CN104164424A - CC2D2A gene mutant and application thereof - Google Patents
CC2D2A gene mutant and application thereof Download PDFInfo
- Publication number
- CN104164424A CN104164424A CN201310184623.4A CN201310184623A CN104164424A CN 104164424 A CN104164424 A CN 104164424A CN 201310184623 A CN201310184623 A CN 201310184623A CN 104164424 A CN104164424 A CN 104164424A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- sample
- nucleotide sequence
- joubert
- optionally
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 101150017546 CC2D2A gene Proteins 0.000 title claims abstract description 65
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 102
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 100
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 100
- 239000012472 biological sample Substances 0.000 claims abstract description 71
- 201000008645 Joubert syndrome Diseases 0.000 claims abstract description 45
- 238000000034 method Methods 0.000 claims abstract description 39
- 238000012216 screening Methods 0.000 claims abstract description 31
- 229920001184 polypeptide Polymers 0.000 claims abstract description 14
- 102000004196 processed proteins & peptides Human genes 0.000 claims abstract description 14
- 108090000765 processed proteins & peptides Proteins 0.000 claims abstract description 14
- 239000000523 sample Substances 0.000 claims description 78
- 239000002773 nucleotide Substances 0.000 claims description 55
- 125000003729 nucleotide group Chemical group 0.000 claims description 55
- 230000008859 change Effects 0.000 claims description 46
- 238000012163 sequencing technique Methods 0.000 claims description 44
- 102220084759 rs773881370 Human genes 0.000 claims description 38
- 206010064571 Gene mutation Diseases 0.000 claims description 33
- 102220085144 rs863225344 Human genes 0.000 claims description 30
- 238000000605 extraction Methods 0.000 claims description 15
- 238000012408 PCR amplification Methods 0.000 claims description 13
- 239000012620 biological material Substances 0.000 claims description 13
- 239000003153 chemical reaction reagent Substances 0.000 claims description 12
- 239000002299 complementary DNA Substances 0.000 claims description 12
- 239000013614 RNA sample Substances 0.000 claims description 10
- 238000010276 construction Methods 0.000 claims description 9
- 238000000926 separation method Methods 0.000 claims description 9
- 238000012360 testing method Methods 0.000 claims description 9
- 208000025341 autosomal recessive disease Diseases 0.000 claims description 8
- 238000010839 reverse transcription Methods 0.000 claims description 8
- 108020004711 Nucleic Acid Probes Proteins 0.000 claims description 5
- 238000002123 RNA extraction Methods 0.000 claims description 5
- 210000004369 blood Anatomy 0.000 claims description 5
- 239000002853 nucleic acid probe Substances 0.000 claims description 5
- 239000007787 solid Substances 0.000 claims description 5
- 241001269238 Data Species 0.000 claims description 4
- 239000008280 blood Substances 0.000 claims description 4
- 239000000203 mixture Substances 0.000 claims description 4
- 108020004999 messenger RNA Proteins 0.000 claims description 3
- 238000004519 manufacturing process Methods 0.000 claims description 2
- 102100024079 Coiled-coil and C2 domain-containing protein 2A Human genes 0.000 abstract description 19
- 101000910414 Homo sapiens Coiled-coil and C2 domain-containing protein 2A Proteins 0.000 abstract description 19
- 230000035772 mutation Effects 0.000 abstract description 16
- 108090000623 proteins and genes Proteins 0.000 description 27
- 210000004027 cell Anatomy 0.000 description 25
- 108020004414 DNA Proteins 0.000 description 17
- 238000001514 detection method Methods 0.000 description 16
- 238000005516 engineering process Methods 0.000 description 8
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 7
- 210000004081 cilia Anatomy 0.000 description 7
- 235000018102 proteins Nutrition 0.000 description 7
- 102000004169 proteins and genes Human genes 0.000 description 7
- 239000013612 plasmid Substances 0.000 description 6
- 108020004485 Nonsense Codon Proteins 0.000 description 5
- 239000002253 acid Substances 0.000 description 5
- 210000001638 cerebellum Anatomy 0.000 description 5
- 238000003745 diagnosis Methods 0.000 description 5
- 201000010099 disease Diseases 0.000 description 5
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 5
- 230000002068 genetic effect Effects 0.000 description 5
- 230000037434 nonsense mutation Effects 0.000 description 5
- 230000008569 process Effects 0.000 description 5
- 238000011160 research Methods 0.000 description 5
- 208000011580 syndromic disease Diseases 0.000 description 5
- 230000000295 complement effect Effects 0.000 description 4
- 238000010586 diagram Methods 0.000 description 4
- 239000000126 substance Substances 0.000 description 4
- 206010058314 Dysplasia Diseases 0.000 description 3
- 108091028043 Nucleic acid sequence Proteins 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 230000008901 benefit Effects 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 238000007854 ligation-mediated PCR Methods 0.000 description 3
- 230000000869 mutational effect Effects 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 101150065175 Atm gene Proteins 0.000 description 2
- 108091026890 Coding region Proteins 0.000 description 2
- 208000032170 Congenital Abnormalities Diseases 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 241000588724 Escherichia coli Species 0.000 description 2
- 108091028664 Ribonucleotide Proteins 0.000 description 2
- 230000002159 abnormal effect Effects 0.000 description 2
- 208000021024 autosomal recessive inheritance Diseases 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 239000005547 deoxyribonucleotide Substances 0.000 description 2
- 125000002637 deoxyribonucleotide group Chemical group 0.000 description 2
- 230000006870 function Effects 0.000 description 2
- 210000003128 head Anatomy 0.000 description 2
- 210000004962 mammalian cell Anatomy 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 210000004940 nucleus Anatomy 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 210000005259 peripheral blood Anatomy 0.000 description 2
- 239000011886 peripheral blood Substances 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 230000029058 respiratory gaseous exchange Effects 0.000 description 2
- 239000002336 ribonucleotide Substances 0.000 description 2
- 125000002652 ribonucleotide group Chemical group 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 230000019491 signal transduction Effects 0.000 description 2
- 238000001228 spectrum Methods 0.000 description 2
- 101150038313 AHI1 gene Proteins 0.000 description 1
- 208000000363 Agenesis of Corpus Callosum Diseases 0.000 description 1
- BHPQYMZQTOCNFJ-UHFFFAOYSA-N Calcium cation Chemical compound [Ca+2] BHPQYMZQTOCNFJ-UHFFFAOYSA-N 0.000 description 1
- 101710198317 Centrosomal protein of 290 kDa Proteins 0.000 description 1
- 102100035673 Centrosomal protein of 290 kDa Human genes 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 238000001712 DNA sequencing Methods 0.000 description 1
- 206010061619 Deformity Diseases 0.000 description 1
- 108091092584 GDNA Proteins 0.000 description 1
- 206010060766 Heteroplasia Diseases 0.000 description 1
- 101000715664 Homo sapiens Centrosomal protein of 290 kDa Proteins 0.000 description 1
- 208000002720 Malnutrition Diseases 0.000 description 1
- 241000124008 Mammalia Species 0.000 description 1
- 206010060860 Neurological symptom Diseases 0.000 description 1
- 208000007014 Retinitis pigmentosa Diseases 0.000 description 1
- 208000004350 Strabismus Diseases 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 230000005856 abnormality Effects 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 125000003275 alpha amino acid group Chemical group 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 210000004507 artificial chromosome Anatomy 0.000 description 1
- 210000004958 brain cell Anatomy 0.000 description 1
- 230000003925 brain function Effects 0.000 description 1
- 210000005252 bulbus oculi Anatomy 0.000 description 1
- 229910001424 calcium ion Inorganic materials 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 239000004927 clay Substances 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 238000009223 counseling Methods 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 210000001508 eye Anatomy 0.000 description 1
- 230000004424 eye movement Effects 0.000 description 1
- 210000000744 eyelid Anatomy 0.000 description 1
- 230000001815 facial effect Effects 0.000 description 1
- 210000003714 granulocyte Anatomy 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 210000003292 kidney cell Anatomy 0.000 description 1
- 210000000265 leukocyte Anatomy 0.000 description 1
- 210000005229 liver cell Anatomy 0.000 description 1
- 230000001071 malnutrition Effects 0.000 description 1
- 235000000824 malnutrition Nutrition 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 208000004141 microcephaly Diseases 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 230000003387 muscular Effects 0.000 description 1
- 210000001167 myeloblast Anatomy 0.000 description 1
- 208000015380 nutritional deficiency disease Diseases 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 238000004393 prognosis Methods 0.000 description 1
- 210000000449 purkinje cell Anatomy 0.000 description 1
- 239000002096 quantum dot Substances 0.000 description 1
- 210000003370 receptor cell Anatomy 0.000 description 1
- 230000008085 renal dysfunction Effects 0.000 description 1
- 210000001525 retina Anatomy 0.000 description 1
- 210000001202 rhombencephalon Anatomy 0.000 description 1
- 238000007665 sagging Methods 0.000 description 1
- 210000000697 sensory organ Anatomy 0.000 description 1
- 230000008786 sensory perception of smell Effects 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a CC2D2A gene mutant and application thereof, and particularly relates to an isolated nucleic acid for coding a CC2D2A mutant, an isolated polypeptide, a method for screening biological samples susceptible to hereditary Joubert syndrome, a system for screening the biological samples susceptible to hereditary Joubert syndrome and a kit for screening the biological samples susceptible to hereditary Joubert syndrome. Wherein the separated nucleic acid for coding the CC2D2A gene mutant is similar to the nucleic acid shown in SEQ ID NO: 1, at least one mutation having c.2999A > T, c.3688C > T. By detecting whether the novel mutant exists in a biological sample, whether the biological sample is susceptible to hereditary Joubert syndrome can be effectively detected.
Description
Technical field
The present invention relates to technical field.Particularly, the present invention relates to CC2D2A gene mutation body and application thereof.
Background technology
Joubert syndrome (Joubert syndrome, JS, omim num:
213300) be the heredity syndromes that a class is relevant to retinitis pigmentosa, in 1969, by reported first such as Joubert, this sick male sex was common, and M-F is 3:2, and morbidity ratio is 1/100000, and prognosis is conventionally poor.The survival rate of 5 years only reaches 50%.
Clinical characters mainly comprises the vermis of cerebellum underdevelopment with odontorisis, and is attended by neurological symptom, comprises breathing pattern and late-blooming imbalance.This disease also can be followed other heteroplasia, as retina malnutrition, renal dysfunction, microcephalus, facial deformity, agenesis of corpus callosum, refer to (toe) deformity etc. more.Vermis of cerebellum underdevelopment, muscular tension are low in order possessing for its clinical criteria, 3 of development delay; In abnormal 2 of abnormal breathing and eye movement, at least there is 1.
Joubert syndrome is relevant with multiple genes, and the gene of finding at present has more than 20, the albumen that these genes generate be determine or suspect the effect of playing the part of cilium in cell.Cilium is digitation, participates in chemical signal conduction at cell surface.Cilium plays an important role on the structure and function of multiclass cell, comprising brain cell (neurone), kidney and liver cell, primary cilium is separated at Purkinje cell and myeloblast. and cilium is also that the necessary component of sense organ is (as vision, the sense of hearing, sense of smell).Researchist thinks, cilium defect can cause most of phenotype of this disease, but at present still unclear specifically how to cause dysplastic.
There are at present two theories to explain Joubert syndrome patient's vermis of cerebellum dysplasia.The one, the SHH Signal transduction abnormalities due to cilium defect, thus the minimizing of granulocyte propagation causes vermis of cerebellum dysplasia, and the 2nd, middle hindbrain border and rhombomere have slight change to cause vermis of cerebellum dysplasia.
Nearly 25% the syndromic Disease-causing gene of Joubert is AHI1 gene or CEP290/NPHP6 gene.Although Joubert syndrome is made progress rapidly on genetics research, genetic flaw is how to affect brain function, and growth and structure are but still unclear.Wherein CC2D2A gene is positioned at 4p15.33, and coding is rich in the albumen in a coiled coil and C2 region, and functional study finds that this gene may play an important role in calcium ion dependent form signal transduction.
Thereby to Joubert, syndromic research still needs deeply at present.
Summary of the invention
The present invention is intended to one of solve the problems of the technologies described above at least to a certain extent.For this reason, one object of the present invention is to propose a kind ofly can easily suffer from the method for the syndromic biological sample of Joubert by Effective selection.
The present invention is that the following work based on contriver completes: contriver has determined the Disease-causing gene mutational site that Joubert syndrome is new one of (CC2D2A gene c.2999A>T, c.3688C>T at least suddenly change) by the method for high-throughput exon group order-checking associating candidate gene sudden change checking.
According to a first aspect of the invention, the present invention proposes a kind of nucleic acid of coding CC2D2A gene mutation body of separation.According to embodiments of the invention, described nucleic acid, compared with SEQ ID NO:1, has and is selected from least one following sudden change: c.2999A>T, and c.3688C>T.With respect to wild-type CC2D2A gene, c.2999A>T CC2D2A gene of the present invention has missense mutation, c.3688C>T at least one.According to embodiments of the invention, contriver has determined the new mutant body of CC2D2A gene, whether the syndromic morbidity of this mutant and Joubert is closely related, thereby exist in biological sample by detecting this new mutant body, and whether detection of biological sample easily suffers from Joubert syndrome effectively.
According to a second aspect of the invention, the present invention proposes a kind of isolated polypeptide, this polypeptide is compared with SEQ ID NO:2, have and be selected from least one following sudden change: p.Glu1000Val, p.Arg1230X, by whether expressing this polypeptide in detection of biological sample, whether easily Joubert syndrome of detection of biological sample effectively.According to embodiments of the invention, this polypeptide is by above-mentioned nucleic acid encoding.
According to three aspects, ground of the present invention, the present invention proposes a kind of method of screening the syndromic biological sample of easy trouble Joubert, the method comprises the following steps: from described extraction from biological material sample of nucleic acid; Determine the nucleotide sequence of described sample of nucleic acid; The nucleotide sequence of described sample of nucleic acid is compared with SEQ ID NO:1, having at least one sudden change being selected from c.2999A>T or is c.3688C>T that described biological sample is easily suffered from the syndromic instruction of Joubert, optionally, described biological sample is for being selected from blood of human body, optionally, described sample of nucleic acid is complete genome DNA, and optionally, described Joubert syndrome is autosomal recessive disease.By according to the method for the syndromic biological sample of screening susceptible Joubert of the embodiment of the present invention, can effectively screen the syndromic biological sample of susceptible Joubert.
According to a forth aspect of the invention, the present invention proposes a kind of system of screening the syndromic biological sample of easy trouble Joubert, this system comprises: nucleic acid-extracting apparatus, and described nucleic acid-extracting apparatus is used for from described extraction from biological material sample of nucleic acid; Nucleotide sequence determining device, described nucleotide sequence determining device is connected with described nucleic acid-extracting apparatus, for described sample of nucleic acid is analyzed, to determine the nucleotide sequence of described sample of nucleic acid; Judgment means, described judgment means is connected with described nucleotide sequence determining device, so that the nucleotide sequence based on described sample of nucleic acid is compared with SEQ ID NO:1, whether have c.2999A>T, c.3688C>T at least one sudden change, judges whether described biological sample easily suffers from Joubert syndrome; Optionally, described Joubert syndrome is autosomal recessive disease.Utilize this system, can effectively implement the method for the syndromic biological sample of aforementioned screening susceptible Joubert, thereby can effectively screen the syndromic biological sample of susceptible Joubert.
According to a fifth aspect of the invention, the present invention proposes a kind of for screening the test kit of the syndromic biological sample of easy trouble Joubert, this test kit contains: the reagent that is suitable for detecting CC2D2A gene mutation body, wherein compared with SEQ ID NO:1, described CC2D2A gene mutation body has and is selected from least one following sudden change: c.2999A>T, c.3688C>T, optionally, described reagent is nucleic acid probe or primer, optionally, described nucleic acid probe or primer have the nucleotide sequence as shown in SEQ ID NO:3-6, optionally, described Joubert syndrome is autosomal recessive disease.
According to a sixth aspect of the invention, the invention allows for a kind of construct.According to embodiments of the invention, the nucleic acid of the coding CC2D2A gene mutation body that this construct comprises foregoing separation.It should be noted that, " nucleic acid of the coding ATM gene mutation body that construct comprises foregoing separation " represents, construct of the present invention comprises the nucleotide sequence compared with SEQ ID NO:1 with the CC2D2A gene mutation body c.2999A>T suddenling change, or comprise and there is the c.3688C>T nucleotide sequence of the CC2D2A gene mutation body of sudden change compared with SEQ ID NO:1, or comprise the nucleotide sequence of above-mentioned two kinds of CC2D2A gene mutation bodies simultaneously.Thus, utilize the reconstitution cell of construct transformed acceptor cell acquisition of the present invention, can effectively be used as the model of Joubert syndrome correlative study.
According to a seventh aspect of the invention, the invention allows for a kind of reconstitution cell.According to embodiments of the invention, this reconstitution cell obtains by foregoing construct transformed acceptor cell.According to some embodiments of the present invention, reconstitution cell of the present invention, can be effectively as the model of Joubert syndrome correlative study.
For nucleic acid described in the present invention, it will be appreciated by those skilled in the art that actual any of comprising complementary two strands, or two.For convenient, in an embodiment of the present invention, although in most cases only provided a chain, another chain of complementation with it is in fact also disclosed.For example, mention SEQ ID NO:1, actual its complementary sequence that comprises.Those skilled in the art are further appreciated that and utilize a chain can detect another chain, and vice versa.
Additional aspect of the present invention and advantage in the following description part provide, and part will become obviously from the following description, or recognize by practice of the present invention.
Brief description of the drawings
Above-mentioned and/or additional aspect of the present invention and advantage accompanying drawing below combination is understood becoming the description of embodiment obviously and easily, wherein:
Fig. 1: show to screen according to an embodiment of the invention and easily suffered from the system of the syndromic biological sample of Joubert and the schematic diagram of integral part thereof, wherein,
A is the schematic diagram of easily suffering from the system of Joubert syndrome patient's biological sample according to the screening of the embodiment of the present invention,
B is according to the schematic diagram of the nucleic acid-extracting apparatus of the embodiment of the present invention,
C is according to the schematic diagram of the nucleotide sequence determining device of the embodiment of the present invention.
Fig. 2: shown Joubert syndrome patient's family collection of illustrative plates according to an embodiment of the invention.
Fig. 3: shown Joubert syndrome patient's head nucleus magnetic resonance picture according to an embodiment of the invention.
Fig. 4: shown the Sanger method sequencing result of CC2D2A gene mutation body according to an embodiment of the invention.
Embodiment
Describe embodiments of the invention below in detail, the example of described embodiment is shown in the drawings, and wherein same or similar label represents same or similar element or has the element of identical or similar functions from start to finish.Be exemplary below by the embodiment being described with reference to the drawings, be intended to for explaining the present invention, and can not be interpreted as limitation of the present invention.
CC2D2A gene mutation body
According to a first aspect of the invention, the present invention proposes a kind of nucleic acid of coding CC2D2A gene mutation body of separation.According to embodiments of the invention, described nucleic acid, compared with SEQ ID NO:1, has and is selected from least one following sudden change: c.2999A>T, and c.3688C>T.With respect to wild-type CC2D2A gene, c.2999A>T CC2D2A gene of the present invention has a missense mutation or c.3688C>T at least one of a nonsense mutation.According to a particular embodiment of the invention, c.2999A>T the sudden change of CC2D2A gene causes proteins encoded that p.Glu1000Val missense mutation occurs, and c.3688C>T this sudden change causes proteins encoded that p.Arg1230X nonsense mutation occurs.Therefore the pathogenic mutation spectrum of CC2D2A gene has been enriched in this research, significant to carrying out the molecular diagnosis of CC2D2A.
According to embodiments of the invention, contriver has determined the new mutant body of CC2D2A gene, whether the syndromic morbidity of this mutant and Joubert is closely related, thereby exist in biological sample by detecting this new mutant body, and whether detection of biological sample easily suffers from Joubert syndrome effectively.
The phraseology " nucleic acid of coding CC2D2A mutant " that used in this article, refer to the nucleic acid substances corresponding with the gene of the CC2D2A mutant of encoding, the type that is nucleic acid is not particularly limited, can be any deoxyribonucleotide corresponding with the encoding gene of CC2D2A mutant and/or polymkeric substance of ribonucleotide of comprising, include but not limited to DNA, RNA or cDNA.According to a concrete example of the present invention, the nucleic acid of foregoing coding CC2D2A mutant is DNA.According to embodiments of the invention, contriver has determined the new mutant body of CC2D2A gene, these new mutant bodies and the syndromic morbidity of Joubert are closely related, thereby whether exist in biological sample by detecting this new mutant body, whether detection of biological sample easily suffers from Joubert syndrome effectively, also can in organism, whether exist by detecting these mutant, can effectively predict whether organism easily suffers from Joubert syndrome.
The nucleic acid of this coding CC2D2A mutant is that present inventor passes through the new mutant on the definite syndromic Disease-causing gene of Joubert of method that the sudden change of high-throughput exon group order-checking associating candidate gene verifies.This mutational site is not referred in the prior art.
Wherein, the cDNA of wild-type CC2D2A gene has nucleotide sequence as follows:
ATGAATCCCAGGGAAGAAAAAGTAAAAATAATTACAGAGGAGTTCATTGAAAATGATGAGGATGCAGACATGGGAAGACAGAATAAGAACTCAAAGGTTCGAAGACAGCCAAGAAAGAAACAGCCACCAACTGCTGTCCCCAAGGAAATGGTGTCCGAAAAATCCCACCTTGGCAACCCCCAGGAGCCTGTGCAGGAGGAGCCCAAGACCCGCCTCCTGAGTATGACAGTCCGGAGAGGCCCACGGAGCTTACCTCCAATTCCTTCAACTTCCAGAACAGGCTTTGCAGAATTTTCCATGAGGGGACGCATGAGGGAGAAATTGCAAGCAGCGAGGTCCAAAGCAGAAAGTGCATTGCTGCAGGAAATCCCCACTCCTCGGCCCAGACGCTTACGAAGTCCCAGTAAGAAAGAATTGGAGACTGAATTTGGCACAGAGCCAGGGAAAGAGGTAGAAAGGACTCAACAAGAAGTTGACTCCCAAAGTTACTCAAGAGTCAAGTTCCATGATTCTGCACGAAAAATCAAGCCTAAACCCCAGGTTCCACCTGGCTTCCCTTCTGCAGAAGAGGCCTATAACTTCTTTACTTTCAACTTTGATCCCGAACCAGAAGGATCAGAGGAAAAACCAAAAGCAAGACATAGAGCGGGAACTAATCAAGAGGAGGAGGAAGGGGAAGAAGAAGAACCACCTGCACAAGGAGGAGGAAAGGAAATGGATGAGGAAGAACTGCTTAATGGTGATGATGCCGAGGACTTCCTATTGGGCTTAGATCACGTGGCTGACGATTTTGTAGCAGTCAGACCTGCAGATTATGAAAGCATCCATGATCGGCTGCAGATGGAAAGAGAAATGCTCTTCATACCCAGTAGGCAGACAGTCCCTACATATAAAAAGCTTCCTGAGAATGTACAGCCCAGGTTCCTGGAAGATGAAGGCCTTTACACCGGGGTAAGACCAGAGGTGGCACGCACCAATCAGAACATCATGGAGAACAGATTGCTGATGCAGGACCCCGAAAGAAGATGGTTTGGAGATGACGGCAGGATCCTAGCTCTGCCAAACCCCATCAAGCCATTTCCTTCAAGGCCGCCAGTACTAACACAGGAGCAGAGCATTAAGGCAGAGCTTGAAACACTGTATAAAAAGGCTGTAAAATACGTTCACAGTAGTCAGCATGTGATCAGATCTGGAGACCCTCCTGGAAATTTCCAACTGGACATTGATATTTCAGGGTTAATCTTCACTCATCATCCCTGTTTTAGCCGAGAGCATGTTTTGGCAGCCAAGCTGGCCCAGTTATATGACCAGTACCTTGCAAGACACCAGAGAAACAAGGCGAAATTTCTTACTGATAAGCTCCAAGCTTTAAGAAATGCTGTTCAGACTGGCCTTGATCCAGAAAAACCTCATCAGTCTCTCGATACCATCCAAAAAACCATCAATGAGTATAAATCTGAAATTCGACAAACAAGAAAATTCCGTGATGCTGAACAAGAAAAAGATAGAACATTGCTTAAGACTATCATAAAAGTTTGGAAAGAGATGAAATCCCTTCGAGAGTTCCAGAGATTTACAAATACTCCCTTGAAACTTGTTTTGAGAAAGGAAAAAGCTGACCAGAAAGCAGATGAAGAAGCATATGAAGCAGAAATTCAAGCTGAAATAAGTGAACTGTTAGAAGAGCACACGGAGGAGTACGCACAGAAGATGGAAGAATACAGAACGTCGTTACAACAGTGGAAGGCCTGGAGGAAAGTGCAAAGGGCCAAGAAGAAGAAAAGGAAACAAGCAGCAGAAGAACATCCCGGTGATGAGATTGCAGAGCCGTATCCCGAGGAGGACCTTGTGAAGCCCAGCCCTCCAGAGCCCACTGATCGGGCAGTGATAGAGCAGGAGGTGAGGGAGAGAGCAGCCCAGAGCAGGAGGAGGCCTTGGGAGCCCACGCTGGTCCCGGAGCTAAGCCTGGCAGGAAGCGTAACACCCAATGACCAGTGCCCCAGAGCGGAGGTCTCGAGAAGGGAGGATGTAAAGAAGCGCTCAGTGTACTTAAAAGTGCTGTTCAACAACAAGGAGGTGTCCAGGACAGTCAGTCGGCCACTAGGAGCAGACTTCCGAGTTCACTTTGGGCAGATTTTCAATTTGCAAATAGTCAACTGGCCGGAGAGTTTAACACTTCAGGTCTATGAAACTGTCGGACACAGTAGTCCCACCTTGCTAGCAGAAGTGTTTCTGCCTATTCCTGAGACTACTGTTGTCACTGGAAGGGCTCCTACTGAAGAAGTGGAGTTTAGCAGTAATCAGCATGTGACACTGGACCACGAGGGAGTTGGAAGTGGAGTGCCCTTCTCATTTGAAGCTGATGGCAGTAACCAGCTGACTCTGATGACCTCAGGGAAAGTGTCTCATAGTGTGGCATGGGCCATTGGAGAAAACGGGATACCTTTAATTCCTCCATTGTCACAGCAGAACATCGGATTTCGGAGTGCTTTGAAGAAAGCAGATGCCATCTCATCTATTGGCACATCAGGACTGACAGACATGAAAAAATTGGCCAAGTGGGCAGCAGAGTCCAAGCTCGACCCAAATGACCCCAACAATGCCCCTTTGATGCAGCTTATCTCGGTTGCTACCAGTGGTGAATCCTATGTCCCTGATTTCTTTAGACTGGAGCAGCTGCAACAGGAGTTTAACTTTGTTTCAGATCAAGAATTAAATAGATCCAAACGATTTAGGCTTCTTCATCTTAGAAGCCAAGAGGTGCCAGAATTCCGAAATTATAAGCAAGTTCCAGTCTATGACCGAGAAATTATGGAAAAGGTATTCCAGGACTATGAGAAACGGTTACGAGACAGAAATGTAATAGAAACCAAGGAACACATAGACACCCATAGGGCCATAGTAGCCAAGTACCTCCAGCAGGTTAGAGAATCAGTGATAAATCGTTTCTTAATTGCAAAACAATATTTTCTTCTTGCTGATATGATAGTAGAAGAAGAAGTTCCCAATATCAGCATTTTGGGCCTAAGCCTTTTCAAGCTGGCAGAACAAAAGCGACCACTGCGGCCAAGGAGAAAAGGTCGGAAGAAGGTGACAGCCCAAAACCTGTCTGATGGAGACATAAAGCTGCTGGTGAACATTGTGCGAGCTTACGACATTCCAGTGAGGAAGCCGGCAGTGAGCAAATTCCAGCAGCCGTCGAGGTCTTCAAGGATGTTCAGTGAAAAGCATGCTGCTTCCCCAAGCACGTACAGCCCAACCCACAATGCTGACTACCCCCTCGGCCAGGTTTTAGTACGTCCCTTTGTAGAAGTCTCTTTTCAACGAACAGTTTGCCATACGACTACGGCTGAAGGACCAAACCCTAGCTGGAATGAAGAACTAGAACTTCCATTTAGGGCTCCTAATGGAGATTATAGCACAGCCAGTCTGCAGTCAGTGAAAGATGTTGTGTTCATTAACATTTTTGATGAAGTACTGCATGATGTCTTAGAGGATGACCGTGAAAGAGGAAGTGGAATCCATACTCGTATTGAGAGACACTGGCTGGGATGTGTGAAAATGCCATTTAGCACAATATATTTCCAAGCAAGGATTGATGGAACATTTAAAATAGATATTCCCCCAGTTCTTCTGGGCTACAGTAAGGAGCGAAATATGATTCTTGAGCGGGGTTTTGATTCTGTCCGAAGCTTAAGTGAAGGCTCCTACATTACCCTCTTTATTACCATTGAGCCCCAGCTGGTTCCTGGAGAGTCCATTCGAGAAAAGTTTGAGTCTCAGGAAGATGAGAAATTACTTCAAGCAACTGAGAAGTTTCAAGCTGAATGTGCCTTAAAGTTTCCAAATCGTCAGTGCCTTACAACAGTAATTGATATAAGCGGAAAAACTGTTTTTATCACACGTTATCTCAAACCTTTAAACCCTCCTCAGGAGCTCCTTAATGTCTACCCCAATAATCTACAGGCAACTGCAGAACTGGTGGCTCGATATGTGTCCTTGATTCCCTTCTTGCCTGACACTGTCTCATTTGGTGGTATCTGTGACCTCTGGAGCACATCTGATCAATTTCTTGATCTCCTGGCAGGGGATGAAGAAGAACATGCAGTACTATTGTGTAATTACTTTCTGTCTCTGGGTAAGAAGGCCTGGCTGTTGATGGGCAATGCTATTCCTGAGGGTCCAACTGCCTATGTGCTAACTTGGGAGCAAGGTCGTTATTTAATATGGAATCCCTGCAGTGGACATTTTTATGGACAATTTGATACATTCTGTCCCTTGAAAAATGTGGGCTGTTTAATAGGTCCTGACAATATTTGGTTTAATATTCAACGATATGAATCTCCACTAAGGATAAATTTTGATGTCACCAGGCCCAAGCTATGGAAATCTTTCTTTTCAAGAAGCCTTCCATATCCTGGCCTTTCCAGTGTTCAGCCTGAAGAGCTAATTTACCAGCGCTCAGACAAAGCAGCTGCAGCTGAGCTACAAGACAGGATTGAAAAAATACTAAAAGAAAAAATCATGGACTGGAGGCCACGCCATCTGACTCGGTGGAATAGGTATTGTACCTCTACTCTGCGTCACTTCTTGCCTCTGTTAGAAAAAAGTCAAGGAGAAGATGTAGAAGATGACCACAGAGCAGAACTGCTAAAACAGCTGGGAGACTACAGGTTCTCTGGATTTCCTCTTCACATGCCTTATTCTGAAGTGAAGCCTTTAATTGACGCTGTGTATAGTACTGGAGTACATAATATTGATGTTCCTAATGTTGAATTTGCTTTAGCTGTATACATACACCCATACCCCAAAAATGTTTTGTCTGTTTGGATCTATGTTGCCTCTCTTATACGCAACAGGTAA（SEQ ID NO：1），
The protein of its coding has aminoacid sequence as follows:
MNPREEKVKIITEEFIENDEDADMGRQNKNSKVRRQPRKKQPPTAVPKEMVSEKSHLGNPQEPVQEEPKTRLLSMTVRRGPRSLPPIPSTSRTGFAEFSMRGRMREKLQAARSKAESALLQEIPTPRPRRLRSPSKKELETEFGTEPGKEVERTQQEVDSQSYSRVKFHDSARKIKPKPQVPPGFPSAEEAYNFFTFNFDPEPEGSEEKPKARHRAGTNQEEEEGEEEEPPAQGGGKEMDEEELLNGDDAEDFLLGLDHVADDFVAVRPADYESIHDRLQMEREMLFIPSRQTVPTYKKLPENVQPRFLEDEGLYTGVRPEVARTNQNIMENRLLMQDPERRWFGDDGRILALPNPIKPFPSRPPVLTQEQSIKAELETLYKKAVKYVHSSQHVIRSGDPPGNFQLDIDISGLIFTHHPCFSREHVLAAKLAQLYDQYLARHQRNKAKFLTDKLQALRNAVQTGLDPEKPHQSLDTIQKTINEYKSEIRQTRKFRDAEQEKDRTLLKTIIKVWKEMKSLREFQRFTNTPLKLVLRKEKADQKADEEAYEAEIQAEISELLEEHTEEYAQKMEEYRTSLQQWKAWRKVQRAKKKKRKQAAEEHPGDEIAEPYPEEDLVKPSPPEPTDRAVIEQEVRERAAQSRRRPWEPTLVPELSLAGSVTPNDQCPRAEVSRREDVKKRSVYLKVLFNNKEVSRTVSRPLGADFRVHFGQIFNLQIVNWPESLTLQVYETVGHSSPTLLAEVFLPIPETTVVTGRAPTEEVEFSSNQHVTLDHEGVGSGVPFSFEADGSNQLTLMTSGKVSHSVAWAIGENGIPLIPPLSQQNIGFRSALKKADAISSIGTSGLTDMKKLAKWAAESKLDPNDPNNAPLMQLISVATSGESYVPDFFRLEQLQQEFNFVSDQELNRSKRFRLLHLRSQEVPEFRNYKQVPVYDREIMEKVFQDYEKRLRDRNVIETKEHIDTHRAIVAKYLQQVRESVINRFLIAKQYFLLADMIVEEEVPNISILGLSLFKLAEQKRPLRPRRKGRKKVTAQNLSDGDIKLLVNIVRAYDIPVRKPAVSKFQQPSRSSRMFSEKHAASPSTYSPTHNADYPLGQVLVRPFVEVSFQRTVCHTTTAEGPNPSWNEELELPFRAPNGDYSTASLQSVKDVVFINIFDEVLHDVLEDDRERGSGIHTRIERHWLGCVKMPFSTIYFQARIDGTFKIDIPPVLLGYSKERNMILERGFDSVRSLSEGSYITLFITIEPQLVPGESIREKFESQEDEKLLQATEKFQAECALKFPNRQCLTTVIDISGKTVFITRYLKPLNPPQELLNVYPNNLQATAELVARYVSLIPFLPDTVSFGGICDLWSTSDQFLDLLAGDEEEHAVLLCNYFLSLGKKAWLLMGNAIPEGPTAYVLTWEQGRYLIWNPCSGHFYGQFDTFCPLKNVGCLIGPDNIWFNIQRYESPLRINFDVTRPKLWKSFFSRSLPYPGLSSVQPEELIYQRSDKAAAAELQDRIEKILKEKIMDWRPRHLTRWNRYCTSTLRHFLPLLEKSQGEDVEDDHRAELLKQLGDYRFSGFPLHMPYSEVKPLIDAVYSTGVHNIDVPNVEFALAVYIHPYPKNVLSVWIYVASLIRNR（SEQ ID NO：2）。
The CC2D2A gene mutation body that contriver finds is compared with SEQ ID NO:1, and c.2999A>T CC2D2A gene tool of the present invention suddenlys change (this sudden change causes proteins encoded that p.Glu1000Val missense mutation occurs) or at least one of c.3688C>T sudden change (this sudden change causes proteins encoded that p.Arg1230X nonsense mutation occurs).Particularly, c.2999A>T sport the gene with respect to wild-type CC2D2A, the 2999th A of the cDNA of CC2D2A gene mutation body sports T, thus, causes the albumen of its coding that p.Glu1000Val missense mutation occurs.C.3688C>T suddenly change with respect to wild-type CC2D2A gene, the C of the 3688th of the cDNA of CC2D2A gene mutation body sports T.Thus, cause the albumen of its coding that p.Arg1230X nonsense mutation occurs.It should be noted that, in " p.Arg1230X ", X represents to stop translation.
Further, contriver's discovery, when there is p.Glu1000Val, p.Arg1230X sudden change in CC2D2A gene mutation body time simultaneously, the autosomal recessive inheritance type Joubert syndrome that detection of biological sample all suffers from.Whether the CC2D2A gene mutation body by detection with 2 mutational sites exists in biological sample, can predict accurately and effectively whether organism suffers from autosomal recessive inheritance type Joubert syndrome.
According to a second aspect of the invention, the present invention proposes a kind of isolated polypeptide.According to embodiments of the invention, compared with SEQ ID NO:2, this polypeptide has and is selected from least one following sudden change: p.Glu1000Val, p.Arg1230X.According to a particular embodiment of the invention, this polypeptide is by the nucleic acid encoding of the coding CC2D2A gene mutation body of aforementioned separation.By whether expressing this polypeptide in detection of biological sample, whether susceptible Joubert syndrome of detection of biological sample effectively, also can in organism, whether exist by detecting these polypeptide, can effectively predict whether susceptible Joubert syndrome of organism.
The method of the syndromic biological sample of Joubert is easily suffered from screening
According to a third aspect of the present invention, the present invention proposes a kind of method of screening the syndromic biological sample of easy trouble Joubert.According to embodiments of the invention, the method that the syndromic biological sample of Joubert is easily suffered from this screening can comprise the following steps:
First, from described extraction from biological material sample of nucleic acid.According to embodiments of the invention, the type of biological sample is also not particularly limited, and reflects whether biological sample CC2D2A exists the sample of nucleic acid of sudden change as long as can extract from this biological sample.According to embodiments of the invention, biological sample can be for being selected from blood of human body.Thus, can sample easily and detect, thereby can further improve the efficiency that the syndromic biological sample of Joubert is easily suffered from screening.According to embodiments of the invention, here the term " sample of nucleic acid " that used should be interpreted broadly, it can be anyly can reflect whether CC2D2A in biological sample exists the sample of sudden change, it can be for example the complete genome DNA directly extracting from biological sample, also can be a part that comprises CC2D2A encoding sequence in this full genome, can be the total RNA extracting from biological sample, can be also the mRNA extracting from biological sample.According to one embodiment of present invention, described sample of nucleic acid is complete genome DNA.Thus, can expand the source range that comes of biological sample, and can determine the much information of biological sample simultaneously, thereby can improve the efficiency that the syndromic biological sample of Joubert is easily suffered from screening.In addition, according to embodiments of the invention, for adopting RNA as sample of nucleic acid, may further include from extraction from biological material sample of nucleic acid: from extraction from biological material RNA sample, preferably RNA sample is mRNA; And RNA sample based on obtained, by reverse transcription reaction, obtain cDNA sample, the cDNA composition of sample sample of nucleic acid obtaining.Thus, can further improve and utilize RNA easily to suffer from the efficiency of the syndromic biological sample of Joubert as sample of nucleic acid screening.
Next, after obtaining sample of nucleic acid, can analyze sample of nucleic acid, thereby can determine the nucleotide sequence of obtained sample of nucleic acid.According to embodiments of the invention, the method and apparatus of the nucleotide sequence of definite sample of nucleic acid that obtains is also not particularly limited.According to a particular embodiment of the invention, can pass through sequence measurement, the nucleotide sequence of definite kernel acid sample.According to embodiments of the invention, can and be not particularly limited for the method and apparatus that checks order.According to embodiments of the invention, can adopt s-generation sequencing technologies, also can adopt the third generation and the 4th generation or more advanced sequencing technologies.According to concrete example of the present invention, can utilize be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device nucleotide sequence is checked order.Thus, in conjunction with up-to-date sequencing technologies, can reach the higher order-checking degree of depth for Single locus, detection sensitivity and accuracy improve greatly, thereby can utilize the high-throughput of these sequencing devices, the feature of degree of depth order-checking, further improve sample of nucleic acid is detected to the efficiency of analyzing.Thereby, can improve follow-up accuracy and accuracy when sequencing data is analyzed.Thus, according to embodiments of the invention, the nucleotide sequence of definite kernel acid sample may further include: first, for obtained sample of nucleic acid, build nucleic acid sequencing library; And checked order in obtained nucleic acid sequencing library, to obtain the sequencing result being formed by multiple sequencing datas.According to some embodiments of the present invention, can adopt be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device checked order in obtained nucleic acid sequencing library.In addition, according to embodiments of the invention, can screen sample of nucleic acid, enrichment CC2D2A exon, this screening enrichment can, before building sequencing library, build in sequencing library process, or carries out after building sequencing library.According to one embodiment of present invention, for sample of nucleic acid, build nucleic acid sequencing library and further comprise: utilize CC2D2A gene extron Auele Specific Primer, sample of nucleic acid is carried out to pcr amplification; And for obtained amplified production, build nucleic acid sequencing library.Thus, can pass through pcr amplification, enrichment CC2D2A gene extron, thus can further improve the efficiency of screening the syndromic biological sample of susceptible Joubert.According to embodiments of the invention, the sequence of CC2D2A gene extron Auele Specific Primer is not particularly limited, according to a preferred embodiment of the invention, these CC2D2A gene extron Auele Specific Primers have nucleotide sequence as shown in the table, i.e. nucleotide sequence shown in SEQ ID NO:3-6.Contriver is surprised to find, by adopting these primers, can in PCR reaction system, significantly effectively complete to CC2D2A exon especially c.2999A>T the amplification of the exon sequence at the place that c.3688C>T suddenlys change.It should be noted that, the nucleotide sequence shown in these SEQ ID NO:3-6 is that the present inventor is paying after arduous labor, unexpected acquisition.
According to a particular embodiment of the invention, above-mentioned Joubert syndrome is autosomal recessive disease.
About for sample of nucleic acid; build method and the flow process of sequencing library; those skilled in the art can suitably select according to different sequencing technologies; about the details of flow process; can be referring to manufacturer's code that for example Illumina company provides of order-checking instrument, for example, referring to the Multiplexing Sample Preparation Guide(Part#1005361 of Illumina company; Or Paired-End SamplePrep Guide(Part#1005063 Feb2010); Feb2010), be incorporated to herein by reference.According to embodiments of the invention, from the method and apparatus of extraction from biological material sample of nucleic acid, be also not particularly limited, can adopt commercial nucleic acid extraction kit to carry out.
It should be noted that, broad understanding should be made in the term " nucleotide sequence " that here used, it can be after the sequencing data that obtains that sample of nucleic acid is checked order is assembled, the complete nucleic acid sequence information obtaining, also can be directly to adopt by obtained sequencing data (reads) that sample of nucleic acid is checked order as nucleotide sequence, as long as the encoding sequence that contains corresponding CC2D2A gene in these nucleotide sequences.
Finally, after the nucleotide sequence of definite kernel acid sample, the sequence of the nucleotide sequence of obtained sample of nucleic acid and SEQ ID NO:1 is compared.If had c.2999A>T in obtained nucleotide sequence, c.3688C>T sudden change, indicator organism sample is easily suffered from Joubert syndrome.Thus, by easily suffer from the method for the syndromic biological sample of Joubert according to the screening of the embodiment of the present invention, can effectively screen the syndromic biological sample of easy trouble Joubert.According to embodiments of the invention, the method and apparatus that nucleotide sequence and SEQ ID NO:1 are compared is also not particularly limited, and can adopt the software of any conventional to operate, and according to specific examples of the present invention, can adopt SOAP software to compare.
It should be noted that, be not particularly limited according to the purposes of " method of the syndromic biological sample of Joubert is easily suffered from screening " of the embodiment of the present invention, for example can be as the screening method of non-diagnostic purpose.
System and the test kit of the syndromic biological sample of Joubert easily suffered from screening
According to a fourth aspect of the present invention, the present invention proposes a kind of system of screening the syndromic biological sample of easy trouble Joubert.
With reference to figure 1, according to embodiments of the invention, the system 1000 that the syndromic biological sample of Joubert is easily suffered from this screening comprises nucleic acid-extracting apparatus 100, nucleotide sequence determining device 200 and judgment means 300.
According to embodiments of the invention, nucleic acid-extracting apparatus 100 is for from extraction from biological material sample of nucleic acid.As previously mentioned, according to embodiments of the invention, the type of sample of nucleic acid is also not particularly limited, and for adopting RNA as sample of nucleic acid, nucleic acid-extracting apparatus further comprises RNA extraction unit 101 and reverse transcription unit 102, wherein, extraction unit 101 is for from extraction from biological material RNA sample, and reverse transcription unit 102 is connected with RNA extraction unit 101, for RNA sample is carried out to reverse transcription reaction, to obtain cDNA sample, the cDNA composition of sample sample of nucleic acid obtaining.
According to embodiments of the invention, nucleotide sequence determining device 200 is connected with nucleic acid-extracting apparatus 100, for sample of nucleic acid is analyzed, so that the nucleotide sequence of definite kernel acid sample.As previously shown, can adopt the nucleotide sequence of the method definite kernel acid sample of order-checking.Thus, according to one embodiment of present invention, described nucleotide sequence determining device 200 may further include: library construction unit 201 and order-checking unit 202.Library construction unit 201, for for sample of nucleic acid, builds nucleic acid sequencing library; Order-checking unit 202 is connected with library construction unit 201, for being checked order in nucleic acid sequencing library, to obtain the sequencing result being made up of multiple sequencing datas.As previously mentioned, can pass through pcr amplification, enrichment CC2D2A exon, further improves the efficiency that the syndromic biological sample of Joubert is easily suffered from screening.Thus, library construction unit 201 may further include pcr amplification module (not shown), in this pcr amplification module, be provided with CC2D2A exon Auele Specific Primer, to utilize CC2D2A exon Auele Specific Primer, described sample of nucleic acid is carried out to pcr amplification, according to a particular embodiment of the invention, CC2D2A gene extron Auele Specific Primer has the nucleotide sequence as shown in SEQ ID NO:3-6.According to embodiments of the invention, order-checking unit 202 can comprise and is selected from HISEQ2000, SOLiD, 454 and at least one of single-molecule sequencing device.Thus, in conjunction with up-to-date sequencing technologies, can reach the higher order-checking degree of depth for Single locus, detection sensitivity and accuracy improve greatly, thereby can utilize the high-throughput of these sequencing devices, the feature of degree of depth order-checking, further improve sample of nucleic acid is detected to the efficiency of analyzing.Thereby, improve follow-up accuracy and accuracy when sequencing data is analyzed.
According to embodiments of the invention, judgment means 300 is connected with nucleotide sequence determining device 200, be suitable for the nucleotide sequence of sample of nucleic acid to compare, so that the difference of the nucleotide sequence based on sample of nucleic acid and SEQ ID NO:1 judges whether biological sample easily suffers from Joubert syndrome.Particularly, whether the nucleotide sequence based on sample of nucleic acid, compared with SEQ ID NO:1, has at least one sudden change c.2999A>T, c.3688C>T, judges whether biological sample easily suffers from Joubert syndrome.As previously mentioned, according to one embodiment of present invention, the nucleotide sequence of sample of nucleic acid, compared with SEQ ID NO:1, has at least one sudden change c.2999A>T, c.3688C>T, is that biological sample is easily suffered from the syndromic instruction of Joubert.As previously mentioned, according to embodiments of the invention, the equipment that nucleotide sequence and SEQ ID NO:1 are compared is also not particularly limited, and can adopt the software of any conventional to operate, and according to specific examples of the present invention, can adopt SOAP software to compare.
Thus, utilize this system, can effectively implement the method that the syndromic biological sample of Joubert is easily suffered from aforementioned screening, thereby can effectively screen the syndromic biological sample of easy trouble Joubert.
According to a fifth aspect of the invention, the present invention proposes a kind of for screening the test kit of the syndromic biological sample of easy trouble Joubert.According to embodiments of the invention, this test kit that is used for screening the syndromic biological sample of easy trouble Joubert comprises: the reagent that is suitable for detecting CC2D2A gene mutation body, wherein, compared with SEQ ID NO:1, this CC2D2A gene mutation body has at least one sudden change c.2999A>T, c.3688C>T.Utilize test kit according to an embodiment of the invention, can effectively screen the syndromic biological sample of easy trouble Joubert.In this article, the term using " is suitable for detecting the reagent of CC2D2A gene mutation body " and should be interpreted broadly, can be the reagent that detects CC2D2A encoding gene, can be also the reagent that detects CC2D2A mutant polypeptide, for example, can adopt the antibody in identification specificity site.According to one embodiment of present invention, described reagent is nucleic acid probe, thus, can screen efficiently the syndromic biological sample of easy trouble Joubert.According to a particular embodiment of the invention, above-mentioned Joubert syndrome is autosomal recessive disease.
It should be noted that, easily suffer from the feature and advantage described in the method part of the syndromic biological sample of Joubert in screening herein above, be equally applicable to screen system or the test kit of the syndromic biological sample of easy trouble Joubert, do not repeat them here.
Construct and reconstitution cell
According to a sixth aspect of the invention, the invention allows for a kind of construct.According to embodiments of the invention, the nucleic acid of the coding CC2D2A gene mutation body that this construct comprises foregoing separation.It should be noted that, " nucleic acid of the coding ATM gene mutation body that construct comprises foregoing separation " represents, construct of the present invention comprises the nucleotide sequence compared with SEQ ID NO:1 with the CC2D2A gene mutation body c.2999A>T suddenling change, or comprise and there is the c.3688C>T nucleotide sequence of the CC2D2A gene mutation body of sudden change compared with SEQ ID NO:1, or comprise the nucleotide sequence of above-mentioned two kinds of CC2D2A gene mutation bodies simultaneously.Thus, utilize the reconstitution cell of construct transformed acceptor cell acquisition of the present invention, can effectively be used as the model of Joubert syndrome correlative study.Wherein, the kind of described recipient cell is not particularly limited, for example, can be Bacillus coli cells, mammalian cell, and preferably this receptor cell derived is in Mammals.
The term " construct " that used in the present invention refers to so a kind of Genetic carrier, and it comprises specific nucleic acid sequence, and object nucleotide sequence can be proceeded in host cell, to obtain reconstitution cell.According to embodiments of the invention, the form of construct is not particularly limited.According to embodiments of the invention, it can be plasmid, phage, artificial chromosome, clay (Cosmid), virus at least one, preferred plasmid.Plasmid is as Genetic carrier, has simple to operately, can carry the character compared with large fragment, convenient operation and processing.The form of plasmid is also not particularly limited, and can be both circular plasmids, can be also linear plasmid, can be strand, can be also double-stranded.Those skilled in the art can select as required.The term " nucleic acid " that used in the present invention can be any polymkeric substance that comprises deoxyribonucleotide or ribonucleotide, includes but not limited to that its length is not subject to any special restriction through that modify or not modified DNA, RNA.For the construct for building reconstitution cell, preferred described nucleic acid is DNA, because DNA is for RNA, it is more stable, and easy handling.
According to a seventh aspect of the invention, the invention allows for a kind of reconstitution cell.According to embodiments of the invention, this reconstitution cell obtains by foregoing construct transformed acceptor cell.Thereby reconstitution cell of the present invention can the entrained CC2D2A gene mutation body of effective expression construct.According to some embodiments of the present invention, reconstitution cell of the present invention, can be effectively as the model of Joubert syndrome correlative study.According to embodiments of the invention, the kind of recipient cell is not particularly limited, for example, can be Bacillus coli cells, mammalian cell, and preferred described recipient cell derives from non-human mammal.
For nucleic acid described in the present invention, it will be appreciated by those skilled in the art that actual any of comprising complementary two strands, or two.For convenient, in an embodiment of the present invention, although in most cases only provided a chain, another chain of complementation with it is in fact also disclosed.For example, mention SEQ ID NO:1, actual its complementary sequence that comprises.Those skilled in the art are further appreciated that and utilize a chain can detect another chain, and vice versa.
Below with reference to specific embodiment, the present invention will be described, it should be noted that, these embodiment are only illustrative, and can not be interpreted as limitation of the present invention.If do not specialize, the conventional means that the technique means adopting in embodiment is well known to those skilled in the art, can carry out with reference to " molecular cloning experiment guide " third edition or related products, and the reagent adopting and product are also and can business obtain.Various processes and the method do not described in detail are ordinary methods as known in the art, source, the trade(brand)name of agents useful for same and be necessary to list its moiety person, all in the time occurring first, indicate, identical reagent used is if no special instructions, all identical with the content of indicating first thereafter.
Embodiment 1 determines the syndromic Disease-causing gene of Joubert
1, sample collection:
Contriver collects the Chinese Joubert syndrome patient family in 2 generations, and the gene of 500 normal peoples outside this family.Fig. 2 has shown the family collection of illustrative plates of this Joubert syndrome patient family.As shown in Figure 2, wherein, represents normal male, and zero represents normal female, and ■ represents male patient.As shown in Figure 2, this Joubert syndrome patient family has 3 members, and wherein s-generation son is Joubert syndrome patient, and the father and mother of the first-generation are normal member.
This patient is 0.5 years old boy baby, the backwardness of growing, and external strabismus, eye distance is wide, and right eyelid is sagging, and double eyeball level is trembled, and head nucleus magnetic resonance picture is found " grind one's teeth in sleep and levy " (see figure 3).We have gathered this patient's peripheral blood and have extracted genomic dna.
2, chip design, library construction and high-flux sequence
Contriver checks order to this patient's target area in conjunction with Solexa Hiseq2000 high throughput sequencing technologies with the chip (NimblGen, Roche) of catching of customization, specific as follows:
1) having designed an intron sequences of catching exon, splice site and the vicinity of chip (NimblGen, Roche) to 10 genes catches.
2) genomic dna is broken at random to the fragment about 150-200bp, connects respectively top connection at fragment two ends subsequently, preparation library (referring to
http:// www.illumina.com/the Illumina/Solexa standard providing is built storehouse specification sheets).
3) enrichment is hybridized through linear amplification and the custom capture array of ligation-mediated PCR (LM-PCR) after purified in library, then after the linear amplification of LM-PCR, carries out upper machine order-checking.Order-checking platform is Illumina Hiseq2000, and reading length is 90bp.
3, variation detect, annotation and with database comparison
1) raw data obtaining after order-checking is processed by Illumina basecalling Software1.7.Then filter inferior quality reads and comprise joint and pollute reads.Use BWA that high quality reads is compared with reference to genome, obtain the unique comparison reads comparing on genome.Then utilize SOAPsnp and GATK to carry out respectively the detection of SNP and indel.
2) for the SNP detecting and indel variation, we utilize inner flow process to annotate, i.e. definitive variation genome environment of living in, and the type of variation.We pay close attention to nonsynonymous mutation, and insert the sudden change of acceptor splicing site/donor site and coding region and this three class of deletion mutantion is most possible and the sudden change of disease-related.We compare the public databases such as the variation detecting and dbSNP database, thousand human genome databases, HapMap database, HGMD and LSMD.We have selected the variation comprising in HGMD and LSMD database and have been positioned at coding region and the variation of previously not reporting in splice site district, then compare with our internal contrast database.For the candidate's pathogenic mutation being positioned on disease known, we have carried out sanger checking.
By above-mentioned analysis, on this patient's CC2D2A gene, find a complex mutation c.2999A>T, c.3688C>T, wherein c.2999A>T patient's father carries heterozygous mutant, c.3688C>T mother of patient carries heterozygous mutant, and our result shows that two heterozygous mutants of CC2D2A gene have caused the afunction of gene with the form of compound heterozygosis.
Thus, two heterozygous mutants in CC2D2A gene of the present invention, can be for the syndromic diagnosis and detection of Joubert.
The syndromic Disease-causing gene of embodiment 2 Sanger method sequence verification Joubert
Gather the peripheral blood of three members in pedigree chart 2, utilize QIAmp Blood kit (Qiagen, Hilden, Germany) genomic dna in extracting peripheral blood leucocyte, utilize Qubit Fluorometer and agarose gel electrophoresis to measure concentration and the purity of DNA, each sample genomic dna OD260/OD280 of gained is all between 1.7-2.0, and concentration is no less than 50ng/ul, and total amount is no less than 3 μ g.
Respectively to patient (II in Fig. 2: 1), normal people in 2 familys (I in Fig. 2: 1, I: 2) and 500 outer normal people's genes of familys detect, for this place, CC2D2A gene compound heterozygous mutations site primers, pass through pcr amplification, product purification, the method of order-checking obtains relevant sequence, belong to saltant type or wild-type according to sequencing result, and whether sudden change is in family and is divided into from verifying dependency with phenotype.Concrete grammar step is as follows:
1) DNA extraction:
Take respectively father and mother and outer 500 the normal people's peripheric venous bloods of family of patient, patient in family to extract genomic dna, measure DNA content and purity according to the method for embodiment 1.
2) design of primers and PCR reaction
Design of primers reference men and women's genoid data unit sequence storehouse hg19/build37.1, under specifically seeing.
A) primer sequence
B) reaction system:
LA Taq enzyme PCR reaction system
| Reagent | Volume |
| 2×GC Buffer Ⅰ | 5.0μl |
| dNTPs(10mM) | 0.4μl |
| (5U/ μ l) for LA Taq enzyme | 0.1μl |
| Primers(100ng/μl) | 0.2 μ l/ |
| (50ng/ μ l) for gDNA template | 1.0μl |
| ddH2O Add to | 10.0μl |
C) reaction conditions:
3) by step 2) in obtain pcr amplification product carry out purifying with QIAquick pcr amplification test kit (Qiagen), then utilize the 3730xl of ABI to carry out DNA sequencing (Fig. 4).
In patient family member to CC2D2A gene mutation site place encoding sequence and the flanking sequence investigation of suddenling change, c.2999A>T patient II:1 has, c.3688C>T compound heterozygous mutations, I:1, I:2 are carrier, and I:1 only has c.2999A>T sudden change; I:2 only has c.3688C>T(in table 1 and Fig. 4).
Table 1
New compound heterozygous mutations in CC2D2A gene of the present invention: c.2999A>T (this sudden change causes proteins encoded that p.Glu1000Val missense mutation occurs), c.3688C>T (this sudden change causes proteins encoded that p.Arg1230X nonsense mutation occurs), can judge the ill possibility of crowd of not falling ill in this family, can be used for the appraisement and diagnosis of the ill probability of the offspring of family simultaneously, avoid carrying next generation's birth of this sudden change for patient and family provide genetic counseling and antenatal diagnosis.
Studies confirm that CC2D2A transgenation can cause autosomal dominant and recessive Joubert syndrome.Our research shows: the c.2999A>T and c.3688C>T compound heterozygous mutations of CC2D2A gene has caused the afunction of gene, shows as genetic Joubert syndrome.
The invention discloses two kinds of new mutants of CC2D2A gene, confirmed that first it,, for recessive hereditary, carries out the examination in this site in 500 routine Chinese normal good hearing crowds, all negative.The mutation spectrum of CC2D2A gene has been enriched in this research, provides genetics foundation for carrying out the syndromic diagnosis of heredity Joubert.
Embodiment 3 detection kit
Preparation detection kit, the primer pair c.2999A>T and c.3688C>T that wherein contains detection sudden change sees the following form:
Extract person DNA to be measured according to the method described in embodiment 1, react as template and above-mentioned primer carry out PCR taking the DNA being extracted,, to PCR product purification the product of purifying is checked order according to this area ordinary method.C.2999A>T whether the sequence that observing checks order obtains have and c.3688C>T sudden change.
In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " example ", " concrete example " or " some examples " etc. means to be contained at least one embodiment of the present invention or example in conjunction with specific features, structure, material or the feature of this embodiment or example description.In this manual, the schematic statement of above-mentioned term is not necessarily referred to identical embodiment or example.And specific features, structure, material or the feature of description can be with suitable mode combination in any one or more embodiment or example.
Although illustrated and described embodiments of the invention above, be understandable that, above-described embodiment is exemplary, can not be interpreted as limitation of the present invention, those of ordinary skill in the art can change above-described embodiment within the scope of the invention in the situation that not departing from principle of the present invention and aim, amendment, replacement and modification.
Claims (11)
1. a nucleic acid for the coding CC2D2A gene mutation body of separation, is characterized in that, compared with SEQ ID NO:1, described nucleic acid has and is selected from least one following sudden change: c.2999A>T, and c.3688C>T.
2. an isolated polypeptide, is characterized in that, compared with SEQ ID NO:2, described isolated polypeptide has and is selected from least one following sudden change: p.Glu1000Val, p.Arg1230X,
Optionally, described polypeptide is by nucleic acid encoding claimed in claim 1.
3. a method for the syndromic biological sample of Joubert is easily suffered from screening, it is characterized in that, comprises the following steps:
From described extraction from biological material sample of nucleic acid;
Determine the nucleotide sequence of described sample of nucleic acid;
The nucleotide sequence of described sample of nucleic acid, compared with SEQ ID NO:1, has and is selected from c.2999A>T, and at least one sudden change is c.3688C>T that described biological sample is easily suffered from the syndromic instruction of Joubert,
Optionally, described biological sample is for being selected from blood of human body,
Optionally, described sample of nucleic acid is complete genome DNA,
Optionally, described Joubert syndrome is autosomal recessive disease.
4. method according to claim 3, is characterized in that, further comprises from described extraction from biological material sample of nucleic acid:
From described extraction from biological material RNA sample, preferred described RNA sample is mRNA; And
Based on described RNA sample, by reverse transcription reaction, obtain cDNA sample, sample of nucleic acid described in described cDNA composition of sample.
5. method according to claim 3, is characterized in that, determines that the nucleotide sequence of described sample of nucleic acid further comprises:
For described sample of nucleic acid, build nucleic acid sequencing library; And
Checked order in described nucleic acid sequencing library, to obtain the sequencing result that formed by multiple sequencing datas, optionally, adopt be selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device checked order in described nucleic acid sequencing library,
Optionally, for described sample of nucleic acid, build nucleic acid sequencing library and further comprise:
Utilize CC2D2A gene extron Auele Specific Primer, described sample of nucleic acid is carried out to pcr amplification; And
For obtained amplified production, build described nucleic acid sequencing library,
Optionally, described CC2D2A gene extron Auele Specific Primer has the nucleotide sequence as shown in SEQ ID NO:3-6.
6. a system for the syndromic biological sample of Joubert is easily suffered from screening, it is characterized in that, comprising:
Nucleic acid-extracting apparatus, described nucleic acid-extracting apparatus is used for from described extraction from biological material sample of nucleic acid;
Nucleotide sequence determining device, described nucleotide sequence determining device is connected with described nucleic acid-extracting apparatus, for described sample of nucleic acid is analyzed, to determine the nucleotide sequence of described sample of nucleic acid;
Judgment means, described judgment means is connected with described nucleotide sequence determining device, so that the nucleotide sequence based on described sample of nucleic acid is compared with SEQ ID NO:1, whether have c.2999A>T, c.3688C>T at least one sudden change, judges whether described biological sample easily suffers from Joubert syndrome;
Optionally, described Joubert syndrome is autosomal recessive disease.
7. system according to claim 6, is characterized in that, described nucleic acid-extracting apparatus further comprises:
RNA extraction unit, described RNA extraction unit is used for from described extraction from biological material RNA sample; And
Reverse transcription unit, described reverse transcription unit is connected with described RNA extraction unit, for described RNA sample is carried out to reverse transcription reaction, to obtain cDNA sample, sample of nucleic acid described in described cDNA composition of sample.
8. system according to claim 6, is characterized in that, described nucleotide sequence determining device further comprises:
Library construction unit, described library construction unit, for for described sample of nucleic acid, builds nucleic acid sequencing library; And
Order-checking unit, described order-checking unit is connected with described library construction unit, for being checked order in described nucleic acid sequencing library, to obtain the sequencing result being formed by multiple sequencing datas,
Optionally, described library construction unit further comprises:
Pcr amplification module, is provided with CC2D2A gene extron Auele Specific Primer in described pcr amplification module, to utilize described Auele Specific Primer, described sample of nucleic acid is carried out to pcr amplification,
Optionally, described Auele Specific Primer has the nucleotide sequence as shown in SEQ ID NO:3-6,
Optionally, described order-checking unit comprises and is selected from HISEQ2000, SOLiD, 454 and at least one of single-molecule sequencing device.
9. for screening a test kit for the syndromic biological sample of easy trouble Joubert, it is characterized in that, contain:
Be suitable for detecting the reagent of CC2D2A gene mutation body, wherein compared with SEQ ID NO:1, described CC2D2A gene mutation body has and is selected from least one following sudden change: c.2999A>T, and c.3688C>T,
Optionally, described reagent is nucleic acid probe or primer,
Optionally, described nucleic acid probe or primer have the nucleotide sequence as shown in SEQ ID NO:3-6,
Optionally, described Joubert syndrome is autosomal recessive disease.
10. a construct, is characterized in that, the nucleic acid of the coding CC2D2A gene mutation body that comprises separation claimed in claim 1.
11. 1 kinds of reconstitution cells, is characterized in that, described reconstitution cell obtains by construct transformed acceptor cell claimed in claim 10.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310184623.4A CN104164424A (en) | 2013-05-17 | 2013-05-17 | CC2D2A gene mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310184623.4A CN104164424A (en) | 2013-05-17 | 2013-05-17 | CC2D2A gene mutant and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104164424A true CN104164424A (en) | 2014-11-26 |
Family
ID=51908405
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310184623.4A Pending CN104164424A (en) | 2013-05-17 | 2013-05-17 | CC2D2A gene mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104164424A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779464A (en) * | 2014-12-26 | 2016-07-20 | 深圳华大基因研究院 | Nucleic acid and application of separated coding FHL1 mutant |
| CN105779460A (en) * | 2014-12-22 | 2016-07-20 | 深圳华大基因研究院 | Separated nucleic acid for encoding ACD mutants and applications thereof |
| CN108531580A (en) * | 2018-04-27 | 2018-09-14 | 国家卫生计生委科学技术研究所 | C5orf42 gene mutation bodies and its application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009043173A1 (en) * | 2007-10-05 | 2009-04-09 | Centre For Addiction And Mental Health | Cc2d2a gene mutations associated with joubert syndrome and diagnostic methods for identifying the same |
-
2013
- 2013-05-17 CN CN201310184623.4A patent/CN104164424A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009043173A1 (en) * | 2007-10-05 | 2009-04-09 | Centre For Addiction And Mental Health | Cc2d2a gene mutations associated with joubert syndrome and diagnostic methods for identifying the same |
Non-Patent Citations (2)
| Title |
|---|
| GISELE E ISHAK，ET AL: "Genotype-phenotype correlation in CC2D2Arelated Joubert syndrome reveals an association with ventriculomegaly and seizures", 《J MED GENET》 * |
| 陈曦 等: "Joubert 综合征及相关疾病的产前及产后影像学研究", 《中华医学超声杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779460A (en) * | 2014-12-22 | 2016-07-20 | 深圳华大基因研究院 | Separated nucleic acid for encoding ACD mutants and applications thereof |
| CN105779464A (en) * | 2014-12-26 | 2016-07-20 | 深圳华大基因研究院 | Nucleic acid and application of separated coding FHL1 mutant |
| CN105779464B (en) * | 2014-12-26 | 2019-06-14 | 深圳华大生命科学研究院 | The nucleic acid of the coding FHL1 mutant of separation and its application |
| CN108531580A (en) * | 2018-04-27 | 2018-09-14 | 国家卫生计生委科学技术研究所 | C5orf42 gene mutation bodies and its application |
| CN108531580B (en) * | 2018-04-27 | 2021-11-19 | 国家卫生计生委科学技术研究所 | C5orf42 gene mutant and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104120132A (en) | FBN1 genetic mutant and application thereof | |
| CN106282195A (en) | Gene mutant and application thereof | |
| CN103374575B (en) | CYP4V2 gene mutant and application thereof | |
| CN103571847A (en) | FOXC1 gene mutant and its application | |
| CN105441454B (en) | SCAP gene mutation body and its application | |
| CN112226440B (en) | Pathogenic mutation of hereditary primary infertility and detection reagent thereof | |
| CN104073499B (en) | TMC1 gene mutation body and its application | |
| CN104164424A (en) | CC2D2A gene mutant and application thereof | |
| CN104745592B (en) | CYP4V2 gene mutant and application thereof | |
| CN104178487B (en) | ATM gene mutant and application thereof | |
| CN103275987B (en) | AQP5 gene mutant and application thereof | |
| CN105838720B (en) | PTPRQ gene mutation body and its application | |
| CN104099338B (en) | MYO15A gene mutation body and its application | |
| CN109943569B (en) | Isolated nucleic acid encoding IFNLR1 mutant and application thereof | |
| CN107760688A (en) | A kind of BRCA2 gene mutation bodies and its application | |
| CN104745594B (en) | CYP4V2 gene mutation body and its application | |
| KR102481211B1 (en) | SNP marker for chronic sensorineural tinnitus diagnosis and diagnosis method using the same | |
| CN104232650A (en) | New pathogenic gene of idiopathic basal ganglia calcification, and coding protein and application thereof | |
| CN110878346B (en) | Gene mutant and application thereof | |
| CN103627710B (en) | SPG11 gene mutation body and application thereof | |
| CN104789572A (en) | GPRASP2 mutant type gene as well as identification method and detection kit thereof | |
| CN103571846A (en) | ATP6V1B2 gene mutant and application thereof | |
| CN104745591A (en) | CYP4V2 gene mutant and application thereof | |
| CN104774840A (en) | Gene mutant and applications thereof | |
| CN103509801A (en) | Skeletal muscle chloride ion channel gene mutant and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: SHENZHEN BGI CORPORATION Free format text: FORMER OWNER: BGI-SHENZHEN CO., LTD. Effective date: 20150819 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20150819 Address after: 410008 Hunan province Changsha Xiangya Road No. 87 Applicant after: XIANGYA HOSPITAL OF CENTRAL SOUTH University Applicant after: BGI SHENZHEN Co.,Ltd. Address before: 410008 Hunan province Changsha Xiangya Road No. 87 Applicant before: XIANGYA HOSPITAL OF CENTRAL SOUTH University Applicant before: BGI SHENZHEN Co.,Ltd. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141126 |