KR102409336B1 - SNP markers for Immunoglobulin A (IgA) nephropathy and IgA vasculitis diagnosis and diagnosis method using the same - Google Patents

Abstract

The present invention relates to a SNP for diagnosing nephropathy and vasculitis and a method for diagnosing nephropathy and vasculitis using the same. The present inventors analyzed the genomes of patients with nephropathy and vasculitis. , found that rs2491835 and rs2502353 are closely related to patients with nephropathy and vasculitis, especially IgA nephropathy and IgA vasculitis, and can be used to develop genetic diagnostic reagents for diagnosing or predicting the onset of nephropathy and vasculitis. have.

Description

SNP markers for Immunoglobulin A (IgA) nephropathy and IgA vasculitis diagnosis and diagnosis method using the same

The present invention relates to a SNP for diagnosing IgA nephropathy and IgA vasculitis, and a method for diagnosing nephropathy and vasculitis using the same.

Immunoglobulin A nephropathy (IgAN) is a disease characterized by the deposition of immune complexes mainly composed of immunoglobulin A (IgA) in the glomeruli when a renal biopsy is performed, and is the most common among glomerular nephropathy. It is characterized by the presence of a predominantly IgA-containing immune complex in the glomerular mesangium upon renal biopsy.

Immunoglobulin A vasculitis (IgAV) is a vasculitis in which immunoglobulin A1 is deposited in small blood vessels. The skin, gastrointestinal tract, and arthritis are the most common symptoms. In the presence of glomerulonephritis, pathological findings on renal biopsy are similar, making it impossible to distinguish it from IgA nephropathy. IgA vasculitis replaced the existing name of Henoch-Schenlein purpura because it was found that the etiology is the abnormal deposition of immunoglobulin A on the blood vessel wall. It is believed that glycosylation at the end of the immunoglobulin hinge is significantly reduced or abnormally glycosylated immunoglobulin A increases in the body's serum, and antibodies against it are generated to cause inflammation in blood vessels.

IgAV and IgAN not only appear in twins or the same patient, but also show similar histological characteristics and IgA abnormalities, and thus have been considered related diseases. In particular, it is known that the serum level of galactose-deficient IgA is high in both groups of IgAN and IgAV nephropathy patients. In addition, genetic background is considered to be an important part in the development or progression of the disease, and although the prevalence of both diseases varies according to race, it is particularly high in Asians.

On the other hand, thanks to the development of genome research technology, the genome-wide association study (GWAS) method, which simultaneously examines the relationship between single nucleotide polymorphism (SNP) and disease occurrence in a person, is trending has been achieved Whole genome association analysis refers to a method of statistically analyzing associations with diseases by searching for the genotypes of about 500,000 to 2 million SNPs. To date, various genetic mutations have been discovered worldwide by this method, and attempts have been made to identify susceptibility genes to diseases using GWAS, but the decisive factor has not yet been identified.

Accordingly, the present inventors performed GWAS analysis and Sanger sequence analysis in detecting a variant using the same sample size to confirm the genotype related to Korean-specific IgA nephropathy and IgA vasculitis. By confirming the SNPs, the present invention was completed.

Journal of the Korean Society of Internal Medicine: Vol. 87, No. 4, 2014

Accordingly, it is an object of the present invention to select from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 To provide a composition for diagnosing or predicting the onset of a disease.

Another object of the present invention is to provide a kit for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising the composition.

Another object of the present invention is that when one or more single polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy , IgA vasculitis or IgA vasculitis with IgA nephropathy, IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy. to provide a way

Another object of the present invention is that when one or more single polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy , IgA vasculitis or IgA vasculitis with IgA nephropathy is necessary for predicting the onset of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy It provides a way to provide information.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, the present invention provides IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 It provides a composition for diagnosing or predicting the onset of a disease selected from the group.

In one embodiment of the present invention, the disease may occur in infants or children, but is not limited thereto.

In another embodiment of the present invention, the disease may occur in Koreans, but is not limited thereto.

In another embodiment of the present invention, the detection agent may be a probe capable of detecting one or more SNPs selected from the group consisting of rs9428555, rs2502349, rs2491835 and rs2502353, but is not limited thereto.

In another embodiment of the present invention, the detection agent may be a primer capable of detecting one or more SNPs selected from the group consisting of rs9428555, rs2502349, rs2491835 and rs2502353, but is not limited thereto.

In another embodiment of the present invention, the primer may include a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 and 2, but is not limited thereto.

The present invention also provides a kit for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising the composition.

In one embodiment of the present invention, the kit may be an RT-PCR kit or a microarray chip kit, but is not limited thereto.

In addition, in the present invention, when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA Necessary for diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy, comprising determining that the patient has a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy It provides a way to provide information.

In addition, in the present invention, when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA A disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining a high risk of contracting a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy. It provides a method for providing information necessary for predicting an outbreak.

In one embodiment of the present invention, the method includes sequencing, exome sequencing, microarray hybridization, allele specific PCR, dynamic allele hybridization technique ( dynamic allele-specific hybridization), PCR extension analysis, and Taqman technique may be performed by at least one method selected from the group consisting of, but not limited thereto.

In addition, the present invention provides a composition comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy. A diagnostic use of a disease is provided.

In addition, the present invention provides a composition comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy. Provided is a use for predicting the onset of a disease.

As a result of analyzing the protein coding region of the genomic DNA of patients with nephropathy and vasculitis, the present inventors found that dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353, which are single nucleotide polymorphism (SNP) sites, were found in nephropathy and vasculitis, particularly IgA nephropathy and IgA vasculitis. It has been identified that it is closely related to the patient, and it can be used to develop a genetic diagnostic reagent for diagnosing or predicting the onset of nephropathy and vasculitis.

1 is a diagram schematically illustrating a process for screening single nucleotide polymorphisms (SNPs) according to an embodiment of the present invention.

The present invention relates to the diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy comprising a detection agent for one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 It relates to a composition for predicting onset.

Hereinafter, the present invention will be described in detail.

As used herein, "polynucleotide" or "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in the form of single or double strands. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner analogous to naturally occurring nucleotides are also included. In general, DNA consists of four bases: adenine (A), guanine (G), cytosine (C), and thymine (T), and RNA consists of uracil (U) instead of thymine (Uracil, U). has a In a double-stranded nucleic acid, A forms a hydrogen bond with T or U, and C forms a hydrogen bond with G bases, and the relationship between these bases is called 'complementary'.

In the present specification, when expressing the mutation of a gene, 'c.' means a mutation in the protein coding region, and '(base position) (single nucleotide) (symbol >) (single nucleotide)' means at the base position It means that the preceding indicated base is replaced by the following indicated base.

As used herein, 'polymorphism' refers to the occurrence of two or more alternative sequences or alleles (or alleles) within a genetically determined population, and 'single nucleotide polymorphism (SNP)' refers to one polymorphism of the base. Specifically, a single base (A, T, C, or G) in the genome refers to the diversity of DNA sequences that occur between members of a species or between chromosomes of an individual. For example, when three DNA fragments from different individuals (eg, AAGT[A/A]AG, AAGT[A/G]AG, AAGT[G/G]AG) contain differences in a single base , called two alleles (A or G), and in general almost all SNPs have two alleles. In addition, when the SNP is genetically closely related to a specific disease, the SNP is mutated in one base at a specific position compared to an identified normal or wild-type (WT) individual or allele. it also means

On the other hand, 'mRNA (messenger RNA or messenger RNA)' is an RNA that serves as a blueprint for polypeptide synthesis (protein translation, translation) by transferring the genetic information of the base sequence of a specific gene to the ribosome during protein synthesis. Using the gene as a template, single-stranded mRNA is synthesized through the transcription process.

As used herein, 'protein' is used interchangeably with 'polypeptide' or 'peptide', and for example, refers to a polymer of amino acid residues as commonly found in proteins in a natural state.

As used herein, the one letter (three letters) of an amino acid refers to the following amino acids according to standard abbreviation rules in the field of biochemistry: A(Ala): alanine; C(Cys): cysteine; D(Asp): aspartic acid; E(Glu): glutamic acid; F(Phe): phenylalanine; G(Gly): glycine; H(His): histidine; I(IIe): isoleucine; K(Lys): lysine; L(Leu): leucine; M(Met): methionine; N(Asn): asparagine; O(Ply): pyrrolysine; P(Pro): proline; Q(Gln): glutamine; R(Arg): arginine; S(Ser): serine; T(Thr): threonine; U(Sec):selenocysteine; V(Val): valine; W(Trp): tryptophan; Y (Tyr): Tyrosine.

“(Amino acid single letter) (amino acid position) (amino acid single letter)” as used herein means that the amino acid previously marked at the corresponding amino acid position of the wild-type protein is substituted with the amino acid post marked.

As used herein, the term "complementary" means that a targeting moiety in a nucleic acid molecule binds to a target (eg, a SNP of the present invention) under predetermined hybridization or annealing conditions, specifically physiological conditions (in a cell). It means that it is sufficiently complementary to selectively hybridize, can have one or more mismatched base sequences, and encompasses both substantially complementary and perfectly complementary. and, more specifically, means completely complementary.

In the present specification, the composition detects one or more SNPs selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 as a diagnostic marker.

In the present specification, SNP rs9428555 is one in which base 243071634 on chromosome 1 is substituted from A to G.

In the present specification, SNP rs2502349 is one in which base 243071698 on chromosome 1 is substituted from A to C.

In the present specification, SNP rs2491835 is one in which base 243071499 on chromosome 1 is substituted from A to T.

In the present specification, SNP rs2502353 is one in which base 243073112 on chromosome 1 is substituted from C to T.

As used herein, the term “detection” is meant to include both measuring and confirming the presence (expression) of a target substance, or measuring and confirming a change in the presence level (expression level) of a target substance. In the same context, measuring the expression level of the SNP in the present invention means measuring the expression level (ie, measuring the expression presence or absence), or measuring the level of qualitative and quantitative change of the SNP. The measurement may be performed without limitation, including both a qualitative method (analysis) and a quantitative method. Qualitative and quantitative methods for measuring the presence or absence of SNPs are well known in the art, and the experimental methods described herein are included therein. A specific SNP level comparison method for each method is well known in the art.

As used herein, the term “IgA nephropathy (IgAN)” is also called IgA nephropathy, and is the most common glomerulonephritis, a disease accompanied by deposition of polymeric IgA in mesangium and histological damage. The key etiology is that IgA1, an abnormal antibody lacking galactosylation, is produced from B cells.

As used herein, the term “IgA vasculitis (IgAV)” is also called Henoch-Schoonrein purpura, and may occur rarely in adults or vasculitis commonly seen in children. IgA vasculitis is a systemic vasculitis that invades small blood vessels due to the deposition of immune complexes including IgA. Typical symptoms include purpura, arthralgia, abdominal pain and gastrointestinal bleeding, nephritis, and, rarely, central nervous system involvement and pulmonary hemorrhage. Renal involvement is a serious complication that can progress to end-stage renal failure and, depending on the severity, has a major impact on long-term prognosis.

In the present specification, the disease may be infant or childhood nephropathy and/or vasculitis, but is not limited thereto. The infant or child may mean a person under the age of 18, but is not limited thereto.

As used herein, the term “diagnosis” refers to determining the susceptibility of a subject to a specific disease or disorder, determining whether an object currently has a specific disease or disorder, or having a specific disease or disorder. It is a concept that includes both determining the prognosis of an object, or therametrics (eg, monitoring the condition of an object to provide information on treatment efficacy). In the present specification, the diagnosis may preferably mean an early diagnosis or an onset prediction, but is not limited thereto.

In the present specification, the diagnosis means diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy. The disease in the present invention may preferably be hereditary IgA nephropathy and/or IgA vasculitis caused by a genetic factor, and the symptoms are aggravated by adding environmental influences to the genetic predisposition. it could be

As used herein, a 'primer' is a short single-stranded oligonucleotide that serves as a starting point of DNA synthesis. The primer specifically binds to a polynucleotide as a template under suitable buffer and temperature conditions, and DNA polymerase adds a nucleoside triphosphate having a base complementary to the template DNA to the primer to link it. is synthesized A primer generally consists of a sequence of 15 to 30 bases, and the melting temperature (Tm) at which it binds to the template strand varies depending on the base composition and length. The sequence of the primer does not need to have a completely complementary sequence to a partial nucleotide sequence of the template, and it is sufficient if it hybridizes with the template and has sufficient complementarity within a range capable of performing an intrinsic function of the primer. Therefore, in the present invention, the primer pair, which is the detection agent according to the present invention, can be easily designed with reference to the nucleotide sequence of the cDNA or genomic DNA of the SNP site. A primer for detecting SNP does not need to have a sequence that is perfectly complementary to each gene sequence, and if it has a length and complementarity suitable for the purpose of measuring the amount of mRNA by amplifying a specific section of mRNA or cDNA through DNA synthesis Suffice. The primers for the amplification reaction are composed of a set (pair) that complementarily binds to the template (or sense) and the opposite side (antisense) of both ends of a specific section of the mRNA to be amplified.

In the present specification, a 'probe' refers to RNA or DNA having a length of several to hundreds of base pairs that can specifically bind to mRNA, cDNA (complementary DNA), DNA of a specific gene, etc. It refers to a fragment of a polynucleotide, and is labeled so that the presence or absence of the target mRNA or cDNA to be bound to, the amount of expression, etc. can be checked. Probe selection and hybridization conditions can be appropriately selected according to techniques known in the art. The probe may be used in a diagnostic method for detecting an allele (or allele, allele). The diagnostic methods include detection methods based on hybridization of nucleic acids, such as Southern blot, and may be provided in a form previously bound to a substrate of a DNA chip in a method using a DNA chip. In the present invention, the primer or probe may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods.

In the present specification, the primer or probe may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods. In addition, primers or probes can be variously modified according to methods known in the art within a range that does not interfere with hybridization with a polynucleotide to be detected. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc. ) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.), and fluorescence or enzymatic binding of a labeling material.

The present invention also provides a kit for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising the composition.

In the present specification, the kit may be an RT-PCR kit or a microarray chip kit, but is not limited thereto.

The kit is IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy by amplifying the SNP marker, a diagnostic marker for a disease selected from the group consisting of, or by checking the expression level of the mRNA by checking the expression level of the SNP marker. The onset of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy can be predicted or diagnosed early.

The RT-PCR kit may include each pair of primers capable of amplifying a nucleic acid comprising the SNP site, other test tubes or other suitable containers, reaction buffers, deoxynucleotides (dNTPs), Taq-polymerization enzymes and enzymes such as reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. In addition, a primer pair specific for a gene used as a quantitative control may be included.

The microarray chip kit may include a microarray having a substrate on which a nucleic acid including the SNP site is immobilized. The microarray may be composed of a conventional microarray except that the polynucleotide, primer, or probe of the present invention is included. Hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art. In the detection, for example, a nucleic acid sample is labeled with a fluorescent material, for example, a label capable of generating a detectable signal including a material such as Cy3 and Cy5, and then hybridized on a microarray and the labeling material A hybridization result can be detected by detecting a signal generated from

As used herein, the term “subject” or “subject” refers to a subject for predicting or diagnosing an onset.

In the present invention, the "sample" can be used without limitation as long as it is collected from a subject to predict or diagnose the onset, for example, cells or tissues obtained by biopsy, blood, whole blood, serum, plasma, saliva, cerebrospinal fluid, various secretions, It may be urine, feces, etc. Preferably, it may be selected from the group consisting of blood, plasma, serum, saliva, nasal fluid, sputum, ascites, vaginal secretion and urine, and preferably blood, plasma, serum, kidney tissue or renal glomerular tissue. The sample may be pretreated prior to use for detection or diagnosis. For example, it may include homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like.

In addition, in the present invention, when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA Necessary for diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis and IgA vasculitis with IgA nephropathy, comprising determining that the patient has a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy It provides a way to provide information.

In addition, in the present invention, when one or more single nucleotide polymorphisms selected from the group consisting of dbSNP databases rs9428555, rs2502349, rs2491835 and rs2502353 exist in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject has IgA nephropathy, IgA A disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining a high risk of contracting a disease selected from the group consisting of vasculitis and IgA vasculitis with IgA nephropathy. It provides a method for providing information necessary for predicting an outbreak.

In the present specification, the method includes sequencing, exome sequencing, microarray hybridization, allele specific PCR, and dynamic allele-specific hybridization technique. hybridization), PCR extension analysis, and Taqman technique may be performed by one or more methods selected from the group consisting of, but not limited thereto.

Since the present invention can apply various transformations and can have various embodiments, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, it should be understood to include all modifications, equivalents and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experimental method

1.1 Target

A total of 127 people with informed consent were enrolled in this study. A total of two-step analysis was performed. Stage 1 (discovery cohort) consisted of 101 cases, and stage 2 (validation cohort, validation cohort) performed replication analysis of the most significant SNPs identified in the discovery cohort in 26 additional cases . Whole genome sequencing data (depth>30x) of 397 general Koreans evaluated in the Korean Standard Genome Database (KRGDB; http://coda.nih.go.kr/coda/KRGDB/) were used as a normal control set with approval. did 127 cases were IgAN (IgA Nephropathy) patients (n=57) diagnosed before the age of 18 and diagnosed at two pediatric kidney centers (Seoul National University Children's Hospital and Bucheon St. Mary's Hospital) or IgAV (IgA Vasculitis) with or without nephritis ) patients (n=70) were included. All IgAN patients were diagnosed by renal biopsy. The diagnosis of IgAV was made clinically, according to the International Rheumatology/Children's Rheumatology Laboratory/European Society for Pediatric Rheumatology criteria: purpura or petechial with inferior vena cava predominance and one of the following four symptoms. One or more (acute onset abdominal pain; histopathology presenting leukocytoclastic vasculitis or proliferative glomerulonephritis with predominant IgA deposition; arthralgia or arthritis; and symptoms such as renal involvement). Renal involvement, also called IgA nephropathy, is defined when an IgAV patient has proteinuria or hematuria during the course of the disease. IgAN or IgAV secondary to systemic lupus erythematosus, chronic hepatitis, diabetes or other conditions including cancer were excluded. Phase 1 included 48 IgAN patients, 10 IgAV patients and 43 IgAV nephropathy (IgAVN) patients. Phase 2 included 9 IgAN patients, 12 IgAV patients, and 5 IgAV nephropathy (IgAVN) patients. The study procedure was performed according to the Declaration of Helsinki. This study was approved by the institutional review committees of the Catholic University of Korea Bucheon St. Mary's Hospital (IRB No. HC18TNDI0012) and Seoul National University Hospital (1808-157-967). Written informed consent was obtained from all participants and their guardians.

1.2 Genotyping

Genomic DNA of subjects was extracted from peripheral blood samples collected in EDTA coated tubes. Genomic DNA samples were genotyped in Korea Biobank Array (DNA Link Inc., Seoul, Korea).

For the verification of the four SNP markers, genomic DNA of 14 samples already genotyped in the discovery stage and 26 samples not used in the discovery stage were separately prepared by Sanger sequencing (Cosmo GeneTech, Seoul, Korea). was genotyped.

rs4926802, rs147294199, rs9428555 및 rs11660485의 생어시퀀싱에 4개의 프라이머쌍을 사용하였다: ACTGAAAGCAATGGCTCAAAC(서열번호 1, rs9428555_F), GTGTCTGACTTACTTCACTTAATATGC(서열번호 2, rs9428555_R), GAGCCAGATGCCTTACACCA(rs4926802_F), TAAGACATTTCAATCCAGCACAGC(rs4926802_R), TTGGCAGCTGGACTTACTGTT(rs147294199_F ), CTTGGGATTCCTTCCAGGCT (rs147294199_R), and CATGGCCTTGATTCAATCCT (rs11660485_F), TTGGAACTTGGTGTAAATGAGA (rs11660485_R).

1.3 Candidate SNP Marker Identification and Statistical Analysis

Among the 827,783 SNP markers in the Korean Biobank Array, only autosomal SNPs assigned to 'recommended' in the SNPlisher package (Affymetrix) were selected. In addition, SNPs with genotype call rates <0.05, Hardy-Weinberg Equilibrium (HWE) p-value>10 ^-6 , and minor allele frequency (MAF) <0.001 were selected. After applying these filters, binding tests were performed on 509,500 SNP markers using PLINK 1.919. SNPs having a p-value of less than 5 × 10 ^-8 in the association test were judged as candidate SNPs.

Example 2. Confirmation of identification of four SNPs in the discovery phase

In the discovery phase, association tests were performed on 101 cases and 397 healthy controls based on more than 500 million SNP genotypes identified using the Korean Biobank Array.

Patient demographic and clinical information are summarized in Table 1.

In addition, as shown in Table 2, by applying a p-value <5 × 10 ⁻⁸ , four SNP markers were selected and considered as candidate markers for further validation.

Total
(n=127) Discovery stage (n=101) Validation stage (n=26) IgAN
(n=48) IgAVN
(n=43) IgAV
(n=10) IgAN
(n=9) IgAVN
(n=5) IgAV
(n=12) Demographics Sex(n, M/F) 76/51 32/16 26/17 4/6 5/4 2/3 7/5 Age at diagnosis(year)* 9.2
(6.4, 13.2) 12.5
(8.8, 15.3) 8.1
(6, 10.6) 5.8
(4.4, 7.9) 10.9
(6.3, 14) 7.9
(6.3, 16.4) 7.3
(5.4, 8.8) Age at sampling(year)* 10.1
(7, 14.2) 13.6
(9.9, 16.4) 9.3
(6.5, 12.3) 6.4
(4.5, 8.3) 13.5
(6.3, 16.4) 7.9
(6.3, 16.3) 7.4
(5.4, 8.8) Family history(n) 5 3 0 One 0 One 0 laboratory findings Serum creatinine (mg/dL)* 0.48
(0.4, 0.64) 0.6
(0.5, 0.81) 0.45
(0.39, 0.51) 0.39
(0.33, 0.46) 0.46
(0.35, 0.59) 0.48
(0.45, 0.55) 0.44
(0.37, 0.55) Serum albumin (g/dL)* 3.9
(3.3, 4.3) 3.9
(3.43, 4.2) 3.6
(3.15, 4.15) 4.55
(4.18, 4.83) 3.5
(3.25, 4.05) 4.05
(3.43, 4.43) 4.85
(4.73, 4.9) Urine protein to creatinine ratio* 1.49
(0.31, 3.39) 1.35
(0.36, 2.8) 2.67
(0.59, 5.11) 0.18
(0.15, 0.22) 1.74
(0.84, 2.52) 4.16
(1.3, 8.08) 0.24
(0.12, 0.32) pathologic findings n=48 n=20 n=9 n=4 Glomerulosclerosis (n, %) 26, 54.2% 12, 60% NA 4, 44.4% 1, 25% NA Diffuse mesangial hypercellularity (n,%) 32, 66.7% 14, 70% 7, 77.8% 2, 50% Tubular atrophy (n,%) 11, 22.9% 2, 10% 4, 44.4% 1, 25%

Chr Position dbSNP ID Gene major allele Minor allele MAF
(Case) MAF
(Control) One 47571902 rs4926802 CYP4Z1 T C 0.198 0.01511 One 55085605 rs147294199 FAM151A C T 0.2857 0.001259 One 243071634 rs9428555 intergenic A G 0.325 0.03526 18 42866471 rs11660485 SLC14A2 A C 0.2526 0.01008

Example 3. Verification of SNP rs9428555 through Sanger sequencing

To confirm whether the genotype identified by the array was correct, Sanger sequencing was performed on the four SNPs using genomic DNA samples already used in the discovery phase. Eight samples with minor allelic variant(s) were used for each SNP, for a total of 14 samples.

As a result, as shown in Table 3, it was verified that SNP rs9428555 was a significant marker.

Sample ID rs4926802 rs147294199 rs9428555 rs11660485 Array Sanger Array Sanger Array Sanger Array Sanger PE008 T C TT TT CC A G A G - - PE021 T C T C - - - - A C AA PE025 T C TT C T CC A G A G - - PE030 - - TT CC - - - - PE034 - - C T CC A G A G A C AA PE035 - - - - GG A G CC AA PE039 T C TT - - - - - - PE040 - - TT CC - - - - PE045 - - C T CC A G A G A C AA PE057 - - - - A G A G CC AA PE071 T C TT - - - - CC AA PE088 T C T C C T CC A G A G A C AA PE101 TC TT C T CC A G A G A C AA PE109 T C TT - - - - - -

Example 4. Confirmation of Sanger Sequencing Validation for Independent Samples

In the further validation phase, blood samples from 26 patients not included in the discovery phase were used. Although the number (n = 26) is relatively small, since the variation (rs9428555) is very rare in East Asia, it was judged that the verification using the number of cases was appropriate.

As a result, the MAF at the discovery stage was 0.2885, which was significantly higher than the MAF of all populations except Africans (East Asia MAF = 0.0278).

In addition, the MAF of IgAN (n=9) was 0.278, the MAF of IgAVN (n=5) was 0.2, and the MAF of IgAV (n=12) was 0.33, confirming that the results were similar.

In addition, as shown in Table 5, it was confirmed that 15 out of 26 patients had the minor allele (G) of the SNP marker.

In addition, as shown in Table 6, the LD (linkage disequilibrium) proxy result of rs9428555 based on the global population of 1000 genomes confirmed that rs2502349, rs2491835, and rs2502353 have a strong linkage relationship with rs9428555.

race 1000 genomes gnomAD genome Worldwide 0.1855 0.146 Africa 0.4887 0.4095 East Asia 0.0278 0.02191 Europe 0.0398 0.04778 South Asia 0.168 0 America 0.073 - latin - 0.06383 Ashkenaz Jews - 0.04514 Etc - 0.08564

Sample ID rs9428555 Sample ID rs9428555 VPE001 AA VPE014 AG VPE002 AA VPE015 AA VPE003 AA VPE016 AG VPE004 AA VPE017 AG VPE005 AG VPE018 AA VPE006 AA VPE019 AG VPE007 AG VPE020 AG VPE008 AG VPE021 AA VPE009 AG VPE022 AG VPE010 AA VPE023 AA VPE011 AG VPE024 AG VPE012 AG VPE025 AG VPE013 AA VPE026 AG

dbSNP ID Coordinate
in Chr 1 MAF Distance D' R ² Correlated
Alleles rs9428555
(query) 243071634 0.1855 0 One One A=A,G=G rs2502349 243071698 0.1859 64 One 0.9974 A=G,G=A rs2491835 243071499 0.1859 -135 One 0.9974 A=A,G=T rs2502353 243073112 0.1865 1478 One 0.9934 A=C,G=T

SNPs judged to have clinical significance in nephropathy, vasculitis, and vasculitis with nephropathy were selected according to the above embodiment. It is expected that it will be usefully used for predicting the outbreak.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION Dongguk University Industry-Academic Cooperation Foundation SNU R&DB FOUNDATION <120> SNP markers for Immunoglobulin A (IgA) nephropathy and IgA vasculitis diagnosis and diagnosis method using the same <130> MP20-106 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs9428555_F <400> 1 actgaaagca atggctcaaa c 21 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> rs9428555_R <400> 2 gtgtctgact tacttcactt aatatgc 27 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs4926802_F <400> 3 gagccagatg ccttacacca 20 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs4926802_R <400> 4 taagacattt caatccagca cagc 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs147294199_F <400> 5 ttggcagctg gacttactgt t 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs147294199_R <400> 6 cttgggattc cttccaggct 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs11660485_F <400> 7 catggccttg attcaatcct 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs11660485_R <400> 8 ttggaacttg gtgtaaatga ga 22

Claims (11)

A composition for diagnosing or predicting the onset of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising a detection agent of the dbSNP database rs9428555.
According to claim 1,
The disease is characterized in that the onset in infants or children, a composition for diagnosis or onset prediction.
According to claim 1,
The disease is characterized in that the onset in Koreans, diagnosis or onset prediction composition.
According to claim 1,
The detection agent is a probe capable of detecting rs9428555, diagnosis or onset prediction composition.
According to claim 1,
The detection agent is a primer capable of detecting rs9428555, diagnosis or onset prediction composition.
6. The method of claim 5,
The primer is a composition for diagnosis or onset prediction, characterized in that it comprises a base sequence selected from the group consisting of SEQ ID NOs: 1 and 2.
A kit for diagnosing a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising the composition of claim 1.
8. The method of claim 7,
The kit is an RT-PCR kit or a microarray chip kit, characterized in that the kit.
When a single polymorphism in the dbSNP database rs9428555 exists in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject is diagnosed with a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy. A method for providing information necessary for diagnosis of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining that the patient has IgA nephropathy.
When a single polymorphism in the dbSNP database rs9428555 exists in the nucleotide sequence of the SNP site in the sample obtained from the subject, the subject is diagnosed with a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy. A method of providing information necessary for predicting the onset of a disease selected from the group consisting of IgA nephropathy, IgA vasculitis, and IgA vasculitis with IgA nephropathy, comprising determining a high risk of developing the disease.
11. The method of claim 9 or 10,
The method includes sequencing, exome sequencing, microarray hybridization, allele specific PCR, dynamic allele-specific hybridization, and PCR. A method, characterized in that it is performed by at least one method selected from the group consisting of extension analysis and Taqman technique.

Images