CN111793636B

CN111793636B - Apple gene MdBT2 for regulating and controlling adventitious root development and application thereof

Info

Publication number: CN111793636B
Application number: CN202010742941.8A
Authority: CN
Inventors: 王小非; 郝玉金; 季兴龙
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2020-07-29
Filing date: 2020-07-29
Publication date: 2021-09-28
Anticipated expiration: 2040-07-29
Also published as: CN111793636A

Abstract

The invention discloses an apple gene MdBT2 for regulating and controlling adventitious root development and application thereof, wherein the nucleotide sequence of the apple gene MdBT2 is shown as SEQ.ID.NO. 1. The invention utilizes the transgenic technology of the 35S strong promoter driving principle to carry out excessive and inhibited expression on the MdBT2 gene in the apple to obtain transgenic apple material. Overexpression of MdBT2 in apples significantly suppressed the occurrence of adventitious roots, whereas suppression of expression promoted the occurrence of adventitious roots. The apple gene MdBT2 can directly optimize the generation of adventitious roots of apple tissue culture seedlings, and particularly can be widely applied to tissue culture and rapid propagation rooting of stocks and cultivars in fruit trees, so that the propagation efficiency of apple seedlings is improved, and the cost is reduced.

Description

Apple gene MdBT2 for regulating and controlling adventitious root development and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an apple gene MdBT2 for regulating and controlling adventitious root development and application thereof.

Background

The apple is an important fruit crop in the world, and the propagation of apple seedlings comprises seedling propagation, layering propagation and tissue culture rapid propagation. Compared with seedling and layering propagation, the tissue culture rapid propagation has the advantages of low cost, high propagation speed, no limitation of time and season and the like, and is a rapid propagation mode of seedlings which is developed at home at present. However, the tissue culture and rapid propagation of the virus-free seedlings have the rooting problem, and some varieties are not easy to root, so that the development of the virus-free seedlings is limited by the factor.

Disclosure of Invention

Aiming at the defects in the prior art, one MdBT2 protein is screened, and the suppression of MdBT2 expression in the apple can obviously promote the generation of adventitious roots of tissue culture seedlings of the apple, so that the rapid rooting method plays a positive role in the rapid rooting of tissue culture virus-free seedlings of apple varieties and the promotion of the development of tissue culture rapid propagation.

The specific technical scheme is as follows:

one of the purposes of the invention is to provide an apple gene MdBT2 for regulating and controlling the development of adventitious roots.

The nucleotide sequence of the apple gene MdBT2 is shown in SEQ ID No. 1.

The applicant of the present invention isolated and identified a novel gene MdBT2 regulating adventitious root development from apple. It was experimentally found that overexpression of MdBT2 showed a phenotype in which the time and number of adventitious roots formation was suppressed, whereas suppression of expression of MdBT2 showed a phenotype in which adventitious roots rapidly formed. The gene is shown to play an important role in regulating the development of adventitious roots.

The applicant of the invention extracts total RNA from Gala apple tissue culture seedlings and obtains cDNA through reverse transcription. Primers were designed based on the published apple genome database in the international gene bank, and conventional Polymerase Chain Reaction (PCR) was performed. And connecting the PCR product with a proper size with a pMD18-T vector, transforming escherichia coli DH5 alpha competent cells, screening recombinants, performing sequencing analysis and confirmation, and finally obtaining a cDNA full-length sequence.

The Open Reading Frame (ORF) of the gene is 1086 bp. It follows that this gene encodes 361 amino acids. The amino acid sequence of the gene is searched in an international gene bank, and the gene has higher homology with the published arabidopsis related gene AtBT2, so the applicant of the invention names the gene MdBT 2.

Furthermore, the amino acid sequence coded by the nucleotide sequence of the apple gene MdBT2 is shown in SEQ ID No. 2.

Further, the apple gene MdBT2 is from Gala apple.

The invention also aims to provide the application of the apple gene MdBT2 in regulating the development of adventitious roots of plants.

Furthermore, the apple gene MdBT2 is used for regulating and controlling the number of adventitious roots.

Specifically, the invention extracts the apple tissue culture leaf RNA, carries out reverse transcription on the apple tissue culture leaf RNA to obtain cDNA, and designs a full-length DNA sequence and an antisense DNA sequence of primer amplification MdBT 2. The nucleotide sequence of the antisense DNA is shown in SEQ ID No. 3. Positively inserting a total 1086bp fragment containing the MdBT2 gene coding region into an expression vector pRI to construct an over-expression vector; at the same time, the 512bp fragment of the antisense DNA is reversely inserted into an expression vector pRI to construct an antisense expression vector. And (3) obtaining the transgenic apple through agrobacterium-mediated infection.

As a result, compared with the wild type, the number of adventitious roots of the strain over-expressing MdBT2 is obviously inhibited, and the generation of the adventitious roots of the strain inhibiting MdBT2 expression is obviously promoted.

It is a further object of the present invention to provide a nucleic acid construct comprising the apple gene MdBT2 described above under the control of a strong promoter.

Further, the strong promoter is a cauliflower mosaic virus 35S promoter.

The invention has the following beneficial effects:

overexpression of MdBT2 in apples significantly suppressed the occurrence of adventitious roots, whereas suppression of expression promoted the occurrence of adventitious roots. The apple gene MdBT2 can directly optimize the generation of adventitious roots of apple tissue culture seedlings, and particularly can be widely applied to tissue culture and rapid propagation rooting of stocks and cultivars in fruit trees, so that the propagation efficiency of apple seedlings is improved, and the cost is reduced.

Drawings

FIG. 1 is a photograph comparing the effect of the overexpression and antisense expression lines on the development of adventitious roots in example 4;

FIG. 2 is a graph comparing the effect of the overexpression lines and the antisense expression lines on the number of adventitious roots in example 4;

in FIG. 1, MdBT2-anti13, MdBT2-anti23, GL3 (control), MdBT2-ox1, MdBT2-ox5 and MdBT2-ox7 are arranged from top to bottom in sequence.

Detailed Description

The principles and features of this invention are described below in conjunction with examples, which are set forth to illustrate, but are not to be construed to limit the scope of the invention.

Example 1

Cloning of the gala apple MdBT2 gene was performed.

1. Gala apple tissue culture leaf RNA extraction

The method for extracting the total RNA of the tissue culture leaf of the Gala apple by a CTAB method comprises the following steps:

1) taking 1.5g of Gala apple tissue culture seedlings subjected to salt treatment for 24 hours by 200mM NaCl solution, putting the Gala apple tissue culture seedlings into a precooled mortar, adding liquid nitrogen, grinding, and transferring into a precooled 50mL centrifuge tube;

2) quickly adding 10mL of extraction buffer solution (CTAB 20% w/v, Tris-HCl 0.1mol/L, EDTA 25mol/L, NaCl 2mol/L, mercaptoethanol 2% w/v, PVP 2% w/v, double distilled water without RNA enzyme to constant volume, wherein PVP and mercaptoethanol are added at the moment of use), gently mixing, and placing in a water bath at 65 ℃ for 0.5 hour;

3) adding a mixture of water saturated phenol/chloroform/isoamyl alcohol (volume ratio is 25:24:1) with the same volume as the tube liquid obtained in the previous step, oscillating in an ice bath for 0.5 hour, and centrifuging at 4 ℃ and 12,000rpm for 20 minutes; transferring the supernatant to a new 50mL centrifuge tube;

4) adding precooled LiCl (10 mol/L) of 1/3 supernatant, standing at-20 ℃ for 3 hours, centrifuging at 12,000rpm for 30 minutes, and discarding the supernatant;

5) adding 500 mu L of SSTE buffer solution (NaCl 1mol/L, SDS 0.5.5% w/v, EDTA 10mol/L, double distilled water constant volume without RNase) to fully suspend and precipitate, and then averagely subpackaging into 2 centrifuge tubes with 1.5 mL;

6) adding water saturated phenol/chloroform/isoamyl alcohol (volume ratio is 25:24:1) mixture with the same volume as the suspension respectively, oscillating in ice bath for 10 minutes, and centrifuging at 4 ℃ and 12,000rpm for 10 minutes; transferring the supernatant to a new 1.5mL centrifuge tube;

7) adding chloroform/isoamyl alcohol (volume ratio is 24:1) mixture with the same volume as the supernatant respectively, oscillating for 10 minutes in ice bath, centrifuging for 10 minutes at 12,000rpm at 4 ℃; transferring the supernatant to a new 1.5mL centrifuge tube;

8) adding precooled absolute ethyl alcohol with the volume 2.5 times of the volume of the supernatant, and standing for 1-2 hours at the temperature of-20 ℃;

9) centrifuging at 12,000rpm for 20 min at 4 deg.C, washing with 70% ethanol for 2 times;

10) centrifuging at 14,000rpm for 10 min at 4 deg.C, and air drying the precipitate on a super clean bench; adding 20 mu L DEPC water to dissolve RNA;

11) the samples were stored at-80 ℃ for further use, or immediately subjected to the following reverse transcription experiments.

2. Reverse transcription of total RNA to obtain cDNA

Reverse transcription of total RNA reverse transcription cDNA was obtained using a commercially available reverse transcription kit.

3. Amplification of MdBT2 full-Length DNA and antisense DNA sequences

Respectively designing a full-length primer and an antisense primer, and carrying out PCR amplification by using the reverse transcription cDNA as a template.

The upstream primer MdBT2-F of the full-length primer is shown as SEQ ID No.4ATGGAAGCTAATCCGACCGC, respectively; the downstream primer MdBT2-R of the full-length primer is shown as SEQ.ID.NO.5, and is specifically TCACAATCTGAAGCTTCT.

An upstream primer MdBT2(anti) -F of the antisense primer is shown as SEQ.ID.NO.6, and is specifically TGAAGTTGGTCGCTAATCACT; the downstream primer MdBT2(anti) -R of the antisense primer is shown as SEQ.ID.NO.7, and is specifically CATCACCTTCTTCACAAGCA.

PCR amplification System: 25. mu.L of the purified cDNA product, 10. mu.L of 5 XTdT buffer, 5. mu.L of 0.1% BSA, 2.5. mu. L, TdT 15U of 10mM dCTP, 1. mu.L of each of the upstream and downstream primers (mother liquor concentration: 5. mu.M), and a volume of 50. mu.L of double distilled water was determined.

PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; the cycle parameters are 94 ℃ denaturation for 30 seconds, 56 ℃ annealing for 30 seconds and 72 ℃ extension for 90 seconds, and 32 cycles are carried out; fully extended for 10 minutes at 72 ℃.

After the PCR reaction is finished, the PCR product is recovered and connected to a pMD-18T vector to obtain a pMD18-T-MdBT2 plasmid. The sequencing result (Beijing Liuhua Dagenescience and technology Co., Ltd.) shows that the nucleotide sequence of MdBT2 gene is shown in SEQ.ID.NO. 1; the coded amino acid sequence is shown in SEQ ID No. 2. The nucleotide sequence of the antisense fragment is shown in SEQ ID No. 3. Sequencing a correct monoclonal, extracting plasmid DNA of pMD18-T-MdBT2 by an alkaline method, and storing at-20 ℃ for subsequent functional verification experiments.

Example 2

Construction of MdBT2 gene vector:

in order to further research the function of the MdBT2 gene, a total 1086bp fragment containing the MdBT2 gene coding region is positively inserted into an expression vector pRI to construct an over-expression vector; at the same time, the antisense 512bp fragment is reversely inserted into an expression vector pRI to construct an antisense expression vector.

Example 3

Obtaining a transgenic apple:

selecting single colony of Agrobacterium, inoculating in 10mL YEP liquid culture medium (containing 50mg/L hygromycin), culturing at 28 deg.C and 200rpm under shaking until OD600 is 0.6-0.8 (about 48 hr); adding 1mL of the bacterial solution into 20mL of YEP liquid culture medium, performing shaking culture at 28 deg.C and 200rpm until OD600 is 0.6-0.8 (about 5 h). And (4) centrifugally collecting thalli and infecting.

Screening of kanamycin-resistant positive candidate transgenic lines by using a screening medium (containing 5mg/L kanamycin) can obtain 3 MdBT2 overexpression lines (MdBT2-ox1, 5 and 7) and two 35S MdBT2 antisense expression lines (MdBT2-anti13 and 23).

Example 4

MdBT2 regulates adventitious root development:

to further determine the function of the transgenic plants, transgenic material and control (GL3) were cultured on 1/2MS medium and the adventitious root development phenotype was observed. Transgenic material and control (GL3) were cultured in 1/2MS medium for 4 weeks and analyzed when adventitious root growth differences were apparent

As shown in FIG. 1 and FIG. 2, it was found that the number of adventitious roots of the transgenic line overexpressing MdBT2 was significantly suppressed, while the occurrence of adventitious roots of the MdBT2 expression-suppressed line was significantly promoted, as compared with the wild type.

Taken together, the MdBT2 gene had a significant effect on adventitious root development.

The above description is only exemplary of the present invention and should not be taken as limiting the invention, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Shandong university of agriculture

<120> apple gene MdBT2 for regulating and controlling adventitious root development and application thereof

<141> 2020-07-29

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1086

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggaagcta atccgaccgc aacctccggc acctccgtcg acctgtacgg tctctccggc 60

accaaatatc tccccgaacc cgacgtcgac atcctcacct gcgacgccat ccgcatcccg 120

gtgcactctt gcatcctggc ctcagtgtcg ccggtgctgg agaacataat cgaccggcct 180

cgtaagcacc ggagctcgga gcgggtcatt ccgattctcg gcgttccgta cgacgccgta 240

ttggccttcg tccgctttct ctactcctcc aggtgcacag aagagaacat ggagaagtac 300

gggatccatc tgctggcgct gtcccacgtg tacttggtcc cgcagctgaa gaacagatgc 360

acgaaggagc ttggtcaacg tttgaccatc gaaaacgtgg tggacgtgct gcaactggcg 420

aagatgtgcg atgcagcgga tctctacctc aaatgcatga agttggtcgc taatcacttc 480

aaggttgttg agacaactga aggatggaaa ttcttgcaag ctcacgaccc ttggctcgaa 540

ctccacatca tgcaattcat cgacgaaatt gaatcgagga agaagaggac aaggaggcat 600

agagaggagc agaggttgta tctccagctg agtgaggcaa tggagtgctt ggagcacata 660

tgcaaggaag gttgcactag tgttgggccc tacgacatgg agccaggtta caaaaggggc 720

ccatgcagca agttctccac gtgtcaaggc ctccagatgt tgatccagca ctttgccacg 780

tgtaagagga gggtgaatgg agggtgctta cgttgcaagc gcatgtggca gcttcttaag 840

cttcactctt caatgtgcga agaacctgat tcttgcagag tccctctttg caggcaattc 900

aagttgaaaa tgcagcaaga gaagaagacg gacgatgcca ggtggaaact gcttgtgaag 960

aaggtgatgt cggccaaaac cttatcttcc ctgtctctgc caaagaggaa gagggaggaa 1020

gaattaggag aaggaagaag cacttctact attactgctc atggaattag aagcttcaga 1080

ttgtga 1086

<210> 2

<211> 361

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Glu Ala Asn Pro Thr Ala Thr Ser Gly Thr Ser Val Asp Leu Tyr

1 5 10 15

Gly Leu Ser Gly Thr Lys Tyr Leu Pro Glu Pro Asp Val Asp Ile Leu

20 25 30

Thr Cys Asp Ala Ile Arg Ile Pro Val His Ser Cys Ile Leu Ala Ser

35 40 45

Val Ser Pro Val Leu Glu Asn Ile Ile Asp Arg Pro Arg Lys His Arg

50 55 60

Ser Ser Glu Arg Val Ile Pro Ile Leu Gly Val Pro Tyr Asp Ala Val

65 70 75 80

Leu Ala Phe Val Arg Phe Leu Tyr Ser Ser Arg Cys Thr Glu Glu Asn

85 90 95

Met Glu Lys Tyr Gly Ile His Leu Leu Ala Leu Ser His Val Tyr Leu

100 105 110

Val Pro Gln Leu Lys Asn Arg Cys Thr Lys Glu Leu Gly Gln Arg Leu

115 120 125

Thr Ile Glu Asn Val Val Asp Val Leu Gln Leu Ala Lys Met Cys Asp

130 135 140

Ala Ala Asp Leu Tyr Leu Lys Cys Met Lys Leu Val Ala Asn His Phe

145 150 155 160

Lys Val Val Glu Thr Thr Glu Gly Trp Lys Phe Leu Gln Ala His Asp

165 170 175

Pro Trp Leu Glu Leu His Ile Met Gln Phe Ile Asp Glu Ile Glu Ser

180 185 190

Arg Lys Lys Arg Thr Arg Arg His Arg Glu Glu Gln Arg Leu Tyr Leu

195 200 205

Gln Leu Ser Glu Ala Met Glu Cys Leu Glu His Ile Cys Lys Glu Gly

210 215 220

Cys Thr Ser Val Gly Pro Tyr Asp Met Glu Pro Gly Tyr Lys Arg Gly

225 230 235 240

Pro Cys Ser Lys Phe Ser Thr Cys Gln Gly Leu Gln Met Leu Ile Gln

245 250 255

His Phe Ala Thr Cys Lys Arg Arg Val Asn Gly Gly Cys Leu Arg Cys

260 265 270

Lys Arg Met Trp Gln Leu Leu Lys Leu His Ser Ser Met Cys Glu Glu

275 280 285

Pro Asp Ser Cys Arg Val Pro Leu Cys Arg Gln Phe Lys Leu Lys Met

290 295 300

Gln Gln Glu Lys Lys Thr Asp Asp Ala Arg Trp Lys Leu Leu Val Lys

305 310 315 320

Lys Val Met Ser Ala Lys Thr Leu Ser Ser Leu Ser Leu Pro Lys Arg

325 330 335

Lys Arg Glu Glu Glu Leu Gly Glu Gly Arg Ser Thr Ser Thr Ile Thr

340 345 350

Ala His Gly Ile Arg Ser Phe Arg Leu

355 360

<210> 3

<211> 512

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgaagttggt cgctaatcac ttcaaggttg ttgagacaac tgaaggatgg aaattcttgc 60

aagctcacga cccttggctc gaactccaca tcatgcaatt catcgacgaa attgaatcga 120

ggaagaagag gacaaggagg catagagagg agcagaggtt gtatctccag ctgagtgagg 180

caatggagtg cttggagcac atatgcaagg aaggttgcac tagtgttggg ccctacgaca 240

tggagccagg ttacaaaagg ggcccatgca gcaagttctc cacgtgtcaa ggcctccaga 300

tgttgatcca gcactttgcc acgtgtaaga ggagggtgaa tggagggtgc ttacgttgca 360

agcgcatgtg gcagcttctt aagcttcact cttcaatgtg cgaagaacct gattcttgca 420

gagtccctct ttgcaggcaa ttcaagttga aaatgcagca agagaagaag acggacgatg 480

ccaggtggaa actgcttgtg aagaaggtga tg 512

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atggaagcta atccgaccgc 20

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcacaatctg aagcttct 18

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgaagttggt cgctaatcac t 21

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

catcaccttc ttcacaagca 20

Claims

1. An application of an apple gene MdBT2 for regulating the development of adventitious roots in regulating the development of the adventitious roots of an apple is disclosed, wherein the nucleotide sequence of the apple gene MdBT2 is shown in SEQ ID No. 1.

2. The use of claim 1 for regulating the number of adventitious roots in apples.