CN113684213A

CN113684213A - MYO15A gene mutant and application thereof

Info

Publication number: CN113684213A
Application number: CN202010418136.XA
Authority: CN
Inventors: 彭智宇; 孙宇; 向嘉乐; 陈森; 谢文; 李丹; 宋娜娜; 方星星
Original assignee: Tongji Medical College of Huazhong University of Science and Technology; BGI Shenzhen Co Ltd
Current assignee: Tongji Medical College of Huazhong University of Science and Technology; BGI Shenzhen Co Ltd; BGI Genomics Co Ltd; Union Hospital Tongji Medical College Huazhong University of Science and Technology
Priority date: 2020-05-18
Filing date: 2020-05-18
Publication date: 2021-11-23

Abstract

The invention provides a MYO15A gene mutant and application thereof. A genetic mutation is provided having a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation, as compared to the wild-type MYO15A gene. The gene mutation is detectable, and whether the biological sample suffers from non-syndromic deafness can be effectively detected by detecting whether the gene mutation exists in the biological sample. By detecting the gene mutation, the detection and the research of the hereditary hearing loss disease are expanded and perfected, and a new detection site, a new detection method and a new detection way are provided for the diagnosis or the treatment of the disease.

Description

MYO15A gene mutant and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a MYO15A gene mutant and application thereof.

Background

Deafness (HL) is the most common disease with sensory dysfunction, and the onset of a considerable number of deafness patients is related to genetic factors. The molecular mechanism of deafness is determined by means of gene detection, prenatal gene diagnosis and intervention measures are further adopted, and the method is an effective means for reducing the incidence rate of deafness and is also one of the fundamental ways for preventing and treating deafness. Hereditary hearing loss can be classified into Syndromic Hearing Loss (SHL) and non-syndromic hearing loss (NSHL) depending on whether there are other clinical phenotypes that are concurrent.

Non-syndromic deafness accounts for about 70% of congenital hereditary deafness, and 75% -80% of them are Autosomal Recessive (AR). To date, more than 100 loci (loci) have been associated with autosomal recessive deafness, these loci being designated DFNB. The non-syndromic deafness caused by different pathogenic genes has obvious differences in the onset age, hearing loss degree, progressiveness and the like. The determination of the pathogenic gene of the deafness helps to select a proper hearing intervention means for the patient, and the life quality of the deafness patient is better improved.

With the development of sequencing technology, more and more genes related to genetic deafness are identified, which provides a basis for the molecular diagnosis of genetic deafness and enables more patients with genetic deafness to be diagnosed and treated. However, due to the strong genetic heterogeneity of hereditary hearing loss, a large number of pathogenic genes are still unidentified, so that the research on the aspect has a large space, and the research on the aspect of enhancing the gene identification is still needed.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, the invention aims to provide a MYO15A gene mutant and application thereof.

It should be noted that the present invention has been completed based on the following knowledge and findings of the inventors:

whole-exon sequencing (WES) is the most frequently used method for sequencing genomes. Exons are protein-coding regions of the human genome whose DNA can be captured and enriched using sequence capture techniques. Although the exon regions only account for about 1% of the whole genome, 85% of the pathogenic mutations are contained. Compared with whole genome sequencing, whole exon sequencing is more economical and efficient. Exome sequencing is used primarily to identify and study variations in coding regions and UTR regions associated with disease, population evolution. The combination of a large number of exon data provided by public databases is beneficial to better explain the relationship between the obtained variation and the disease.

The inventor carries out detection and verification of pathogenic mutation by a method of whole exon sequencing and family analysis combined with Sanger sequencing verification aiming at one autosomal recessive non-syndromic deafness Trio family (parents + probands) collected by self. Finally, according to each detection result, the inventor determines a new pathogenic mutation site of autosomal recessive non-syndrome type deafness, namely c.2802_2812 delTCCCACCCAC mutation of MYO15A gene, and the mutation forms compound heterozygosity (in trans) with c.5681T > C mutation of the same gene on another chromosome of a patient, so that the autosomal recessive non-syndrome type deafness is caused.

The MYO15A gene is located at the DFNB3 locus and includes 66 exons, encoding three distinct subtypes, one of which is myosin 15. Myosin 15 is essential for the maintenance of normal hearing and thus the MYO15A gene plays an important role in the development and maintenance of hair cell cilia that convey perception.

The inventor researches an autosomal recessive non-syndromic deafness Trio family to find that c.2802_2812 delTCCCACCCAC mutation on a pathogenic mutation site MYO15A gene and c.5681T > C mutation of the same gene form compound heterozygosity (in trans), and the mutation causes myosin 15 abnormality to be the cause of human DFNB3 deafness. MYO15A gene mutation can cause autosomal recessive non-syndromic deafness, and the clinical manifestation is non-progressive severe-extremely severe full-frequency hearing loss before study. The mutation locus can be used for screening autosomal recessive deafness-causing mutation carriers. The combination of the two mutation sites can be used for molecular diagnosis of autosomal recessive deafness patients and differential diagnosis of related diseases, and has the advantages of rapidness, accuracy, high efficiency, simplicity and high early diagnosis rate. Of course, the gene can be used in combination with other reported mutation sites on the MYO15A gene or other reported mutation sites for autosomal recessive deafness characterization as required, and can be applied to molecular diagnosis of autosomal recessive deafness patients and identification and diagnosis of related diseases.

In a first aspect of the invention, the invention features a genetic mutation. According to embodiments of the invention, there is a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the wild-type MYO15A gene. The inventor finds that the c.2802_2812delTCCCACCCAAC mutation and/or c.5681T > C mutation of MYO15A gene are closely related to the onset of non-syndrome deafness, so that whether the biological sample suffers from non-syndrome deafness can be effectively detected by detecting whether the gene mutation occurs in the biological sample. According to embodiments of the invention, the provided gene mutation is detectable.

In a second aspect of the invention, the invention provides a nucleic acid. According to embodiments of the invention, there is a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the wild-type MYO15A gene. The inventors found that the c.2802_2812delTCCCACCCAAC mutation and/or c.5681T > C mutation of MYO15A gene are closely related to the onset of non-syndromic deafness, so that whether a biological sample is susceptible to non-syndromic deafness can be effectively detected by detecting the presence of the nucleic acids in the biological sample. According to an embodiment of the invention, the nucleic acids provided are isolatable.

In a third aspect of the invention, the invention provides a polypeptide. According to an embodiment of the invention, the amino acid sequence of the polypeptide has the following mutations compared to the amino acid sequence of a polypeptide expressed by the wild-type MYO15A gene: amino acid mutations caused by p.Gln937Leufs 39 and/or p.Leu1894Pro mutations. As mentioned above, the amino acid mutation caused by the c.2802_2812delTCCCACCCAAC mutation and/or the c.5681T > C mutation of MYO15A gene is closely related to the onset of non-syndrome deafness, so that the protein or polypeptide expressed by the nucleic acid is closely related to the onset of non-syndrome deafness, and the protein or polypeptide can be detected in a biological sample to effectively detect whether the biological sample is susceptible to non-syndrome deafness. According to an embodiment of the invention, the provided polypeptide is isolatable.

In a fourth aspect of the invention, the invention provides the use of a reagent for detecting a gene mutation, which is a gene mutation according to the first aspect of the invention, or a nucleic acid, which is a nucleic acid according to the second aspect of the invention, or a polypeptide, which is a polypeptide according to the third aspect of the invention, in the manufacture of a kit or a device for diagnosing non-syndromic deafness. As described above, the aforementioned gene mutation, nucleic acid, polypeptide are closely related to the onset of non-syndromic deafness, and further, reagents capable of detecting these gene mutation, nucleic acid, or polypeptide can be used to prepare kits or devices, and the obtained kits or devices can effectively screen biological samples suffering from non-syndromic deafness.

In a fifth aspect of the invention, there is provided the use of a biological model for screening for a drug, the biological model carrying at least one of: (1) a mutation in the gene according to the first aspect of the invention; (2) a nucleic acid according to the second aspect of the invention; (3) expressing the polypeptide of the third aspect of the invention. It is noted that "the biological model carries a genetic mutation according to the first aspect of the invention" means that the biological model carries a MYO15A gene having a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the wild-type MYO15A gene; by "a biological model carries a nucleic acid according to the second aspect of the invention" is meant that the biological model carries a nucleic acid sequence having a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the nucleic acid sequence of the wild-type MYO15A gene; by "a biological model carries a polypeptide according to the third aspect of the invention" is meant a biological model carrying a polypeptide having an amino acid mutation caused by a mutation in p.gln937leufs 39 and/or p.leu1894pro compared to the polypeptide expressed by the wild type MYO15A gene. The provided biological model can be effectively used as a related research of non-syndromic deafness, especially autosomal recessive non-syndromic deafness. According to embodiments of the present invention, the provided biological model can be used to screen drugs for the treatment of non-syndromic deafness. The biological model provided may be a cellular model or an animal model.

In a sixth aspect, the present invention provides the use of an agent which specifically alters a genetic mutation or a nucleic acid, wherein the genetic mutation is a genetic mutation according to the first aspect of the invention, in the manufacture of a medicament for the treatment of non-syndromic deafness, and the nucleic acid is a nucleic acid according to the second aspect of the invention. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned gene mutation or the aforementioned nucleic acid is closely related to the onset of non-syndromic deafness, particularly autosomal recessive non-syndromic deafness, and thus, a drug prepared from an agent that specifically alters the aforementioned nucleic acid or the aforementioned gene mutation is effective for treating non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

In a seventh aspect of the present invention, there is provided a medicament for the treatment of non-syngenic deafness, said medicament comprising: an agent which specifically alters a genetic mutation according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, and thus, a medicament comprising an agent that specifically alters the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

In an eighth aspect of the invention, there is provided a construct comprising a mutation in a gene according to the first aspect of the invention or a nucleic acid according to the second aspect of the invention. It is noted that by "the construct comprises a mutation in a gene according to the first aspect of the invention" is meant that the construct has a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the wild type MYO15A gene; by "the construct comprises a nucleic acid according to the second aspect of the invention" is meant that the construct carries a nucleic acid sequence having a p.gln937leufs 39 and/or a p.leu1894pro mutation compared to the nucleic acid sequence of the wild type MYO15A gene. Thus, the recombinant cells obtained by transforming the receptor cells with the constructs according to the embodiments of the present invention can be effectively used as a model for research related to non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

In a ninth aspect of the invention, there is provided a recombinant cell obtained by transforming a recipient cell with the construct of the eighth aspect of the invention. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a research related to non-syndromic deafness, in particular autosomal recessive non-syndromic deafness.

In a tenth aspect of the invention, the invention provides a kit for detecting non-syndromic deafness, said kit comprising reagents for detecting a mutation in a gene according to the first aspect of the invention, and/or reagents for detecting a nucleic acid according to the second aspect of the invention, and/or reagents for detecting a polypeptide according to the third aspect of the invention. As described above, the nucleic acids, gene mutations and polypeptides described above are closely related to the onset of non-syndromic deafness, and thus can be used in a kit comprising reagents effective for detecting the nucleic acids described above or the gene mutations described above or the polypeptides described above, to effectively screen a biological sample suffering from non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 shows a diagram of autosomal recessive non-synthetic deafness Trio family provided according to an embodiment of the present invention;

FIG. 2 illustrates pure tone audiometry results for a patient in a patient's family provided in accordance with an embodiment of the present invention;

FIG. 3 shows a representative Sanger sequencing validation peak plot of the c.2802_2812delTCCCACCCAAC mutational site for MYO15A gene of all family members in a patient's family provided according to an embodiment of the present invention;

figure 4 shows a representative Sanger sequencing validation peak plot of c.5681t > C mutation sites of MYO15A genes of all family members in a patient's family provided according to one embodiment of the present invention.

Detailed Description

The following describes embodiments of the present invention in detail. The following examples are illustrative only and are not to be construed as limiting the invention.

It should be noted that the terms "first" and "second" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Further, in the description of the present invention, "a plurality" means two or more unless otherwise specified.

Herein, the term "non-syndromic deafness" is also commonly referred to in the art as "non-syndromic hereditary deafness", which refers to deafness as the sole symptom of the affected individual, without other genetically impaired sexual organ dysfunction.

The term "autosomal recessive non-syndromic deafness", also commonly referred to in the art as "autosomal recessive non-syndromic hereditary deafness" or as "non-syndromic autosomal recessive deafness" or "non-syndromic autosomal recessive hereditary deafness", means that hereditary deafness is controlled by recessive alleles that occur on autosomes, i.e., both alleles are required to appear recessive, and the patient appears diseased. And since the c.2802_2812delTCCCACCCAAC and c.5681T > C mutations appear as compound heterozygosity, patients appear diseased only if mutations occur at both sites.

The invention discovers a pathogenic locus c.2802_2812delTCCCACCCAAC mutation on an autosomal recessive deafness pathogenic gene MYO15A, and the mutation and a mutation c.5681T > C of the same gene on the other chromosome of a patient form compound heterozygosity (in trans), so that autosomal recessive non-syndromic deafness is caused. The mutation site can be used for screening autosomal recessive deafness pathogenic mutation carriers, can also be used for molecular diagnosis of autosomal recessive deafness patients and differential diagnosis of related diseases, is rapid, accurate, efficient, simple and convenient, has high early diagnosis rate, and can provide scientific basis for early diagnosis, differential diagnosis and drug treatment of autosomal recessive deafness.

It should be noted that the mutation site on the MYO15A gene provided herein can be used as a marker of non-syndromic deafness, more specifically, a marker of autosomal recessive non-syndromic deafness; or the presence of these mutation sites is indicative of a biological sample having non-syndromic deafness, more particularly autosomal recessive non-syndromic deafness. This does not mean that "non-syndromic deafness" or "autosomal recessive non-syndromic deafness" is a restriction as a site of this mutation in the MYO15A gene. That is, if the disease characterized by the mutation site in the MYO15A gene is to be specifically indicated or indicated, it is known that it may indicate that the biological sample is afflicted with non-syndromic deafness, more specifically autosomal recessive non-syndromic deafness; but can just as well be informed directly, depending on the specific purpose or on the subject, that genetic deafness is present, or that deafness is present.

Herein, the DNA sequence (e.g. intron sequence, exon sequence, etc.), RNA sequence, information on the encoded protein, etc. of the wild-type MYO15A gene are all included in the NCBI database and can be obtained with reference to the following website: https:// www.ncbi.nlm.nih.gov/nuccore/NC _000017.10report ═ genbank & from ═ 18012020& to ═ 18083116 and https:// www.ncbi.nlm.nih.gov/nuccore/NM _ 016239.4/. The c.2802_2812delTCCCACCCAAC mutations, c.5681t > C mutations shown herein were all determined with reference to cDNA and intron sequences of the wild-type MYO15A gene in the NCBI database.

The c.2802_2812delTCCCACCCAAC mutation shown herein refers to a TCCCACCCAAC base deletion at positions 2802 to 2812 in the cDNA of wild-type MYO 15A.

For purposes of illustration, a portion of the DNA sequence of the wild-type MYO15A gene is provided below, and the double underlined bold bases of the c.2802-2812 delTCCCACCCAAC mutation corresponding to this portion of the wild-type sequence (SEQ ID NO:1) is the deletion of base TCCCACCCAAC that occurs.

SEQ ID NO:1 (corresponding to NCBI database accession number NM-016239.4, Sequence section: EXON2)

As follows:

correspondingly, c.2802_2812delTCCCACCCAAC mutation of the MYO15A gene resulted in an amino acid change, which can be expressed as p.gln937leufs × 39, representing that the 937 glutamine (Gln) of the mutated polypeptide was changed to leucine (Leu) with a frame shift and termination after a frame shift of 39 amino acids compared to the amino acid expressed by the wild-type MYO15A gene.

Likewise, the c.5681t > C mutation shown herein refers to the replacement of the T base with a C base occurring at position 5681 of the wild-type MYO15A gene.

For ease of review, a partial DNA sequence of the wild-type MYO15A gene is provided as shown in SEQ ID NO:2 (where the double underlined bases are the mutated bases, mutated from base T to base C.. the primer sequence is labeled).

SEQ ID NO:2 (corresponding to NCBI database accession number NM-016239.4, NCBI Reference Sequence, corresponding Sequence segment INTRON23-EXON24)

Accordingly, c.5681T > C mutation of the MYO15A4 gene affects splicing, resulting in a frameshift mutation of an amino acid, which can be expressed as p.Leu1894Pro, i.e. leucine (Leu) at position 1894 is changed into proline (Pro).

It should be noted that the mutation sites and sequences given above are all referred to the contents included in the NCBI database, and it should be understood by those skilled in the art that the mutation sites and sequences shown may be slightly different or changed due to the update of the database or the difference of the database, and the differences or changes may be determined by the contents of the database given as the standard, and are also included in the protection scope of the present invention.

Gene mutation

In one aspect of the invention, the invention features a genetic mutation. According to embodiments of the invention, there is a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the wild-type MYO15A gene. The inventor finds that the c.2802_2812 delTCCCACCCAC mutation and/or c.5681T > C mutation on the gene is closely related to the onset of non-syndrome deafness (such as autosomal recessive non-syndrome deafness), so that whether the biological sample suffers from non-syndrome deafness can be effectively detected by detecting whether the gene mutation occurs in the biological sample.

A gene mutation generally refers to a change in the structural base pair composition or arrangement of genes. Herein, a gene mutation refers to deletion, insertion, substitution, etc. of a base occurring on the MYO15A gene. The gene mutation may be detected or otherwise discerned as a mutation site in the MYO15A gene, as part of the nucleic acid of the MYO15A gene or the entire nucleic acid of the MYO15A gene. Of course, it can be said that the gene mutation can be selected. The gene mutation can be detected by using an antibody, a probe, a primer, a mass spectrometric detection reagent and the like which are commonly used in the field.

Nucleic acids

In yet another aspect of the invention, a nucleic acid is provided. According to embodiments of the invention, there is a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the wild-type MYO15A gene. The inventors found that the c.2802_2812delTCCCACCCAAC mutation and/or c.5681T > C mutation of MYO15A gene are closely related to the onset of non-syndromic deafness, so that by detecting the presence of the above nucleic acids in a biological sample, it can be effectively detected whether the biological sample suffers from non-syndromic deafness.

For the purposes of the present description and claims, reference to nucleic acids will be understood by those skilled in the art to include virtually either or both of the complementary strands. For convenience, in the present specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference to the sequence of the MYO15A gene actually includes the complement thereof. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.

Polypeptides

In another aspect of the invention, the invention features a polypeptide. According to an embodiment of the invention, the amino acid sequence of the polypeptide has the following mutations compared to the amino acid sequence of a polypeptide expressed by the wild-type MYO15A gene: amino acid mutations caused by p.Gln937Leufs 39 and/or p.Leu1894Pro mutations. As mentioned above, c.2802_2812delTCCCACCCAAC mutation and/or c.5681T > C mutation of MYO15A gene are closely related to the onset of non-syndrome deafness, and the protein expressed by the mutant gene is also closely related to the onset of non-syndrome deafness, so that whether the biological sample suffers from non-syndrome deafness can be effectively detected by detecting whether the polypeptide exists in the biological sample.

Use of reagent for detecting nucleic acid, gene mutation and polypeptide in preparation of kit or equipment

In a further aspect of the invention, the invention provides the use of a reagent for a mutation in a gene as hereinbefore described or a nucleic acid as hereinbefore described or a polypeptide as hereinbefore described in the manufacture of a kit or device. According to an embodiment of the invention, the kit or device is for diagnosing non-syndromic deafness. As mentioned above, the gene mutation, nucleic acid, polypeptide described above are closely related to the onset of non-syndromic deafness, and the reagent for detecting the nucleic acid described above or the gene mutation described above or the polypeptide described above can be used to prepare a kit or a device, and the obtained kit or device can effectively screen out biological samples suffering from non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

According to an embodiment of the invention, the non-syndromic deafness is autosomal recessive non-syndromic deafness.

According to an embodiment of the invention, the reagent comprises at least one of an antibody specific for at least one of the nucleic acid, the genetic mutation and the polypeptide, a probe, a primer and a mass spectrometric detection reagent. For example, the inventors can detect the presence of the above mutation in a test sample by the specific binding of an antibody specifically recognizing the polypeptide to the polypeptide, i.e., the presence of the above polypeptide is detected by the interaction of a specific antibody with an antigen; the inventors can also identify the presence of the nucleic acid or gene mutation by designing in advance a probe that specifically recognizes the nucleic acid or gene mutation and complementarily pairing the probe with a nucleic acid fragment in which the site of the nucleic acid or gene mutation is located; the inventors can also design specific primers for amplifying the exons in which the gene mutations are located, and then determine whether the gene mutations exist through gene amplification and sequencing; the inventors also determined the presence of the above-described polypeptide having an amino acid mutation caused by the mutation of p.gln937leufs 39 and/or p.leu1894pro by measuring m/z of the polypeptide by mass spectrometry. At least one of the provided antibody, the probe, the primer and the mass spectrum detection reagent can specifically and high sensitively screen out the nucleic acid or the gene mutation or the polypeptide, and further specifically and high sensitively screen out a biological sample suffering from non-syndrome type deafness, especially autosomal recessive non-syndrome type deafness, and further can be effectively used for preparing a kit or equipment for screening the biological sample suffering from non-syndrome type deafness, especially autosomal recessive non-syndrome type deafness.

Biological model

In another aspect of the invention, the invention provides the use of a biological model for screening for a drug. According to an embodiment of the invention, the biological model carries at least one of the following: (1) the nucleic acid as described above; (2) mutations in the aforementioned genes; (3) expressing the polypeptide as described above. According to the provided biological model, the method can be effectively used as a model for related research of non-syndromic deafness, especially autosomal recessive non-syndromic deafness. These biological models may be cell models or animal models.

Use of agents for the manufacture of a medicament

In a further aspect of the invention, the invention proposes the use of an agent which specifically alters a nucleic acid as described above or a mutation in a gene as described above, in the manufacture of a medicament for the treatment of non-syndromic deafness. It is to be noted that the specific alteration is such that the mutated nucleic acid or mutated site of the gene is restored to its original wild-type state or other non-pathogenic state without substantially affecting other sequences in the genome of the individual. As described above, the aforementioned nucleic acids or the aforementioned gene mutations are closely related to the onset of non-syndromic deafness, and thus, drugs prepared from these agents capable of specifically altering the aforementioned nucleic acids or the aforementioned gene mutations can be effectively used for treating non-syndromic deafness.

According to embodiments of the invention, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease. For example, the CRISPR technology is a technology for modifying a target gene by using an RNA-guided Cas protein, CRISPR-Cas9 mainly realizes genome modification through three ways of gene knockout, introduction of a special variation and site-directed transgene, and based on a method of CRISPR-Cas9, the inventors can design sgRNA and synthesize gRNA of the sequence, co-express the gRNA and dCas9 in a cell, and mediate dCas9 protein to be combined with a target DNA region through the gRNA, thereby realizing repair or change of a specific site.

Construct and recombinant cell

In yet another aspect of the invention, the invention features a construct. According to an embodiment of the invention, the construct comprises the nucleic acid or the genetic mutation as described above. The provided construct is transformed into a receptor cell to obtain a recombinant cell, which can be effectively used as a model for related researches on non-syndromic deafness, particularly autosomal recessive non-syndromic deafness. The type of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell or a mammalian cell, and the recipient cell is preferably derived from a mammal.

The term "construct" as used in the present invention refers to a genetic vector comprising a specific nucleic acid sequence and capable of transferring the nucleic acid sequence of interest into a host cell to obtain a recombinant cell. According to embodiments of the present invention, the form of the construct is not limited, and includes, but is not limited to, at least one of a plasmid, a bacteriophage, an artificial chromosome, a Cosmid (Cosmid), and a virus, preferably a plasmid. The plasmid is used as a genetic carrier, has the characteristics of simple operation, capability of carrying larger fragments and convenience for operation and treatment. The form of the plasmid is not particularly limited, and may be a circular plasmid or a linear plasmid, and may be either single-stranded or double-stranded. The skilled person can select as desired. The term "nucleic acid" used in the present invention may be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA, RNA, the length of which is not subject to any particular limitation. For constructs used to construct recombinant cells, it is preferred that the nucleic acid be DNA, as DNA is more stable and easier to manipulate than RNA.

In yet another aspect of the invention, a recombinant cell is provided. According to an embodiment of the invention, the recombinant cell is obtained by transforming a recipient cell with the construct described above. According to some embodiments of the invention, the recombinant cells of the invention can be effectively used as a model for research related to non-syndromic deafness, in particular autosomal recessive non-syndromic deafness.

According to the embodiment of the present invention, the kind of the recipient cell is not particularly limited, and may be, for example, an escherichia coli cell, a mammalian cell, and preferably, the recipient cell is derived from a non-human mammal.

Kit for detecting non-syndromic deafness

In another aspect of the invention, the invention provides a kit for detecting non-syndromic deafness. According to an embodiment of the invention, the kit comprises reagents for detecting the nucleic acids described above, and/or reagents for detecting the genetic mutations described above, and/or reagents for detecting the polypeptides described above. As described above, the nucleic acids, gene mutations and polypeptides described above are closely related to the onset of non-syndromic deafness, and thus can be used in a kit comprising reagents effective for detecting the nucleic acids described above or the gene mutations described above or the polypeptides described above, to effectively screen a biological sample suffering from non-syndromic deafness, particularly autosomal recessive non-syndromic deafness.

Method for screening biological samples for non-syndromic deafness

In addition to the above, the present invention also provides a method of screening a biological sample for non-syndromic deafness. According to an embodiment of the invention, the method comprises the steps of:

extracting a nucleic acid sample from a biological sample;

determining a nucleic acid sequence of the nucleic acid sample based on the nucleic acid sample;

determining whether the biological sample has non-syndromic deafness based on whether the nucleic acid sequence of the nucleic acid sample, or a complement thereof, has a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation compared to the wild-type MYO15A gene, wherein the nucleic acid sequence of the nucleic acid sample, or the complement thereof, has the c.2802_2812delTCCCACCCAAC mutation and/or the c.5681t > C mutation compared to the wild-type MYO15A gene is indicative of the biological sample having non-syndromic deafness. The provided method for screening the biological sample suffering from non-syndromic deafness can effectively screen the biological sample suffering from non-syndromic deafness, especially autosomal recessive non-syndromic deafness.

First, a nucleic acid sample is extracted from a biological sample. According to an embodiment of the present invention, the type of biological sample is not particularly limited as long as a nucleic acid sample reflecting the presence or absence of a mutation in the MYO15A gene of the biological sample can be extracted from the biological sample. According to an embodiment of the present invention, the biological sample may be at least one selected from human blood, skin, and subcutaneous tissue. Therefore, the sampling and detection can be conveniently carried out, and the efficiency of screening the biological sample with non-syndromic deafness can be further improved. The term "nucleic acid sample" as used herein is to be understood in a broad sense according to the embodiments of the present invention and may be any sample that reflects the presence or absence of a mutation in the MYO15A gene in a biological sample, such as whole genomic DNA extracted directly from the biological sample, a portion of the whole genome that contains coding sequences for the MYO15A gene, total RNA extracted from the biological sample, or mRNA extracted from the biological sample. According to one embodiment of the invention, the nucleic acid sample is whole genomic DNA. Therefore, the source range of the biological sample can be expanded, and a plurality of information of the biological sample can be determined simultaneously, so that the efficiency of screening the biological sample suffering from non-syndromic genetic deafness can be improved. In addition, according to an embodiment of the present invention, for using RNA as the nucleic acid sample, extracting the nucleic acid sample from the biological sample may further include: extracting an RNA sample from the biological sample, preferably the RNA sample is mRNA; and obtaining a cDNA sample by reverse transcription reaction based on the obtained RNA sample, the obtained cDNA sample constituting a nucleic acid sample. Thus, the efficiency of screening biological samples suffering from non-syndromic deafness using RNA as a nucleic acid sample can be further improved.

The obtained nucleic acid sample is analyzed, and the nucleic acid sequence of the obtained nucleic acid sample can be determined. According to embodiments of the present invention, the method and apparatus for determining the nucleic acid sequence of the resulting nucleic acid sample are not particularly limited. According to embodiments of the present invention, the nucleic acid sequence of a nucleic acid sample may be determined by a sequencing method. The methods and apparatus that can be used to perform sequencing are not particularly limited, and for example, second generation sequencing techniques can be used, as can third and fourth generation or more advanced sequencing techniques. According to embodiments of the invention, a nucleic acid sequence may be sequenced using at least one of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and a single molecule sequencing device. Therefore, by combining the latest sequencing technology, the higher sequencing depth can be achieved for a single site, and the detection sensitivity and accuracy are greatly improved, so that the characteristics of high throughput and deep sequencing of the sequencing devices can be utilized to further improve the efficiency of detecting and analyzing the nucleic acid sample. Therefore, the accuracy and the precision of the subsequent analysis of the sequencing data can be improved. Thus, according to embodiments of the present invention, determining the nucleic acid sequence of the nucleic acid sample may further comprise: firstly, aiming at the obtained nucleic acid sample, constructing a nucleic acid sequencing library; and sequencing the obtained nucleic acid sequencing library so as to obtain a sequencing result consisting of a plurality of sequencing data. According to some embodiments of the invention, the resulting nucleic acid sequencing library may be sequenced using at least one selected from the group consisting of BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLID, 454, and single molecule sequencing devices. In addition, according to an embodiment of the present invention, a nucleic acid sample may be screened to enrich for an exon of the MYO15A gene, and the screening enrichment may be performed before, during or after the construction of a sequencing library. Exon-targeted sequence enrichment systems such as: the capture chip of the Huada major autonomous exon, and other exons or target region capture platforms such as active SureSelect, Nimblegen and the like enrich target fragments. According to one embodiment of the present invention, constructing a nucleic acid sequencing library for a nucleic acid sample further comprises: performing PCR amplification on the nucleic acid sample by using at least one primer selected from MYO15A gene specific primers; and constructing a nucleic acid sequencing library aiming at the obtained amplification products. Therefore, MYO15A gene exon can be enriched through PCR amplification, so that the efficiency of screening biological samples suffering from non-syndromic genetic deafness can be further improved. According to the embodiment of the present invention, the sequence of the Primer specific to MYO15A gene is not particularly limited, and may be obtained by, for example, on-line design using Primer3.0 with reference to the human genome sequence database GRCh37.1/hg19, such as UCSC (http:// genome. UCSC. edu /), Primer3(version 0.4.0, http:// Primer3.ut. ee /) is applied to design and synthesize the Primer of candidate gene (synthetic by Biotech), and the Primer specificity is verified using Primer-BLAST (http:// www.ncbi.nlm.nih.gov/tools/Primer-BLAST /).

The methods and procedures for constructing sequencing libraries for nucleic acid samples may be suitably selected by those skilled in the art based on different sequencing techniques, and for details of the procedures, reference may be made to the manufacturer of the sequencing instrument, e.g., the protocol provided by Illumina, Inc., see, e.g., Multiplexing Sample Preparation Guide (Part # 1005361; Feb2010) or Paired-End Sample Preparation Guide (Part # 1005063; Feb2010), which is incorporated herein by reference. The method and apparatus for extracting a nucleic acid sample from a biological sample according to an embodiment of the present invention are not particularly limited, and may be performed using a commercially available nucleic acid extraction kit.

It should be noted that the term "nucleic acid sequence" used herein should be understood in a broad sense, and may be complete nucleic acid sequence information obtained by assembling sequencing data obtained by sequencing a nucleic acid sample, or may be nucleic acid sequences directly obtained by sequencing nucleic acid samples (reads), as long as the nucleic acid sequences contain coding sequences corresponding to the MYO15A gene.

Finally, after determining the nucleic acid sequence of the nucleic acid sample, the obtained nucleic acid sequence is aligned with a reference sequence, and when the obtained nucleic acid sequence has the aforementioned mutation, it indicates that the biological sample suffers from non-syndromic deafness. Thus, by the method for screening a biological sample suffering from non-syndromic deafness according to the embodiment of the present invention, a biological sample suffering from non-syndromic deafness can be effectively screened. The method and apparatus for aligning a nucleic acid sequence with a corresponding wild-type gene sequence according to embodiments of the present invention are not particularly limited and may be performed using any conventional software, and according to embodiments of the present invention, alignment may be performed using SOAPALIGNER/SOAP 2.

It should be noted that the use of the "method for screening a biological sample suffering from non-syndromic deafness" according to the embodiment of the present invention is not particularly limited, and for example, the method can be used as a screening method for non-diagnostic purposes, for example, in scientific research or other applications such as the production process of kits.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1 determination of autosomal recessive deafness-causing mutations

1. Sample collection

The inventor collects the Trio family (parents + probands) of Chinese Han family autosomal recessive non-syndromic deafness patients, and the family chart is shown in figure 1. As shown in FIG. 1, the family includes 3 members, the daughter is deaf (i.e. II-1 in the family map) and the parents are normal (i.e. I-1, I-2 in the family map), and the autosomal recessive inheritance pattern is conformed. The solid icon is the patient, the semi-solid icon is the carrier, and the arrow indicates the proband.

The hearing results of the patients in this family are shown in figure 2. In fig. 2, the abscissa indicates the frequency of hearing and the ordinate indicates the hearing level, and if hearing is normal, the threshold curve should be floating around 0. As shown in FIG. 2, the audiogram prompted patient II-1 of severe deafness in both ears.

The inventors collected peripheral blood samples from all members of the family, added EDTA for anticoagulation, and stored at-80 ℃. All blood samples had signed an informed consent.

2. DNA extraction

Taking peripheral blood of all members of the family, extracting the genomic DNA of peripheral blood leucocyte by QIAmp BLOOD kit (Qiagen, Hilden, Germany), and measuring the concentration and purity of the DNA by using a QubitFluorometer and agarose gel electrophoresis, wherein the obtained genomic DNA OD260/OD280 of each sample is between 1.7 and 2.0, the concentration is not less than 50 ng/microliter, and the total amount is not less than 3 micrograms.

3. Capture sequencing

Samples of all family members were sequenced using a liquid phase capture system such as Agilent, combined with the high throughput sequencing technology of Illumina Hiseq 2500. The capture range comprises the exon region of the whole genome (accounting for about 1 percent of the whole genome), the total length of the capture region can reach 50M, the sequencing data volume is 10-12Gb, and 100 multiplied by the effective sequencing depth. The main steps include breaking, library preparation and sequencing on machine.

And after the sequencing data is downloaded, performing mutation detection, annotation and database comparison by using an internal customization process, and determining candidate pathogenic sites according to the means such as crowd frequency, software prediction results, family analysis and the like.

Results a compound heterozygous c was found in the patient's MYO15A gene [2802_2812delTCCCACCCAAC ]; [5681T > C ] mutation. Pedigree analysis showed that the patient's father and mother were heterozygous carriers for the c.2802_2812delTCCCACCCAAC and c.5681t > C mutations, respectively.

According to the recessive inheritance pattern of MYO15A gene-related deafness, if c. [2802_2812delTCCCACCCAAC ]; the [5681T > C ] mutation is proved to be true positive by Sanger, and the two mutations forming compound heterozygosis can be basically confirmed as the pathogenic cause of deafness of patients.

Example 2 sequencing validation by Sanger method

The MYO15A genes were detected separately for all family members (including patients and hearing-normal parents) in the family of autosomal recessive non-syngeneic deafness patients described in example 1: designing primers aiming at the c.2802_2812 delTCCCACCCAC AC and c.5681T > C mutation of MYO15A gene, then obtaining related sequences of mutation sites by PCR amplification, product purification and sequencing, and verifying whether the c.2802_2812 delTCCCACCCAC and c.5681T > C mutation of MYO15A gene is detected in a sample according to the determination result that whether the sequence determination result belongs to mutant or wild type.

The method comprises the following specific steps:

1. DNA extraction

According to the DNA extraction method described in example 1, genomic DNA in peripheral venous blood of a subject was extracted for use.

2. Primer design and PCR reaction

Firstly, specific primers are designed aiming at c.2802_2812delTCCCACCCAAC and c.5681T > C mutations of MYO15A gene by referring to a human genome reference sequence GRCh37/hg19, wherein the specific sequences are as follows:

MYO15A C.2802_2812del upstream primer TCCCTGAATCTGCCCTCG (PRIMER SEQ 3F 1)

MYO15A C.2802_2812del downstream primer GGTGTCTGCCCAGGAAGA (PRIMER SEQ 3R 1)

MYO15A c.5681T > C upstream primer GCCCTGCCTATTCTGTCTCC (PRIMER SEQ 4F 1)

MYO15A c.5681T > C downstream primer ATCCTGCCTTTTCTGTGCCT (PRIMER SEQ 4R 1)

Then, preparing a PCR reaction system of each DNA sample according to the following mixture ratio and carrying out PCR reaction:

reaction system (20 μ l):

and (3) PCR reaction conditions:

thus, PCR amplification products of the genomic DNA samples of each subject were obtained.

3. Sanger sequencing

And (3) directly carrying out DNA sequencing after purifying the PCR product obtained in the step (2), and carrying out forward and reverse sequencing on the sequencing by using an ABI3730XL sequencer.

Based on the sequencing results, as shown in fig. 3 and 4, in the Trio family of autosomal recessive deafness patients shown, the patients simultaneously carried the c.5681t > C and c.2802_2812delTCCCACCCAAC mutations of MYO15A gene, and the father and mother with normal hearing were heterozygous carriers of the c.2802_2812delTCCCACCCAAC mutation and the c.5681t > C mutation, respectively.

By combining the above information, it can be confirmed that the compound heterozygous genotype composed of c.2802_2812delTCCCACCCAAC and c.5681T > C mutation of MYO15A gene is the causative factor of the deaf patient II-1 in the recessive deafness family.

Example 3 detection kit

A test kit comprising primers capable of detecting c.2802_2812delTCCCACCCAAC and c.5681t > C mutations of MYO15A gene was prepared for screening biological samples susceptible to autosomal recessive nonsynthetic deafness, wherein the primers are MYO15A gene specific primers having the sequences as PRIMER SEQ 3F 1, PRIMER SEQ 3F 2, PRIMER SEQ 4R 1, PRIMER SEQ 4R 2 in example 2.

The method for screening the biological sample susceptible to autosomal recessive nonsynthetic deafness by using the kit comprises the following specific steps:

extracting DNA of a person to be tested according to the method described in step 2 of example 1, performing PCR reaction with the extracted DNA as a template and the specific primer of the MYO15A gene (see example 2 for a PCR reaction system and reaction conditions), purifying the PCR product according to a conventional method in the field, sequencing the purified product, and then observing whether the sequence obtained by sequencing has c.2802_2812 delTCCCACCCAC AAC and c.5681T > C mutation, so that whether the MYO15A gene mutant exists in the DNA of the person to be tested can be effectively detected, whether the person to be tested is susceptible to autosomal recessive and nonsynthesized deafness, and further, a biological sample susceptible to autosomal recessive and nonsynthesized deafness can be screened from the person to be tested.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen Hua Dagene GmbH, Huazhong university college of science and technology, affiliated conjunction Hospital

<120> MYO15A gene mutant and application thereof

<130> PIDC3202286

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 400

<212> DNA

<213> Artificial

<220>

<223> 1

<400> 1

tccctgaatc tgccctcgcg cctcccgcac acgtggcggc gcctcagcga gccacccact 60

cgggctgtga agccgcaagt gcgcctgccc ttccaccgac cgcccagggc cggggcctgg 120

cgggcgcccc tggaacaccg ggagagcccg cgagaacccg aggactcaga gacgccctgg 180

actgtgcccc cactggcccc cagctgggac gtggacatgc ctcccaccca acgcccaccc 240

tccccctggc caggaggtgc aggcagccgc cgaggctttt ccaggccacc ccctgtgccg 300

gaaaacccct ttctccagct cctgggccct gtgccatccc ccaccctcca gcctgaggat 360

ccagctgctg atatgaccag ggtcttcctg ggcagacacc 400

<210> 2

<211> 298

<212> DNA

<213> Artificial

<220>

<223> 2

<400> 2

gccctgccta ttctgtctcc acggacttct agagagggag gggcccttag tccagcctcc 60

tggctcctat ctgcctcagt gccttcctcc tgtccttagc tgttccttaa ggaacaccta 120

taccagctgc tggagagtat gcgagagcat gtcctgaatc tggcagccct cactctgcag 180

cgctgcctcc gtggcttctt cattaagcgg cgattccgct ctctgcgcca caagatcatc 240

ctgctgcaaa gccgggcccg tggctacctt gccaggtgag gcacagaaaa ggcaggat 298

<210> 3

<211> 18

<212> DNA

<213> Artificial

<220>

<223> 3

<400> 3

tccctgaatc tgccctcg 18

<210> 4

<211> 18

<212> DNA

<213> Artificial

<220>

<223> 4

<400> 4

ggtgtctgcc caggaaga 18

<210> 5

<211> 20

<212> DNA

<213> Artificial

<220>

<223> 5

<400> 5

gccctgccta ttctgtctcc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial

<220>

<223> 6

<400> 6

atcctgcctt ttctgtgcct 20

Claims

1. A genetic mutation having a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation, compared to the wild-type MYO15A gene;

optionally, the genetic mutation is detectable.

2. A nucleic acid having a c.2802_2812delTCCCACCCAAC mutation and/or a c.5681t > C mutation, compared to the wild-type MYO15A gene.

3. A polypeptide having the following mutations in its amino acid sequence compared to the amino acid sequence of a polypeptide expressed from a wild-type MYO15A gene:

amino acid mutations caused by p.Gln937Leufs 39 and/or p.Leu1894Pro mutations.

4. Use of a reagent for detecting a mutation in a gene according to claim 1 or a nucleic acid according to claim 2 or a polypeptide according to claim 3 for the preparation of a kit or device for the diagnosis of non-syndromic deafness;

optionally, the non-syndromic deafness is autosomal recessive non-syndromic deafness;

optionally, the reagents include at least one of antibodies, probes, primers, and mass spectrometry detection reagents specific for at least one of the gene mutation, the nucleic acid, and the polypeptide.

5. Use of a biological model for screening for a drug, wherein the biological model carries at least one of:

(1) a mutation of the gene of claim 1;

(2) the nucleic acid of claim 2;

(3) expressing the polypeptide of claim 3;

optionally, the biological model is a cellular model or an animal model;

optionally, the biological model is used to screen for drugs for the treatment of non-syndromic deafness.

6. Use of an agent that specifically alters a gene mutation of claim 1 or a nucleic acid of claim 2 in the manufacture of a medicament for the treatment of non-syndromic deafness;

optionally, the agent is an agent based on at least one of shRNA, antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpf1, and zinc finger nuclease.

7. A medicament for the treatment of non-syngenic deafness, said medicament comprising:

an agent that specifically alters the genetic mutation of claim 1 or the nucleic acid of claim 2;

8. A construct comprising a genetic mutation of claim 1 or a nucleic acid of claim 2.

9. A recombinant cell obtained by transforming a recipient cell with the construct of claim 8.

10. A kit for detecting non-syndromic deafness, comprising a reagent for detecting a mutation in the gene of claim 1, and/or a reagent for detecting the nucleic acid of claim 2, and/or a reagent for detecting the polypeptide of claim 3.