CN114836531A - SNP locus for detecting Bombay-like blood type variants - Google Patents

Abstract

The invention provides an SNP locus for detecting a blood group variant of a Bombay type, wherein the provided SNP locus is positioned in a coding region sequence of a 4 th exon of a human FUT1 gene with a nucleotide sequence of SEQ ID NO. 1; comprises 35 th base nt35C > T; nt422 of base 422, 422G > T; nt422G at base 803 > T. The invention also provides the application of the preparation for detecting the SNP locus in preparing products for detecting the Bombay blood type. The invention provides an effective way for diagnosing the Bombay-like type gene by detecting and screening the obtained gene polymorphic site, and the application effect shows that the gene polymorphic site and the detection primer provided by the invention can be effectively used for rapid detection of the Bombay-like type gene of blood donors and clinical patients.

Description

SNP locus for detecting Bombay-like blood type variants

Technical Field

The invention belongs to the technical field of gene diagnosis products, and particularly relates to an SNP locus for detecting a Bombay blood type variant, a molecular preparation for detecting the SNP locus and application thereof.

Background

The blood group system is a classification system established by typing blood according to the difference of antigens on red blood cell membranes. By 2 months 2021, the international blood transfusion society (ISBT) has identified a total of 43 human erythroid blood group systems. The H antigen belongs to the Hh blood group system, is closely related to ABO blood group and Lewis blood group system, and is positioned on the oligosaccharide branched chain molecular structure outside the erythrocyte membrane.

The Hh blood group system mainly comprises of the two phenotypes of bombyx and bombyx-like, which are represented by complete or partial deletion of H antigen on erythrocytes. There are two closely linked gene loci on chromosome 19: h gene and Se gene. The H gene is also called FUT1 gene, the Se gene is also called FUT2 gene, and each of the two genes codes for an alpha-2-fucosyltransferase. The substrate of alpha-2-fucosyltransferase encoded by the H (FUT1) gene is a type 2 sugar chain, and an H epitope is synthesized. The substrates of alpha-2-fucosyltransferase encoded by the Se (FUT2) gene are type 1 and type 2 sugar chains. The FUT1 gene has strong polymorphism, and the polymorphism is related to the distribution of people.

The molecular biological mechanism of the Monsanto-like type shows stronger characteristics related to different population distributions. In 1961, Levine found 1 specific blood group in zeekman, and the red blood cells of this individual did not have H antigen, much like monty type, but unlike monty type, there was a small amount of a antigen present on the red blood cells, and Levine called monty-like type. The existence of the Bombay-like form was subsequently found in Japan, Thailand, Singapore, France, Indiana, USA. In 1979, Zhang Gong beam and the like found the first Bombay blood type in China, and then, tens of Bombay blood types were reported in succession in China. The data show that the Monsanto-like forms in the Japanese population range from about l to 2/300000, hong Kong in 1/15620, and Taiwan in 1/8000. In 1994, Kelly et al first reported the molecular mechanisms of the bombyx and bombyx blood groups, indicating that the bombyx-like is due to mutations in the FUTl gene.

Most individuals with erythrocyte H deficiency are homozygous for one mutation, but some are heterozygous for two different recessive mutations. Studies have shown that the FUT1 gene has 4 exons, and that the protein coding sequence is located in exon 4. Wherein the glycosyltransferase molecule consists of 365 amino acids. Whereas the FUT2 gene contains 2 exons, exon 1 is 7kb upstream of exon 2, all protein coding sequences are located in exon 2, and the glycosyltransferase molecule consists of 332 amino acid residues.

Due to the lack of H antigen on erythrocytes, the presence of anti-HI antibodies in serum, conventional ABO blood group testing tends to mistake the bombyx blood group as O, which if infused into O erythrocytes causes hemolytic transfusion reactions. To further address the clinical transfusion problem of mengamic individuals, extensive molecular mechanistic studies of various H-deficiency phenotypes are required.

Disclosure of Invention

The invention aims to provide an SNP locus for detecting a Bombay blood type variant, a molecular preparation for detecting the SNP locus and application thereof.

The invention firstly provides SNP loci related to the blood group variation of the Bombay type, and the provided SNP loci are positioned in the coding region sequence of the No. 4 exon of a human FUT1 gene (NCBI accession number is NG _007510.1) with the nucleotide sequence of SEQ ID NO. 1; comprises 35 th base nt35C > T; nt422 of base 422, 422G > T; nt803G > T at position 803;

ATGTGGCTCCGGAGCCATCGTCAGCTCTGCCTGGCCTTCCTGCTAGTCTGTGTCCTCTCTGTAATCTTCTTCCTCCATATCCATCAAGACAGCTTTCCACATGGCCTAGGCCTGTCGATCCTGTGTCCAGACCGCCGCCTGGTGACACCCCCAGTGGCCATCTTCTGCCTGCCGGGTACTGCGATGGGCCCCAACGCCTCCTCTTCCTGTCCCCAGCACCCTGCTTCCCTCTCCGGCACCTGGACTGTCTACCCCAATGGCCGGTTTGGTAATCAGATGGGACAGTATGCCACGCTGCTGGCTCTGGCCCAGCTCAACGGCCGCCGGGCCTTTATCCTGCCTGCCATGCATGCCGCCCTGGCCCCGGTATTCCGCATCACCCTGCCCGTGCTGGCCCCAGAAGTGGACAGCCGCACGCCGTGGCGGGAGCTGCAGCTTCACGACTGGATGTCGGAGGAGTACGCGGACTTGAGAGATCCTTTCCTGAAGCTCTCTGGCTTCCCCTGCTCTTGGACTTTCTTCCACCATCTCCGGGAACAGATCCGCAGAGAGTTCACCCTGCACGACCACCTTCGGGAAGAGGCGCAGAGTGTGCTGGGTCAGCTCCGCCTGGGCCGCACAGGGGACCGCCCGCGCACCTTTGTCGGCGTCCACGTGCGCCGTGGGGACTATCTGCAGGTTATGCCTCAGCGCTGGAAGGGTGTGGTGGGCGACAGCGCCTACCTCCGGCAGGCCATGGACTGGTTCCGGGCACGGCACGAAGCCCCCGTTTTCGTGGTCACCAGCAACGGCATGGAGTGGTGTAAAGAAAACATCGACACCTCCCAGGGCGATGTGACGTTTGCTGGCGATGGACAGGAGGCTACACCGTGGAAAGACTTTGCCCTGCTCACACAGTGCAACCACACCATTATGACCATTGGCACCTTCGGCTTCTGGGCTGCCTACCTGGCTGGCGGAGACACTGTCTACCTGGCCAACTTCACCCTGCCAGACTCTGAGTTCCTGAAGATCTTTAAGCCGGAGGCGGCCTTCCTGCCCGAGTGGGTGGGCATTAATGCAGACTTGTCTCCACTCTGGACATTGGCTAAGCCTTGA(SEQ ID NO:1)。

the invention provides the application of the preparation for detecting the SNP locus in preparing products for detecting the Bombay blood type;

the preparation is specifically described as a PCR amplification or sequencing primer in one embodiment of the invention;

specifically, the primer set has the following specific sequence information:

FUT1-4F:5′-TGGGACTAAGGAGTGCTGCA-3′(SEQ ID NO:2)、

FUT1-4R:5′-TCTCCAACTCTCCCAACTAGAATCA-3′(SEQ ID NO:3)。

the product is a PCR amplification sequencing detection kit.

The invention provides an effective way for diagnosing the Bombay-like type gene by detecting and screening the obtained gene polymorphic site, and the application effect shows that the gene polymorphic site and the detection primer provided by the invention can be effectively used for rapid detection of the Bombay-like type gene of blood donors and clinical patients.

Drawings

FIG. 1: example 1 (proband) direct sequencing of the Monsanta blood type FUT1, proband FUT1 gene encoding region was heterozygous at CT, GT, and GT, 35, 422, 803 from the start codon.

FIG. 2: example 1 (proband) clone sequencing of the Bombay blood group FUT1, proband FUT1 has one allele coding region with 35 th base C > T and 803 th base G > T from the start codon.

FIG. 3: example 1 (proband) clone sequencing of the Bombay blood group FUT1, proband FUT1 has another allele-encoding region with bases G > T at 422 from the start codon.

Detailed Description

The applicant carries out the FUT1 gene sequencing on clinical patients suspected of being Bombay blood type in the result of blood group serology detection, and finds out the Bombay blood type caused by a new SNP locus, thereby leading to the invention.

The FUT1 gene is located in chromosome 19q13.3 region, can be transcribed into 1095bp mRNA (NCBI accession number NG _007510.1), and finally translated into protein consisting of 365 amino acids. Because of the lack of H antigen on erythrocytes in individuals of the bombyx-blood group, resulting in the production of immune anti-H antibodies in the serum, which can agglutinate with erythrocytes of all H antigen positive donors, resulting in severe hemolytic transfusion reactions, it is difficult to find a suitable blood for transfusion during clinical blood transfusion. The method for establishing the Bombay-like blood group gene detection system by adopting the molecular biology hand technique is applied to clinical blood transfusion and blood collection, is favorable for accurately detecting Bombay-like blood group individuals, prompts clinical patients to take autologous blood preparation as soon as possible or search suitable blood donor blood in a rare blood group bank, and reduces the occurrence of immune hemolytic blood transfusion reaction to the maximum extent.

The allele polymorphic site markers to which the present invention relates are explained as follows:

genetic polymorphisms are understood as meaning the simultaneous and frequent presence of two or more discrete variants or genotypes (genotypes) or alleles (alleles) in a biological population, also known as genetic polymorphisms (genetic polymorphisms). The nucleotide sequence of the coding sequence is changed by base substitution, deletion and insertion related to gene polymorphism, and the change of genetic code, fragment deletion in protein peptide chain, mRNA splicing abnormality, or mutation of promoter and mutation of non-transcription region are caused in the process of transcribing and translating synthetic protein, so that the transcription abnormality, activity enhancement or reduction of gene and the influence on the arrangement sequence of amino acids in polypeptide chain are caused.

The present invention will be described in detail with reference to examples.

Example 1: screening of Gene polymorphism site marker

1. Extracting peripheral blood genome DNA:

on the premise of meeting the national relevant policy, collecting 5mL of peripheral venous blood of a suspected Bombay-like blood type patient on the basis of obtaining the informed consent of a sampling object, placing the blood in an EDTA anticoagulation tube, placing 500 mu L of the blood in a centrifuge tube, adding an equal volume of erythrocyte lysate (pH8.0), uniformly mixing the blood for 5 minutes by vortex, centrifuging the blood for 5 minutes at 12000rpm, and discarding the supernatant. The erythrocyte lysate is added repeatedly at 500ul, vortexed for 5 minutes, centrifuged at 12000rpm for 5 minutes, and the supernatant is discarded. The precipitate was vortexed for 5 minutes, 50ul of lysis buffer was added, vortexed for 5 minutes, and placed in a 56 ℃ metal bath for 15 minutes. The sample was removed from the water bath and 135ul of protein remover was added. Vortex well and mix, and place at 4 ℃ for 30 min.

Centrifuge at 12000rpm for 5 minutes at room temperature and aspirate the supernatant (approximately 200ul) into a new centrifuge tube. Add 500ul of glacial ethanol, shake the centrifuge tube repeatedly until the white DNA precipitate is separated out. Centrifuge at 12000rpm for 2 minutes at room temperature and discard the supernatant. To the DNA precipitate was added 75% ethanol, rinsed once, centrifuged at 12000rpm for 3 minutes at room temperature, the supernatant was discarded, left to evaporate the remaining ethanol at room temperature, and finally 50. mu.L of TE (pH8.0) was added to dissolve the DNA overnight at 4 ℃. And (3) performing agarose gel electrophoresis on the extracted DNA, and performing color comparison at 260nm and 280nm by using an ultraviolet spectrophotometer to detect the purity and the concentration of the DNA.

2. Gene sequencing searched for FUT1 gene mutations:

PCR amplification of the fragment of interest: reaction conditions and reaction system:

(1) and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 10 min; 60 seconds at 94 ℃, 90 seconds at 63 ℃, 60 seconds at 72 ℃ and 10 cycles; 60 seconds at 94 ℃, 90 seconds at 61 ℃, 60 seconds at 72 ℃ and 25 cycles; extending for 10min at 72 ℃, and preserving the temperature of the amplification product at 10 ℃.

(2) Reaction system: (TAKARA Ex-Taq polymerase)

The amplification reaction of the genomic DNA template of the proband and the FUT1 primer was performed using this reaction system.

Sequencing a PCR product: the PCR products were sequenced by conventional Sanger sequencing method, and found in exon 4 of the proband FUT1 gene, the 35 th base CT was heterozygous, the 422 th base GT was heterozygous, and the 803 th base GT was heterozygous, as shown in FIG. 1. Further clone sequencing of exon 4 of FUT1 gene revealed that one allele: nt35C > T, nt803G > T, see FIG. 2; the other allele: nt422G > T, see FIG. 3.

In the SNP locus, the 35 th base C is mutated into T, so that the codon is mutated from GCC into GUC, the coded amino acid is converted from alanine (Ala) into valine (Val), the 803 th base G is mutated into T, so that the codon is mutated from UGU into UUU, and the coded amino acid is converted from cysteine (Cys) into phenylalanine (Phe), so that the conformation of the alpha-1, 2 fucosyltransferase protein is changed, and the weak expression of the H antigen is caused.

The 422 th base G of the other allele is mutated into T, so that the codon is mutated from TGG into TTG, and the coded amino acid is converted from tryptophan (Trp) into leucine (Leu), thereby causing the conformational change of the a-1,2 fucosyltransferase protein and causing the weak expression of H antigen.

The two mutated FUT1 alleles of proband are the molecular basis for proband to behave as a blood group like monte.

The multiple sequencing results show that the polymorphic gene is not caused by amplification or sequencing errors, and nt422G > T and nt803G > T are new mutation sites. This mutation is not present in the following four databases: single nucleotide polymorphism databases (ftp:// ftp. ncbi. nih. gov/snp/database /), thousand human genome project (ftp:// ftp-trace. ncbi. nih. gov/1000 genes/ftp /), Hapmap8 database (http:// Hapmap. ncbi. nlm. nih. gov /) and Yanhuang database (http:// yh. genomics. org. cn /), indicate that the mutation is very rare, and that the mutation causes inactivation of the fucosyltransferase of proband a-1,2, resulting in a Bomby blood group-like type.

Through the analysis, the method is proved to be capable of accurately determining the specific Bombay blood type genes, so that the blood type of a person to be determined can be more accurately determined, and the method has very important significance for a patient to formulate a reasonable blood transfusion scheme.

The proband family members collected in the research institute are extracted to obtain the peripheral blood genome DNA, the DNA is used as a template to amplify a PCR target fragment together with FUT1-4F and FUT1-4R primers, the PCR product is directly sequenced by using the pair of primers by a conventional Sanger sequencing method, and the 4 th exon of the FUT1 gene of the H blood type system of the other family member of the proband is found to have the gene heterozygosity of nt35CT, nt422GT and nt803 GT. And (3) continuously carrying out haplotype sequencing on the 4 th exon of the FUT1 gene on the family member with the mutation, carrying out PCR target fragment amplification by using the extracted genome DNA of the family member as a template and the primer, cloning the PCR product into a T carrier, selecting a plurality of colonies, carrying out haplotype sequence determination, and determining the haplotype sequence of the sample. Haplotype sequencing finds that the encoding regions of the family members FUT1 gene are nt35C > T, nt422G > T and nt803G > T, the encoded amino acids are respectively converted from alanine (Ala) to valine (Val), tryptophan (Trp) to leucine (Leu) and cysteine (Cys) to phenylalanine (Phe), so that the conformation of the alpha-1, 2 fucosyltransferase protein is changed, the weak expression of the H antigen is caused, and the expression is completely consistent with that of proband.

In summary, the Bombay blood type variant SNP site related in the invention can accurately confirm the red blood cell Bombay blood type, and the specific primer and the detection method can realize specific, sensitive and convenient detection of the Bombay blood type, and have very important significance for clinical transfusion safety.

Sequence listing

<110> Qingdao city central blood station

<120> SNP site for detecting Bombay-like blood group variants

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1098

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtggctcc ggagccatcg tcagctctgc ctggccttcc tgctagtctg tgtcctctct 60

gtaatcttct tcctccatat ccatcaagac agctttccac atggcctagg cctgtcgatc 120

ctgtgtccag accgccgcct ggtgacaccc ccagtggcca tcttctgcct gccgggtact 180

gcgatgggcc ccaacgcctc ctcttcctgt ccccagcacc ctgcttccct ctccggcacc 240

tggactgtct accccaatgg ccggtttggt aatcagatgg gacagtatgc cacgctgctg 300

gctctggccc agctcaacgg ccgccgggcc tttatcctgc ctgccatgca tgccgccctg 360

gccccggtat tccgcatcac cctgcccgtg ctggccccag aagtggacag ccgcacgccg 420

tggcgggagc tgcagcttca cgactggatg tcggaggagt acgcggactt gagagatcct 480

ttcctgaagc tctctggctt cccctgctct tggactttct tccaccatct ccgggaacag 540

atccgcagag agttcaccct gcacgaccac cttcgggaag aggcgcagag tgtgctgggt 600

cagctccgcc tgggccgcac aggggaccgc ccgcgcacct ttgtcggcgt ccacgtgcgc 660

cgtggggact atctgcaggt tatgcctcag cgctggaagg gtgtggtggg cgacagcgcc 720

tacctccggc aggccatgga ctggttccgg gcacggcacg aagcccccgt tttcgtggtc 780

accagcaacg gcatggagtg gtgtaaagaa aacatcgaca cctcccaggg cgatgtgacg 840

tttgctggcg atggacagga ggctacaccg tggaaagact ttgccctgct cacacagtgc 900

aaccacacca ttatgaccat tggcaccttc ggcttctggg ctgcctacct ggctggcgga 960

gacactgtct acctggccaa cttcaccctg ccagactctg agttcctgaa gatctttaag 1020

ccggaggcgg ccttcctgcc cgagtgggtg ggcattaatg cagacttgtc tccactctgg 1080

acattggcta agccttga 1098

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgggactaag gagtgctgca 20

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tctccaactc tcccaactag aatca 25

Claims (5)

1. An SNP site related to the blood group variation of the Bombay type is characterized in that the SNP site is positioned at the 35 th site of which the nucleotide sequence is SEQ ID NO. 1, and the basic group is 35C which is more than T; at position 422, the base is 422G > T; at position 803, the base is 422G > T.

2. Use of a preparation for detecting the SNP site according to claim 1 for the preparation of a product for detecting Bombay-type blood groups.

3. The use according to claim 2, wherein the agent is a PCR amplification or sequencing primer.

4. A product for detecting Bombay type blood, which is a detection kit comprising PCR amplification or sequencing primers for detecting the SNP site according to claim 1.

5. The article of claim 4, wherein the sequences of the primers at the upstream and downstream ends of the primer pair are SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

Images