CN111793681A - HLA-B locus allele typing kit and detection method thereof - Google Patents
HLA-B locus allele typing kit and detection method thereof Download PDFInfo
- Publication number
- CN111793681A CN111793681A CN202010758304.XA CN202010758304A CN111793681A CN 111793681 A CN111793681 A CN 111793681A CN 202010758304 A CN202010758304 A CN 202010758304A CN 111793681 A CN111793681 A CN 111793681A
- Authority
- CN
- China
- Prior art keywords
- hla
- sequencing
- locus
- seq
- exon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an HLA-B locus allele typing kit and a detection method thereof, wherein the kit comprises an amplification primer for amplifying the 2 nd, 3 rd and 4 th exon regions covering the HLA-B locus and specific sequencing primers aiming at the 2 nd, 3 th and 4 th exon regions respectively. According to the detection method, an amplification primer is used for amplifying a DNA sample, sequencing primers aiming at exon regions 2,3 and 4 of an HLA-B locus are used for sequencing exons 2,3 and 4 in an amplification product respectively, and the obtained sequencing result is compared with a database to obtain the allele type of the HLA-B locus. According to the method, the amplification primers can be used for directly amplifying the HLA-B locus and sequencing the exon regions 2,3 and 4 of the sequencing primers to obtain various allelic genotypes on the B locus, so that the interference of the HLA-A and C locus gene sequences with extremely high homology with the B locus is avoided, and the accuracy of the typing result is improved.
Description
Technical Field
The invention belongs to the technical field of gene detection, and particularly relates to an HLA-B locus allele typing kit and a detection method thereof.
Background
Human Leukocyte Antigens (HLA) are encoded by genes located on the short arm of human chromosome 6, classical HLA-I molecules include A, B and C sites, HLA-II molecules include DR, DQ and DP sites, and genes at each HLA site are linked and inherited in a haploid form, wherein the HLA-B site is the most complex site of allelic polymorphism found so far. The HLA-B locus allelic factor reported by WHO is 7255, the B locus allelic factor of Chinese population is 485, and the common allelic factor is 54.
The HLA-B locus plays an important role in allogeneic hematopoietic stem cell transplantation and organ transplantation, and is closely related to heredity, pathogenesis, disease progression, drug toxicity or adverse reaction, reproductive health, infertility and the like. Especially, compared with the traditional serotype, the HLA-B locus allelic gene typing has more accurate diagnosis and prognosis judgment of diseases. The clinical application field is as follows: the clinical value of HLA-B27 allelic typing in the prediction and diagnosis of ankylosing spondylitis; clinical value in predicting adverse drug reactions in patients, such as antiepileptic drug detection of gene B15: 02, antiviral drug Abacawei detection of gene B57: 01, anti-gout drug uric acid reduction of allopurinol detection of gene B58: 01, etc.; and HLA has relevance to immune infertility and habitual abortion. Therefore, the kit for accurately carrying out HLA-B locus allele typing prepared by the gene sequencing method has very important clinical application prospect and diagnosis and treatment values on diseases.
The gene Sequencing (SBT) technology is a gold standard of HLA genotyping, and the method for carrying out HLA-B locus allele genotyping by adopting the SBT technology is a method for carrying out full-length sequencing on 2 nd, 3 rd and 4 th exons with T cell important antigen presentation function on a B locus, so that not only can 2 alleles on the HLA-B locus of a patient be accurately sequenced, but also serotype, allele homozygote or heterozygote expression can be determined, and the HLA haplotype of a pathogenic gene can be further analyzed. The kit has the advantages of high accuracy, high specificity, high precision, small sample size, capability of realizing large-scale detection, short report time and the like.
Disclosure of Invention
The invention aims to provide an HLA-B locus allele typing kit and a detection method for carrying out HLA-B locus allele typing by using the kit, wherein a primer sequence for the sequencing reaction of 2 nd, 3 rd and 4 th exons of an HLA-B locus is further designed by designing a primer sequence covering the characteristics of various alleles of the HLA-B locus, and an experiment reaction system and conditions are simultaneously established and optimized for carrying out the detection of the HLA-B locus allele typing.
In order to achieve the purpose, the invention provides the following technical scheme:
an HLA-B locus allele typing kit comprises amplification primers for amplifying 2 nd, 3 rd and 4 th exon regions covering HLA-B loci and specific sequencing primers aiming at the 2 nd, 3 th and 4 th exon regions respectively;
the nucleotide sequence of the amplification primer is as follows:
an upstream primer BF: TCTCAGGGTCTCAGGGTCCG, as shown in SEQ ID NO. 1;
a downstream primer BR: CAGCCAGGCCAGCAACAATG, as shown in SEQ ID NO. 2;
sequencing primers for exon 2 were as follows:
upstream primer B2F: CCCAGGCTCCCACTCCAT, as shown in SEQ ID NO. 3;
the downstream primer B2R: GGGGAGTCGTGACCTGC, as shown in SEQ ID NO. 4;
sequencing primers for exon 3 were as follows:
upstream primer B3F: GGCCAGGGTCTCACA, as shown in SEQ ID NO. 5;
the downstream primer B3R: GGCGACATTCTAGCGC, as shown in SEQ ID NO. 6;
sequencing primers for exon 4 were as follows:
upstream primer B4F: AGATGCAAAGCGCCTGAA, as shown in SEQ ID NO. 7;
the downstream primer B4R: GGCTCCTGCTTTCCCTGA, as shown in SEQ ID NO. 8.
Further, the amplification system covering the 2 nd, 3 rd and 4 th exon regions of the HLA-B site comprises: upstream primer BF, downstream primer BR, 10 XBuffer, dNTP, Taq enzyme and DNA sample.
Further, the sequencing system for the 2 nd, 3 rd and 4 th exon regions comprises: PCR amplification products, B2F/B2R, B3F/B3R, B4F/B4R sequencing primers and Bigdye.
The detection method for HLA-B locus allelic gene typing by using the kit comprises the following steps:
(1) extracting DNA;
(2) amplifying the DNA sample extracted in the step (1) by using amplification sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2 to obtain a DNA sequence covering HLA-B sites and containing exon regions 2,3 and 4;
(3) carrying out electrophoresis on the PCR product amplified in the step (2) by using agarose gel, separating a target band according to the size and the position of the target band, adding shrimp alkaline enzyme into the target band for digestion, and then respectively carrying out sequencing reaction;
(4) sequencing the digested PCR product in the step (3) by utilizing sequencing primers shown in SEQ ID NO. 3-8 to sequence exons 2,3 and 4 respectively to obtain a sequencing product;
(5) purifying and denaturing the sequencing product obtained in the step (4), and then sequencing by using a sequencer; and comparing the sequence obtained by sequencing with an HLA-IMGT database and analyzing to obtain the HLA-B locus allele type.
Further, the amplification conditions of step (2): 5min at 95 ℃; 30s at 95 ℃, 25 s at 63 ℃ and 2min at 72 ℃ for 30s, and the total number of cycles is 40; 5min at 72 ℃; and finishing at 10 ℃.
Further, the sequencing conditions of step (4): 20min at 96 ℃, 30s at 50 ℃ and 1min at 60 ℃ for 45s for 25 cycles.
Has the advantages that: the kit is a HLA-B locus allele typing kit prepared for the first time based on a gene sequencing method, and comprises an amplification primer covering an HLA-B locus and sequencing primers aiming at exons 2,3 and 4, so that various allele types of the HLA-B locus can be directly analyzed, the interference of gene sequences of HLA-A and C loci with extremely high homology with the allele types is avoided, and the accuracy of a typing result is improved. Drawings
FIG. 1 is an electrophoresis diagram of the product of DNA amplification reaction of HLA-B site.
FIG. 2 is a graph of the sequencing of exon 2 of HLA-B locus showing the results of B locus allelic typing: HLA-B15: 01, B51: 01, arrows indicate exon 2 regions within the black bar.
FIG. 3 is a graph of the sequencing of exon 3 of HLA-B locus showing the results of B locus allelic typing: HLA-B46: 01, arrows indicate the 3 rd exon region within the black bar.
FIG. 4 is a graph of the sequencing of exon 4 of HLA-B locus showing the results of B locus allelic typing: HLA-B46: 01, B51: 01, arrows indicate the 4 th exon region within the black bar.
Figure 5 is a schematic representation of the HLA naming convention of the WHO.
Detailed Description
The present invention is further described below with reference to specific examples, which are only exemplary and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.
Example 1
An HLA-B locus allele typing kit comprises amplification primers for amplifying 2 nd, 3 rd and 4 th exon regions covering the HLA-B locus and specific sequencing primers aiming at the 2 nd, 3 rd and 4 th exon regions respectively;
the nucleotide sequence of the amplification primer is as follows:
an upstream primer BF: TCTCAGGGTCTCAGGGTCCG, as shown in SEQ ID NO. 1;
a downstream primer BR: CAGCCAGGCCAGCAACAATG, as shown in SEQ ID NO. 2;
sequencing primers for exon 2 were as follows:
upstream primer B2F: CCCAGGCTCCCACTCCAT, as shown in SEQ ID NO. 3;
the downstream primer B2R: GGGGAGTCGTGACCTGC, as shown in SEQ ID NO. 4;
sequencing primers for exon 3 were as follows:
upstream primer B3F: GGCCAGGGTCTCACA, as shown in SEQ ID NO. 5;
the downstream primer B3R: GGCGACATTCTAGCGC, as shown in SEQ ID NO. 6;
sequencing primers for exon 4 were as follows:
upstream primer B4F: AGATGCAAAGCGCCTGAA, as shown in SEQ ID NO. 7;
the downstream primer B4R: GGCTCCTGCTTTCCCTGA, as shown in SEQ ID NO. 8.
The kit covers an amplification system of exon regions 2,3 and 4 of an HLA-B locus and comprises: mu.L of 10. mu.M BF primer 0.6. mu.L, 10. mu.M BR primer 0.6. mu.L, 10 XBuffer 2. mu. L, dNTP 0.4. mu.L, hot start Taq enzyme 0.2. mu. L, DNA 2. mu. L, H2O14.2 mu L, the total volume is 20 mu L;
the sequencing system of the kit for the 2 nd, 3 rd and 4 th exon regions comprises: forward and reverse sequencing primers 10. mu.M 0.7. mu. L, Bigdye 4. mu. L, H for exon 2 (B2F/B2R), exon 3 (B3F/B3R) and exon 4 (B4F/B4R), respectively2O3.3. mu.L, product 2. mu.L, total volume 10. mu.L.
Example 2
The detection method for HLA-B locus allelic gene typing by using the kit comprises the following steps:
(1) extraction of DNA: DNA was extracted at a concentration of not less than 10 ng/. mu.L according to the instructions of the apparatus and kit.
(2) Amplifying the DNA sample extracted in the step (1) by using amplification sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2 to obtain a DNA sequence covering HLA-B sites and containing exon regions 2,3 and 4; amplification was performed using a Perkin elmer geneamp 9700 PCR amplificator, PCR reaction conditions: 5min at 95 ℃; 30s at 95 ℃, 25 s at 63 ℃ and 2min at 72 ℃ for 30s, and the total number of cycles is 40; 5min at 72 ℃ and forever at 10 ℃.
(3) Electrophoresis: preparing 1.0-1.5% agarose gel, adding PCR product and 1 Xgel sample-adding buffer solution, mixing, and performing electrophoresis for 10-15 min to obtain an electrophoresis chart shown in FIG. 1; imaging by an ultraviolet imager, judging the specificity of a target band by taking a picture and judging the result, wherein the PCR amplification product is 2KB, and analyzing the specificity and brightness of the product and whether a non-specific band or a primer dimer exists.
(4) Product digestion: adding 2.5 mu L of shrimp alkali enzyme into 18 mu L of product, placing the product in a PCR instrument, and reacting under the following conditions: 20min at 37 ℃, 20min at 80 ℃ and forever at 10 ℃.
(5) Sequencing the digested PCR product in the step (4) by utilizing sequencing primers shown in SEQ ID NO. 3-8 to sequence exons 2,3 and 4 respectively to obtain a sequencing product; sequencing PCR reaction conditions: 20min at 96 ℃, 30s at 50 ℃ and 1min at 60 ℃ for 45s, for 25 cycles.
(6) And (3) purifying a product: adding 2 mul of sodium acetate and EDTA into 10 mul of product, mixing, centrifuging, adding 25 mul of absolute ethyl alcohol, mixing uniformly for 2min at 2000r/min in an oscillator, placing in a horizontal centrifuge, centrifuging for 12min at 2000g, and reversing and throwing a plate after centrifuging; adding 45 μ L of 80% anhydrous ethanol, centrifuging at 2000g for 5min, and reversing the throwing plate; adding 10. mu.L of HiDi, and denaturing at 37 ℃ for 2min in a PCR instrument.
(7) Sequencing: compiling a sequencing plate number, sequencing by using an ABI 3730XL type sequencer, wherein the sample injection amount is 5-8 muL, the sample injection time is 10-20 seconds, and the measured HLA-B locus 2 nd, 3 rd and 4 th exon sequencing graphs are respectively shown in figures 2-4.
(8) Data acquisition: reading sequencing data, comparing with HLA data for base sequence, and analyzing to obtain HLA-B
Locus allelic type. Table 1 shows the results of HLA-B locus allele typing of 100 unrelated individuals.
TABLE 1 HLA-B locus genotyping (n =50)
The advantages and innovation points of the invention are as follows:
the allele counts of HLA-B loci increased with the updating of IMGT database, and 7431, 4739 of them with protein function (www. ebi. ac. uk/ipd/IMGT/HLA), were published in 6 months in 2020
Html). According to the rules of the WHO for HLA nomenclature, the functional alleles of HLA-B sites need to be clearly distinguished, and as shown in the diagram of FIG. 5, HLA-A02: 101, i.e., different functional alleles must be distinguished.
1. The technical characteristics are as follows: the invention realizes the allele typing method with the highest definition and the highest resolution of the HLA-B locus,
compared with the conventional HLA high-resolution typing method, the method can clearly distinguish two alleles on two chromosomes derived from parental inheritance by human beings through one-time detection, and overcomes the defects that two pyramids can be combined and the alleles cannot be distinguished in the conventional high-resolution typing method. The method for comparing the base sequences is used for analyzing and judging the HLA-B locus allele typing result, not only determining whether the obtained base sequences are consistent with or wrong with the database sequences, but also distinguishing single peak or double peaks and peak heights and finding some new alleles. Therefore, the invention has the functions of intuition, definition and automatic comparison for the analysis of the experimental result. See fig. 2,3, 4.
2. Clinical advantages are as follows: for example, the following steps are carried out: for example, HLA-B27: 04 and HLA-B27: 0,6, are common HLA-B27 subtype in Chinese population in an autoimmune ankylosing spondylitis disease characterized primarily by inflammatory lesions of the medial axis spinal and sacral hip joints and their appendages: b27: 04, B27: 05, B27: 07, B27: 27 are pathogenic genes, and B27: 06, B27: 09 are protective genes. Therefore, by applying the kit and the detection method thereof, 4 thousand HLA-B locus alleles can be accurately distinguished, the disease diagnosis is accurate and rapid, and the purpose of large-scale detection is achieved.
Sequence listing
<110> Suzhou university affiliated first hospital
<120> HLA-B locus allele typing kit and detection method thereof
<141>2020-07-31
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>1
tctcagggtc tcagggtccg 20
<210>2
<211>20
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>2
<210>3
<211>18
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>3
<210>4
<211>17
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>4
ggggagtcgt gacctgc 17
<210>5
<211>15
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>5
ggccagggtc tcaca 15
<210>6
<211>16
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>6
ggcgacattc tagcgc 16
<210>7
<211>18
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>7
<210>8
<211>18
<212>DNA
<213> Artificial sequence (chemical Synthesis)
<400>8
Claims (6)
1. An HLA-B locus allele typing kit characterized by: comprises amplification primers for amplifying the 2 nd, 3 rd and 4 th exon regions covering the HLA-B locus and specific sequencing primers aiming at the 2 nd, 3 th and 4 th exon regions respectively;
the nucleotide sequence of the amplification primer is as follows:
an upstream primer BF: TCTCAGGGTCTCAGGGTCCG, as shown in SEQ ID NO. 1;
a downstream primer BR: CAGCCAGGCCAGCAACAATG, as shown in SEQ ID NO. 2;
sequencing primers for exon 2 were as follows:
upstream primer B2F: CCCAGGCTCCCACTCCAT, as shown in SEQ ID NO. 3;
the downstream primer B2R: GGGGAGTCGTGACCTGC, as shown in SEQ ID NO. 4;
sequencing primers for exon 3 were as follows:
upstream primer B3F: GGCCAGGGTCTCACA, as shown in SEQ ID NO. 5;
the downstream primer B3R: GGCGACATTCTAGCGC, as shown in SEQ ID NO. 6;
sequencing primers for exon 4 were as follows:
upstream primer B4F: AGATGCAAAGCGCCTGAA, as shown in SEQ ID NO. 7;
the downstream primer B4R: GGCTCCTGCTTTCCCTGA, as shown in SEQ ID NO. 8.
2. The HLA-B locus allele-typing kit according to claim 1, wherein: the amplification system covering the 2 nd, 3 rd and 4 th exon regions of the HLA-B site comprises: upstream primer BF, downstream primer BR, 10 XBuffer, dNTP, Taq enzyme and DNA sample.
3. The HLA-B locus allele-typing kit according to claim 1, wherein: the sequencing system for the 2 nd, 3 th and 4 th exon regions comprises: PCR amplification products, B2F/B2R, B3F/B3R, B4F/B4R sequencing primers and Bigdye.
4. A method for detecting an allelic type of HLA-B locus using the kit according to any one of claims 1 to 3, wherein: the method comprises the following steps:
(1) extracting DNA;
(2) amplifying the DNA sample extracted in the step (1) by using amplification sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2 to obtain a DNA sequence covering HLA-B sites and containing exon regions 2,3 and 4;
(3) carrying out electrophoresis on the PCR product amplified in the step (2) by using agarose gel, separating a target band according to the size and the position of the target band, adding shrimp alkaline enzyme into the target band for digestion, and then respectively carrying out sequencing reaction;
(4) sequencing the digested PCR product in the step (3) by utilizing sequencing primers shown in SEQ ID NO. 3-8 to sequence exons 2,3 and 4 respectively to obtain a sequencing product;
(5) purifying and denaturing the sequencing product obtained in the step (4), and then sequencing by using a sequencer; and comparing the sequence obtained by sequencing with an HLA-IMGT database and analyzing to obtain the HLA-B locus allele type.
5. The detection method according to claim 4, wherein the amplification conditions of step (2): 5min at 95 ℃; 30s at 95 ℃, 25 s at 63 ℃ and 2min at 72 ℃ for 30s, and the total number of cycles is 40; 5min at 72 ℃; and finishing at 10 ℃.
6. The detection method according to claim 4, wherein the sequencing conditions of step (4): 20min at 96 ℃, 30s at 50 ℃ and 1min at 60 ℃ for 45s for 25 cycles.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010758304.XA CN111793681B (en) | 2020-07-31 | 2020-07-31 | HLA-B locus allele typing kit and detection method thereof |
| AU2021205090A AU2021205090A1 (en) | 2020-07-31 | 2021-07-15 | Hla-b locus allele typing kit and test method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010758304.XA CN111793681B (en) | 2020-07-31 | 2020-07-31 | HLA-B locus allele typing kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111793681A true CN111793681A (en) | 2020-10-20 |
| CN111793681B CN111793681B (en) | 2023-08-25 |
Family
ID=72828142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010758304.XA Active CN111793681B (en) | 2020-07-31 | 2020-07-31 | HLA-B locus allele typing kit and detection method thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN111793681B (en) |
| AU (1) | AU2021205090A1 (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892317A (en) * | 2010-07-29 | 2010-11-24 | 苏州大学 | HLA high-resolution gene sequencing kit |
| CN109355366A (en) * | 2018-12-26 | 2019-02-19 | 银丰基因科技有限公司 | HLA-B high-resolution gene sequencing kit |
-
2020
- 2020-07-31 CN CN202010758304.XA patent/CN111793681B/en active Active
-
2021
- 2021-07-15 AU AU2021205090A patent/AU2021205090A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892317A (en) * | 2010-07-29 | 2010-11-24 | 苏州大学 | HLA high-resolution gene sequencing kit |
| CN109355366A (en) * | 2018-12-26 | 2019-02-19 | 银丰基因科技有限公司 | HLA-B high-resolution gene sequencing kit |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2021205090A1 (en) | 2022-02-17 |
| CN111793681B (en) | 2023-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Clifford et al. | Genetic variations at loci involved in the immune response are risk factors for hepatocellular carcinoma | |
| Zhang et al. | Genetic studies of human diversity in East Asia | |
| Fowler et al. | Genome wide analysis reveals single nucleotide polymorphisms associated with fatness and putative novel copy number variants in three pig breeds | |
| CN101892317A (en) | HLA high-resolution gene sequencing kit | |
| WO2014065410A1 (en) | Method and kit for dna typing of hla gene | |
| Wang et al. | Common variants in the ATP2B1 gene are associated with hypertension and arterial stiffness in Chinese population | |
| Bashirova et al. | Population-specific diversity of the immunoglobulin constant heavy G chain (IGHG) genes | |
| Wang et al. | Copy number variation detection via high-density SNP genotyping | |
| CN112226440B (en) | Pathogenic mutation of hereditary primary infertility and detection reagent thereof | |
| CN113444838A (en) | Molecular marker for detecting COVID-19 susceptibility, kit and application | |
| Simtong et al. | RHD 1227 A and hybrid Rhesus box analysis in Thai RhD+ and RhD-blood donors: prevalence, RHD zygosity, and molecular screening | |
| CN105177152B (en) | Detect the method and primer of HLA-B*51 allele | |
| CN111793681B (en) | HLA-B locus allele typing kit and detection method thereof | |
| CN108441547B (en) | Primer group, kit and method for HLA gene amplification and genotyping | |
| Cornaby et al. | HLA Typing by next-generation sequencing: lessons learned and future applications | |
| CN110499368A (en) | One kind SNP marker relevant to carcinoma of mouth prognosis prediction and its application | |
| CN112980949B (en) | SNP marker for identifying nasopharyngeal carcinoma high-risk group, kit and application thereof | |
| CN106119406B (en) | Genotyping diagnostic kit for multiple granulomatous vasculitis and arteriolositis and using method thereof | |
| CN108424959B (en) | Biomarker for early diagnosis of ankylosing spondylitis and application of biomarker in kit | |
| Höher et al. | Identification of ACKR1 variants associated with altered Duffy phenotype expression in blood donors from southern Brazil | |
| US20220068433A1 (en) | Computational detection of copy number variation at a locus in the absence of direct measurement of the locus | |
| CN109097464B (en) | Application of SNP (single nucleotide polymorphism) site of CFAP43 gene | |
| JP4381424B2 (en) | HLA novel gene | |
| CN110144404B (en) | New mutation SNP site of breast cancer treatment gene TFR2 and application thereof | |
| D'Orio et al. | Troubleshooting and challenges of Next-generation sequencing technology in forensic use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |