agggctgggt cctctggcta tttggctgag 1140

aaggggccag gccaagggcc gggtggggat gggcaccaag aatctctccc accacctgaa 1200

ttctccaagg actcgggttt cctggaagag ctcccagaag ataacctctc ctcctgggcc 1260

acctggggca ccttaccacc ggagccgaat ctggtccctg ggggaccccc agtttctctt 1320

cagacactga ccttctgctg ggaaagcagc cctgaggagg aagaggaggc gagggaatca 1380

gaaattgagg acagcgatgc gggcagctgg ggggctgaga gcacccagag gaccgaggac 1440

aggggccgga cattggggca ttacatggcc aggtga 1476

<210> 2

<211> 491

<212> PRT

<213> Artificial sequence

<400> 2

Met Ala Gly Pro Glu Arg Trp Gly Pro Leu Leu Leu Cys Leu Leu Gln

1 5 10 15

Ala Ala Pro Gly Arg Pro Arg Leu Ala Pro Pro Gln Asn Val Thr Leu

20 25 30

Leu Ser Gln Asn Phe Ser Val Tyr Leu Thr Trp Leu Pro Gly Leu Gly

35 40 45

Asn Pro Gln Asp Val Thr Tyr Phe Val Ala Tyr Gln Ser Ser Pro Thr

50 55 60

Arg Arg Arg Trp Arg Glu Val Glu Glu Cys Ala Gly Thr Lys Glu Leu

65 70 75 80

Leu Cys Ser Met Met Cys Leu Lys Lys Gln Asp Leu Tyr Asn Lys Phe

85 90 95

Lys Gly Arg Val Arg Thr Val Ser Pro Ser Ser Lys Ser Pro Trp Val

100 105 110

Glu Ser Glu Tyr Leu Asp Tyr Leu Phe Glu Val Glu Pro Ala Pro Pro

115 120 125

Val Leu Val Leu Thr Gln Thr Glu Glu Ile Leu Ser Ala Asn Ala Thr

130 135 140

Tyr Gln Leu Pro Pro Cys Met Pro Pro Leu Asp Leu Lys Tyr Glu Val

145 150 155 160

Ala Phe Trp Lys Glu Gly Ala Gly Asn Lys Thr Leu Phe Pro Val Thr

165 170 175

Pro His Gly Gln Pro Val Gln Ile Thr Leu Gln Pro Ala Ala Ser Glu

180 185 190

His His Cys Leu Ser Ala Arg Thr Ile Tyr Thr Phe Ser Val Pro Lys

195 200 205

Tyr Ser Lys Phe Ser Lys Pro Thr Cys Phe Leu Leu Glu Val Pro Glu

210 215 220

Ala Asn Trp Ala Phe Leu Val Leu Pro Ser Leu Leu Ile Leu Leu Leu

225 230 235 240

Val Ile Ala Ala Gly Gly Val Ile Trp Lys Thr Leu Met Gly Asn Pro

245 250 255

Trp Phe Gln Arg Ala Lys Met Pro Arg Ala Leu Glu Leu Thr Arg Gly

260 265 270

Val Arg Pro Thr Pro Arg Val Arg Ala Pro Ala Thr Gln Gln Thr Arg

275 280 285

Trp Lys Lys Asp Leu Ala Glu Asp Glu Glu Glu Glu Asp Glu Glu Asp

290 295 300

Thr Glu Asp Gly Val Ser Phe Gln Pro Tyr Ile Glu Pro Pro Ser Phe

305 310 315 320

Leu Gly Gln Glu His Gln Ala Pro Gly His Ser Glu Ala Gly Gly Val

325 330 335

Asp Ser Gly Arg Pro Arg Ala Pro Leu Val Pro Ser Glu Gly Ser Ser

340 345 350

Ala Trp Asp Ser Ser Asp Arg Ser Trp Ala Ser Thr Val Asp Ser Ser

355 360 365

Trp Asp Arg Ala Gly Ser Ser Gly Tyr Leu Ala Glu Lys Gly Pro Gly

370 375 380

Gln Gly Pro Gly Gly Asp Gly His Gln Glu Ser Leu Pro Pro Pro Glu

385 390 395 400

Phe Ser Lys Asp Ser Gly Phe Leu Glu Glu Leu Pro Glu Asp Asn Leu

405 410 415

Ser Ser Trp Ala Thr Trp Gly Thr Leu Pro Pro Glu Pro Asn Leu Val

420 425 430

Pro Gly Gly Pro Pro Val Ser Leu Gln Thr Leu Thr Phe Cys Trp Glu

435 440 445

Ser Ser Pro Glu Glu Glu Glu Glu Ala Arg Glu Ser Glu Ile Glu Asp

450 455 460

Ser Asp Ala Gly Ser Trp Gly Ala Glu Ser Thr Gln Arg Thr Glu Asp

465 470 475 480

Arg Gly Arg Thr Leu Gly His Tyr Met Ala Arg

485 490

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence

<400> 3

agtggctgcc tgtctgga 18

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence

<400> 4

tggtgctcaa ctgaaaataa tga 23

Claims (10)

1. Application of reagent for detecting mutation sites in preparation of kit for screening patient susceptible to non-syndrome autosomal dominant hereditary hearing loss syndromeIFNLR1c.296G of gene>And (3) mutation A.

2. The use according to claim 1, wherein c.296G of IFNLR1 gene>Mutation A causesIFNLR1The p.arg99his mutation occurs in the polypeptide encoded by the gene.

3. The use according to claim 1, wherein the reagent comprises a nucleic acid probe or primer pair that specifically detects the mutation site.

4. Use according to claim 3, characterized in that the nucleic acid sequences of the primer pairs are as follows: the forward primer is SEQ ID NO:3, and the reverse primer is SEQ ID NO: 4.

5. Use of a reagent for detecting a mutation site in a system for screening patients susceptible to non-syndromic autosomal dominant deafnessIFNLR1c.296G of gene>A mutation, and the reagent comprises a specific primer pair for specifically detecting the mutation site.

6. Use according to claim 5, characterized in that the system comprises:

a nucleic acid extraction device for extracting a nucleic acid sample from a biological sample;

the nucleic acid sequence determining device is connected with the nucleic acid extracting device and is used for analyzing the nucleic acid sample and determining the nucleic acid sequence of the nucleic acid sample;

a judging device connected to the nucleic acid sequence determining device for judging whether the sample is wild-type or not based on the nucleic acid sequence of the nucleic acid sampleIFNLR1In the nucleic acid sequence of gene comparisonWhether or not it has c.296G>And (3) mutation A.

7. The use according to claim 6, characterized in that the nucleic acid extraction device further comprises:

an RNA extraction unit for extracting an RNA sample from the biological sample; and

and the reverse transcription unit is connected with the RNA extraction unit and is used for carrying out reverse transcription reaction on the RNA sample to obtain a cDNA sample, and the cDNA sample forms the nucleic acid sample.

8. The use according to claim 7, wherein the nucleic acid sequence determination apparatus further comprises:

a PCR amplification module, wherein the PCR amplification module is provided withIFNLR1A specific primer pair, so that the nucleic acid sample is subjected to PCR amplification by using the specific primer pair; and

a sequencing unit that obtains a sequencing result.

9. The use according to claim 8, characterized in that the specific primer pairs are as follows: the forward primer is SEQ ID NO:3, and the reverse primer is SEQ ID NO: 4.

10. The use according to claim 8, wherein the sequencing unit comprises at least one selected from the group consisting of HISEQ2000, SOLID, 454 and a single molecule sequencing device.

Images