CN111534474A

CN111534474A - Recombinant bacillus subtilis and application thereof in production of polylysine

Info

Publication number: CN111534474A
Application number: CN202010237129.XA
Authority: CN
Inventors: 饶志明; 乔郅钠; 徐美娟; 杨套伟; 张显; 邵明龙
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-03-30
Filing date: 2020-03-30
Publication date: 2020-08-14
Anticipated expiration: 2040-03-30
Also published as: CN111534474B

Abstract

The invention discloses recombinant bacillus subtilis and application thereof in producing polylysine, belonging to the technical field of biology. The invention provides a recombinant Bacillus subtilis 168/PMA5-pls capable of efficiently converting L-lysine to produce polylysine, and the recombinant Bacillus subtilis 168/PMA5-pls is added into a reaction system containing L-lysine to react for 4 hours, so that the yield and the conversion rate of polylysine in a reaction solution can reach 195.1mg/L and 17.4% respectively, and therefore, the production of polylysine by using the recombinant Bacillus subtilis 168/PMA5-pls has the advantages of short production period and high yield.

Description

Recombinant bacillus subtilis and application thereof in production of polylysine

Technical Field

The invention relates to recombinant bacillus subtilis and application thereof in producing polylysine, belonging to the technical field of biology.

Background

The polylysine (-PL) is a homotypic amino acid polymer produced by extracellular secretion of microorganisms such as streptomyces, filamentous fungi or bacillus, is generally formed by dehydration condensation of 25-35L-lysine monomers through alpha-COOH and-NH 2, and has a molecular weight of usually 2500-4500 Da.

Because of the advantages of good water solubility, strong heat stability, wide antibacterial spectrum and the like, polylysine is mainly used as a biological food preservative in food industry in Japan, Korea, Europe and America and other countries and regions at present. In 2014, polylysine and the hydrochloride thereof are officially approved in China to be applied to the food fields of fruits and vegetables, rice and flour products, meat products, seasonings, beverages, baking and the like.

Currently, polylysine is produced industrially mainly by biological fermentation processes. However, the microbial fermentation method has many disadvantages, such as that Camptodon et al produces polylysine by inoculating Streptomyces sp.M-Z18 into a 5L fermenter for fed-batch fermentation, but the fermentation period for producing polylysine by the method is as long as 192h, and the fermentation broth obtained by the fermentation method has complicated components, which are not favorable for downstream separation and purification, so the method is not suitable for large-scale industrial production, and furthermore, the application of polylysine produced by the method in the food field is greatly limited because the strain used in the method is a non-food-safe strain (see the references: Ren X D, ChenX S, Cheng X, et al Biosystems Engineering,2015,38(6): 1113-1125.).

Attempts have also been made to produce food-grade polylysine by fermentation using the food-safe strain Bacillus subtilis, for example, Nermen et al, by inoculating Bacillus subtilis SNDS into a fermentation medium, but fermentation for 24 hours using this method only resulted in a yield of 76.3mg/L of polylysine in the fermentation broth, which is low (see in particular references: Prof, Dr, Nermen, et al.

Therefore, it is urgently required to find a method for producing polylysine, which has a short production cycle, high yield and high safety of the produced polylysine.

Disclosure of Invention

[ problem ] to

The invention aims to solve the technical problem of providing a method for producing polylysine, which has short production period, high yield and high safety of the produced polylysine.

[ solution ]

In order to solve the technical problems, the invention provides a recombinant bacillus subtilis which takes bacillus subtilis as a host to express a gene pls for coding polylysine synthase.

In one embodiment of the invention, the amino acid sequence of the polylysine synthase is shown in SEQ ID No. 1.

In one embodiment of the present invention, the nucleotide sequence of the polylysine synthase-encoding gene pls is set forth in SEQ ID No.2 or SEQ ID No. 3.

In one embodiment of the present invention, the recombinant bacillus subtilis expresses the gene pls encoding polylysine synthase using bacillus subtilis as a host and a pMA5 plasmid, a pHT01 plasmid or a pHT43 plasmid as a vector.

In one embodiment of the present invention, the recombinant Bacillus subtilis uses Bacillus subtilis as a host, and expresses the gene pls encoding polylysine synthase using the pMA5 plasmid.

The invention also provides a method for producing polylysine, which comprises the steps of inoculating the recombinant bacillus subtilis into a reaction system containing L-lysine for reaction to obtain a reaction solution containing polylysine, and then separating the reaction solution containing polylysine to obtain the polylysine.

In one embodiment of the present invention, the concentration of L-lysine in the reaction system is 10 to 100 g/L.

In one embodiment of the present invention, the concentration of L-lysine in the reaction system is 50 g/L.

In one embodiment of the present invention, the reaction system has a pH of 2.0 to 7.0.

In one embodiment of the present invention, the reaction system has a pH of 3.0.

In one embodiment of the present invention, the reaction system contains 10mM TAPS-NaOH, 5mM MgCl₂0.5mM ATP, 0.1mM DTT, 2g/L NP-40, and 10% (v/v) glycerol.

In one embodiment of the present invention, the reaction temperature is 20 to 50 ℃, the rotation speed is 100 to 500rpm, and the time is 2 to 6 hours.

In one embodiment of the invention, the reaction is carried out at 30 ℃ and 200rpm for 4 hours.

The invention also provides the application of the recombinant bacillus subtilis or the method in the production of polylysine.

The invention also provides a method for producing polylysine synthase, which comprises the steps of inoculating the recombinant bacillus subtilis into a fermentation culture medium for fermentation to obtain the recombinant bacillus subtilis containing the polylysine synthase, crushing the recombinant bacillus subtilis containing the polylysine synthase to obtain cell crushing liquid, and finally separating the cell crushing liquid to obtain the polylysine synthase.

In one embodiment of the invention, the fermentation medium contains 60g/L glucose, 10.5g/L yeast extract, 15g/L ammonium sulfate, 3.5g/L dipotassium hydrogen phosphate, 1.25g/L magnesium sulfate heptahydrate, 0.1g/L zinc sulfate heptahydrate, and 0.02g/L ferrous sulfate heptahydrate.

In one embodiment of the invention, the fermentation is carried out at 30 ℃ and 180rpm for 72 hours.

The invention also provides the application of the recombinant bacillus subtilis or the method in the production of polylysine synthase.

[ advantageous effects ]

(1) The invention provides a recombinant Bacillus subtilis 168/PMA5-pls capable of efficiently converting L-lysine to produce polylysine, and the recombinant Bacillus subtilis 168/PMA5-pls is added into a reaction system containing L-lysine to react for 4 hours, so that the yield and the conversion rate of polylysine in a reaction solution can reach 195.1mg/L and 17.4% respectively, therefore, the recombinant Bacillus subtilis 168/PMA5-pls for producing polylysine has the advantages of short production period and high yield; in addition, the recombinant Bacillus subtilis 168/PMA5-pls takes food-safe Bacillus subtilis as a host, so that polylysine produced by the recombinant Bacillus subtilis 168/PMA5-pls can reach food grade.

(2) The invention provides a method for producing polylysine, which uses recombinant Bacillus subtilis 168/PMA5-pls to efficiently convert L-lysine to produce polylysine, and the method can be used for reacting for 4 hours, so that the yield and the conversion rate of the polylysine in a reaction solution can respectively reach 195.1mg/L and 17.4 percent, therefore, the method for producing the polylysine has the advantages of short production period and high yield; in addition, the recombinant Bacillus subtilis 168/PMA5-pls used in the invention takes food-safe Bacillus subtilis as a host, so that the polylysine produced by the method can reach food grade.

Drawings

FIG. 1: the enzyme digestion verification result of the recombinant plasmid pMA 5-pls; wherein, M: 10000bp nucleic acid Marker, lanes 1-2: recombinant plasmid pMA 5-pls.

FIG. 2: PCR verification results of recombinant Bacillus subtilis 168/PMA5-pls transformants; wherein, M: 10000bp nucleic acid Marker, lanes 1-2: recombinant Bacillus subtilis 168/PMA5-pls transformants.

FIG. 3: MALDI-TOF-MS analysis of polylysine standards.

FIG. 4: MALDI-TOF-MS analysis results of reaction liquid obtained by recombinant Bacillus subtilis 168/PMA5-pls reaction.

FIG. 5: the reaction solution obtained by the recombinant Bacillus subtilis 168/PMA5-pls reaction has the effect of inhibiting Escherichia coli (Escherichia coli) JM 109.

FIG. 6: the reaction liquid obtained by the reaction of the recombinant Bacillus subtilis 168/PMA5-pls has the inhibiting effect on the new gold color Mycobacterium (Mycobacterium neoaurum) VKMAC-1815D.

Detailed Description

Escherichia coli (Escherichia coli) JM109, Bacillus subtilis 168 and Mycobacterium neoaurum (Mycobacterium neoaurum) VKMAC-1815D, referred to in the following examples, were purchased from North Nami organisms; the PMA5 plasmid referred to in the examples below was purchased from Youbao organisms.

The media involved in the following examples are as follows:

LB liquid medium: 10g/L of peptone and 5g/L, NaCl 10g/L of yeast extract.

LB solid medium: 10g/L of peptone, 5g/L, NaCl 10g/L of yeast extract and 15g/L of agar.

M3G fermentation medium: 60g/L glucose, 10.5g/L yeast extract, 15g/L ammonium sulfate, 3.5g/L dipotassium hydrogen phosphate, 1.25g/L magnesium sulfate heptahydrate, 0.1g/L zinc sulfate heptahydrate and 0.02g/L ferrous sulfate heptahydrate.

Brain Heart Infusion (BHI) broth: brain heart infusion 37.5g/L (purchased from Haibo Bio Inc.).

And (3) buffer solution A: 100mM Tris-HCl, 20% glycerol (v/v), 2mM EDTA (from Shanghai Aladdin Co., Ltd.), 0.2M NaCl, 5mM Dithiothreitol (DTT) (from Shanghai Aladdin Co., Ltd.), pH 8.0.

And (3) buffer solution B: 50mM Tris-HCl (purchased from Mecanol Biochemical technologies, Inc., Shanghai), 20% glycerol (v/v), 1M NaCl, 5mM DTT, pH 8.0.

And (3) buffer C: 10mM TAPS-NaOH (from YuBo Bio), 5mM MgCl₂0.5mM MATP (from Shanghai Aladdin Co., Ltd.), 0.1mM Dithiothreitol (DTT), 2g/LNP-40 (from Shanghai Aladdin Co., Ltd.), 10% glycerol, pH 8.5.

The detection methods referred to in the following examples are as follows:

determination of the enzymatic and specific enzymatic activities of polylysine synthase:

(1) the formulation contained 100nM of TAP-NaOH N-trihydroxymethyl-3-aminopropanesulfonate (pH 8.5) (available from Jiangsu Baolai Biotech Co., Ltd.), 990mM L-lysine, 5mM MgCl₂5mMATP, 1mM Dithiothreitol (DTT), 20% glycerol (v/v) and 0.2% (w/v) NP-40; incubating the reaction system at 30 ℃ for 10min, and adding the crude enzyme solution into the reaction system in an addition amount of 10% (v/v) for reaction; after reacting for 10min, adding 15% (v/v) trichloroacetic acid solution into the reaction solution to terminate the reaction;

(2) preparing polylysine standard solutions (25 mg/L-200 mg/L) with different concentrations; 1mL of the standard polylysine solution(s) each having a different concentration was added to 2.8mL of a phosphate buffer (0.1mM, pH 7.0) to obtain a mixture A₁(ii) a 120. mu.L of trypan blue solution (1mg/mL) was added to mixture A₁To obtain a mixed solution B₁(ii) a Mixing the mixed solution B₁After incubation at 37 ℃ for 60min, mixture B was assayed₁A of (A)₅₈₀(ii) a The concentration of the standard solution of polylysine is plotted on the abscissa, as A₅₈₀Drawing a standard curve for the ordinate;

(3) 1mL of the reaction mixture after completion of the reaction was added to 2.8mL of a phosphate buffer (0.1mM, pH 7.0) to obtain a mixture A₂(ii) a 120. mu.L of trypan blue solution (1mg/mL) was added to mixture A₂To obtain a mixed solution B₂(ii) a Mixing the mixed solution B₂After incubation at 37 ℃ for 60min, mixture B was assayed₂A of (A)₅₈₀(ii) a According to the measured mixed liquor B₂A of (A)₅₈₀And (3) obtaining the content of polylysine generated in the reaction solution according to the standard curve drawn in the step (2), and obtaining the enzyme activity of polylysine synthase in the crude enzyme solution according to the content of polylysine generated in the reaction solution;

(4) calculating the specific enzyme activity of the polylysine synthase in the crude enzyme solution according to the enzyme activity of the polylysine synthase in the crude enzyme solution, wherein the calculation formula is as follows:

wherein the protein concentration in the crude enzyme solution is determined by the Bradford method described in the reference "Bradford, M.M.1976.A rapid and sensitive method for the quantification of microorganisms of protein digestion. analytical. biochem.72: 248-254.");

definition of enzyme activity: under the condition, the enzyme amount required for catalyzing L-lysine to generate 1 mu mol of polylysine per minute is one enzyme activity unit (1U);

definition of specific enzyme activity: the number of units of enzyme activity possessed by a unit weight (mg) of the protein.

Determination of polylysine content and conversion:

(1) preparing polylysine standard solutions (25 mg/L-200 mg/L) with different concentrations; 1mL of the standard polylysine solution(s) each having a different concentration was added to 2.8mL of a phosphate buffer (0.1mM, pH 7.0) to obtain a mixture A₁(ii) a 120. mu.L of trypan blue solution (1mg/mL) was added to mixture A₁To obtain a mixed solution B₁(ii) a Mixing the mixed solution B₁After incubation at 37 ℃ for 60min, mixture B was assayed₁A of (A)₅₈₀(ii) a The concentration of the standard solution of polylysine is plotted on the abscissa, as A₅₈₀Drawing a standard curve for the ordinate;

(2) 1mL of the reaction mixture was added to 2.8mL of a phosphate buffer (0.1mM, pH 7.0) to obtain a mixture A₂(ii) a 120. mu.L of trypan blue solution (1mg/mL) was added to mixture A₂To obtain a mixed solution B₂(ii) a Mixing the mixed solution B₂After incubation at 37 ℃ for 60min, mixture B was assayed₂A of (A)₅₈₀(ii) a According to the measured mixed liquor B₂A of (A)₅₈₀And (2) obtaining the concentration of polylysine in the reaction solution according to the standard curve drawn in the step (1);

(3) according to the concentration of polylysine in the reaction solution, calculating to obtain the conversion rate of polylysine in the reaction solution, wherein the calculation formula is as follows;

in the formula: m is_-polylysineConcentration of polylysine × in the reaction solution,. DELTA.m_L-lysineThe volume of the reaction solution × (initial L-lysine concentration in the reaction solution — remaining L-lysine concentration in the reaction solution).

Example 1: construction of recombinant Bacillus subtilis

The method comprises the following specific steps:

(1) the CG content of the gene with the nucleotide sequence shown as SEQ ID No.2 obtained by chemical combination synthesis (Jinzhi corporation) and coding-polylysine synthase (from Streptomyces albulus, GenBank number of NCBI: AB385841.1) is analyzed by GC content online analysis (http:// www.detaibio.com/tools/GC-content. html), and the analysis result shows that the GC content is up to 75 percent and is possibly unfavorable for the expression of the gene in Bacillus subtilis 168, so the codon is optimized to reduce the GC content to 58.21 percent, so that the heterologous expression of the gene in the Bacillus subtilis 168 can be successfully realized, and the nucleotide sequence of the gene obtained after the codon optimization is shown as SEQ ID No. 3.

(2) A gene encoding polylysine synthase, the nucleotide sequence of which is shown in SEQ ID No.3, was synthesized by chemical synthesis (Jinzhi corporation); performing PCR amplification by using a gene with a nucleotide sequence shown as SEQ ID No.3 obtained by synthesis as a template and pls-F and pls-R as primers to obtain target genes of which two ends are respectively connected with enzyme digestion sites Nde I and BamH I; connecting the target gene and PMA5 plasmid after restriction enzyme Nde I and BamH I digestion to obtain a connection product; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product to obtain a transformation product; the transformed product was spread on LB solid medium (containing 50. mu.g.mL)^-1Ampicillin) in a constant temperature incubator at 37 deg.CCarrying out inverted culture for 8-12 h to obtain a transformant; selecting a transformant, inoculating the transformant to an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 120-180 rpm, extracting plasmids, performing enzyme digestion verification (the verification result is shown in figure 1) and sequencing verification (the plasmids are sent to Jinzhi Limited for sequencing analysis), and obtaining the successfully-transformed recombinant plasmid pMA5-pls after verification is correct; wherein, the primers are as follows:

pls-F: acctaaaggactattagatatgatgcgcgcccccttctcg (nucleotide sequence shown in SEQ ID No. 4);

pls-R: agcttgactctagagatgcgcgcgccac (nucleotide sequence shown in SEQ ID No. 5).

(3) Transforming the recombinant plasmid pMA5-pls into Bacillus subtilis 168 to obtain a transformation product; the transformed product was spread on LB solid medium (containing 50. mu.g.mL)^-1Kanamycin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant; the transformants were verified by PCR (see FIG. 2 for verification results) to obtain recombinant Bacillus subtilis 168/PMA 5-pls.

Example 2: production of polylysine synthase

The method comprises the following specific steps:

the transformant of the recombinant Bacillus subtilis 168/PMA5-pls obtained in example 1 was cultured in the presence of 50. mu.g.mL^-1Streaking on an LB solid culture medium of kanamycin, and carrying out inverted culture in a constant-temperature incubator at 30 ℃ for 12h to obtain a single colony; single colonies were picked and inoculated into 10mL of 50. mu.g.mL^-1Culturing in LB liquid culture medium of kanamycin at 30 deg.C and 200r/min for 12 hr to obtain seed liquid; the seed solution was inoculated to 50mL of a solution containing 50. mu.g.mL of the seed solution in an amount of 10% (v/v)^-1Culturing in M3G fermentation medium of kanamycin at 30 deg.C for 72 hr at 180r/min to obtain fermentation liquid; centrifuging the fermentation liquor at 4 ℃ and 10000rpm for 10min, and collecting thalli A; washing the thallus A with 10mL of buffer solution A, centrifuging at 4 ℃ and 10000rpm for 10min, and collecting a thallus B; washing the thallus B with 10mL of buffer solution B, centrifuging at 4 ℃ and 10000rpm for 10min, and collecting thallus C; resuspending the thalli C in 5mL of buffer solution C to obtain a resuspension solution; crushing the heavy suspension by using an ultrasonic crusher to obtain a cell crushing liquid; will be provided withCentrifuging the cell disruption solution at 4 deg.C for 20min, and collecting supernatant as crude enzyme solution.

Detecting the specific enzyme activity of polylysine synthase in the crude enzyme solution, wherein the detection result is as follows: 71U/mg. As can be seen, the recombinant Bacillus subtilis 168/PMA5-pls can successfully express polylysine synthase.

Example 3: production and detection of polylysine

The method comprises the following specific steps:

1. production of

5g of the cell A obtained in example 2 was added to 50mL of a buffer C containing 50g/L L-lysine, and the mixture was transformed at 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃ and 50 ℃ at a rotation speed of 200rpm for 4 hours to obtain reaction solutions 1 to 7.

Detecting the yield of the polylysine in the reaction solution 1-7, wherein the detection result is as follows: the yield of polylysine in the reaction solutions 1-7 is 157.78mg/L, 173.25mg/L, 181.56mg/L, 170.82mg/L, 73.67mg/L and 68.34mg/L respectively. As can be seen, the optimal temperature for producing polylysine by transforming L-lysine with recombinant Bacillus subtilis 168/PMA5-pls is 30 ℃.

5g of the cell A obtained in example 2 was taken out and added to 50mL of a buffer solution C (pH was adjusted by HCI solution or NaOH solution) containing 50g/L L-lysine at pH 2.0, 3.0, 4.0, 5.0, 6.0 and 7.0, respectively, and the mixture was inverted at 30 ℃ and 200rpm for 4 hours to obtain reaction solutions 8 to 13.

Detecting the yield of the polylysine in the reaction solution 8-13, wherein the detection result is as follows: the yield of polylysine in the reaction liquid 8-13 is 135.34mg/L, 185.88mg/L, 168.21mg/L, 163.68mg/L, 123.83mg/L and 109.37mg/L respectively. As can be seen, the optimum pH for producing polylysine by transforming L-lysine with recombinant Bacillus subtilis 168/PMA5-pls is 3.0.

5g of the cell body A obtained in example 2 was added to 50mL of a buffer solution C (pH adjusted by HCI solution or NaOH solution) containing 10g/L, 20g/L, 30g/L, 40g/L, 50g/L, 60g/L, 70g/L, 80g/L, 90g/L, and 100g/L L-lysine, respectively, and having a pH of 3.0, and the mixture was inverted at 30 ℃ and 200rpm for 4 hours to obtain reaction solutions 14 to 23.

Detecting the yield of polylysine in the reaction solution 14-23, wherein the detection result is as follows: the yields of polylysine in the reaction solutions 14 to 23 were 140.1mg/L, 144.2mg/L, 153.6mg/L, and 195.1mg/L (in this case, the conversion rate was 17.4%), 181.8mg/L, 174.05mg/L, 151.02, 150.01mg/L, and 132.6mg/L, respectively. As can be seen, the optimal substrate (L-lysine) concentration for producing polylysine by transforming L-lysine with recombinant Bacillus subtilis 168/PMA5-pls is 50 g/L.

2. Detection of

In order to further identify whether polylysine produced by converting L-lysine into recombinant Bacillus subtilis 168/PMA5-pls is a target product, namely polylysine, and determine the polymerization state and relative molecular weight of the polylysine produced by converting L-lysine into recombinant Bacillus subtilis 168/PMA5-pls, MALDI-TOF-MS is used for analyzing the reaction solution 17 by using a polylysine standard sample (purchased from Sigma company) as a control (the analysis result is shown in FIGS. 3-4).

As can be seen from FIGS. 3 to 4, the relative molecular mass distribution of polylysine produced by converting L-lysine into recombinant Bacillus subtilis 168/PMA5-pls is 3605 to 4502D, and is mainly concentrated in 4118D, which is consistent with a polylysine standard sample. Therefore, the recombinant Bacillus subtilis 168/PMA5-pls can indeed transform L-lysine to produce polylysine, which confirms that the recombinant Bacillus subtilis 168/PMA5-pls realizes the functional expression of polylysine synthase to a certain extent.

According to the relative molecular mass of polylysine produced by converting L-lysine into recombinant Bacillus subtilis 168/PMA5-pls, the corresponding polymerization degree is distributed in the range of 25-30 and is mainly concentrated at 28. It can be seen that, the L-lysine produced by transforming the recombinant Bacillus subtilis 168/PMA5-pls into the L-lysine may have stronger bacteriostatic activity (the bacteriostatic spectrum of the polylysine is very wide, and the polylysine has better bacteriostatic effects on gram-negative bacteria, gram-positive bacteria and some viruses, and the bacteriostatic activity of the polylysine is related to the polymerization degree of the L-lysine, when the polymerization degree of the L-lysine is lower than 9, the polylysine has almost no bacteriostatic activity, and only when the polymerization degree of the L-lysine is higher than 9, particularly, the polymerization degree is 25-35, the polylysine has stronger bacteriostatic activity).

In order to further identify whether polylysine produced by transforming L-lysine with recombinant Bacillus subtilis 168/PMA5-pls has stronger antibacterial activity, Escherichia coli (Escherichia coli) JM109 and novel Mycobacterium neoaurum (Mycobacterium neoaurum) VKMAC-1815D are taken as research objects, and whether the reaction liquid 17 has influence on the growth of Escherichia coli E.coli and Mycobacterium neoaurum VKMAC-1815D is detected, wherein the specific detection process is as follows: respectively dipping Escherichia coli (Escherichia coli) JM109 and Mycobacterium neoaurum (Mycobacterium neoaurum) VKMAC-1815D bacterial liquid from a glycerol tube by using an inoculating loop, inoculating the bacterial liquid into LB and BHI liquid culture media, and respectively culturing at 37 ℃ and 30 ℃ for 12 hours to obtain culture solutions; respectively coating the culture solution on LB and BHI solid culture media, adding 200 mu L of reaction solution 17 between the LB and BHI solid culture media, respectively culturing at 37 ℃ for 24h and at 30 ℃ for 48h, and observing whether obvious inhibition zones exist on the LB and BHI solid culture media or not after 48h (the detection result is shown in figures 5-6).

As shown in FIGS. 5 to 6, the diameter of the zone of inhibition formed by Escherichia coli (Escherichia coli) JM109 was about 13mm, and the diameter of the zone of inhibition formed by Mycobacterium neoaurum (Mycobacterium neoaurum) VKMAC-1815D was about 12 mm. The results show that the polylysine produced by transforming the recombinant Bacillus subtilis 168/PMA5-pls into L-lysine has stronger bacteriostatic activity, and further prove that the recombinant Bacillus subtilis 168/PMA5-pls realizes the functional expression of polylysine synthase.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of south of the Yangtze river

<120> recombinant bacillus subtilis and application thereof in production of polylysine

<160>5

<170>PatentIn version 3.3

<210>1

<211>1319

<212>PRT

<213>Streptomyces albulus

<400>1

Met Ser Ser Pro Leu Leu Glu Ser Ser Phe Glu Pro Ser Glu Pro Ala

1 5 10 15

Pro Gln Gln Ala Leu Tyr Arg Thr Ala Gly Asn Pro Ala Pro Arg Thr

20 25 30

Leu Leu Asp Val Leu Asp Ala Thr Ala Ala Ala His Pro Gln Ala Ile

35 40 45

Ala Leu Asp Thr Gly Ser Glu Ala Leu Thr Tyr Arg Asp Leu Cys Ile

50 55 60

Glu Ile Glu Arg Arg Ala Arg Gln Leu Arg Asp Arg Gly Ile Gly Pro

65 70 75 80

Gly Asp Arg Val Gly Val Arg Val Pro Ser Gly Thr Ala Glu Leu Tyr

85 90 95

Leu SerIle Leu Ala Val Leu Arg Ser Gly Ala Ala Tyr Val Pro Val

100 105 110

Asp Ala Asp Asp Pro Asp Glu Arg Ala Ala Thr Val Phe Arg Glu Ala

115 120 125

Ala Val Cys Ala Val Leu Gly Pro Asp Gly Pro Leu Pro Gly Pro Ala

130 135 140

Arg Pro Leu Gly Asp Pro Arg Ser Ala Gly Pro Gln Asp Asp Ala Trp

145 150 155 160

Ile Ile Phe Thr Ser Gly Ser Thr Gly Ala Pro Lys Gly Val Ala Val

165 170 175

Ser His Arg Ser Ala Ala Ala Phe Val Asp Ala Glu Ala Asp Leu Phe

180 185 190

Cys Gln Asp Gln Pro Leu Gly Pro Gly Asp Arg Val Leu Ala Gly Leu

195 200 205

Ser Val Ala Phe Asp Ala Ser Cys Glu Glu Met Trp Leu Ala Trp Arg

210 215 220

Tyr Gly Ala Cys Leu Val Pro Ala Pro Arg Ala Leu Val Arg Ala Gly

225 230 235 240

His Glu Leu Gly Pro Trp Leu Val Glu Arg Gly Ile Thr Val Val Ser

245 250 255

Thr Val Pro ThrLeu Ala Ala Leu Trp Pro Asp Glu Ala Met Arg Arg

260 265 270

Val Arg Leu Leu Ile Val Gly Gly Glu Ser Cys Pro Ala Gly Leu Val

275 280 285

Asp Arg Phe Ala Gly Pro Gly Arg Glu Met Trp Asn Thr Tyr Gly Pro

290 295 300

Thr Glu Thr Thr Val Val Ala Cys Ala Ala Arg Leu Leu Pro Gly Glu

305 310 315 320

Pro Val Arg Ile Gly Leu Pro Leu Lys Gly Trp Gln Leu Ala Val Val

325 330 335

Asp Arg Thr Gly Gln Pro Val Pro Phe Gly Ala Glu Gly Glu Leu Leu

340 345 350

Ile Ser Gly Val Gly Thr Ala Arg Tyr Leu Asp Pro Ala Lys Asp Ala

355 360 365

Glu Arg Phe Arg Pro Asp Asp Ala Leu Gly Ala Ala Arg Val Tyr Arg

370 375 380

Thr Gly Asp Leu Val Arg Ala Glu Pro Glu Gly Leu Leu Phe Val Gly

385 390 395 400

Arg Ala Asp Asp Gln Ile Lys Leu Gly Gly Arg Arg Ile Glu Leu Gly

405 410 415

Glu Ile Asp Ala Ala LeuAla Ala Leu Pro Gly Val Arg Gly Ala Ala

420 425 430

Ala Ala Val Gln Thr Thr Pro Ala Gly Thr Gln Val Leu Val Gly Tyr

435 440 445

Val Val Pro Glu Gln Arg Thr Ala Asp Gly Ser Ser Phe Gln Gln Asp

450 455 460

Lys Ala Arg Ala Leu Leu Gln Glu Arg Leu Pro Ala Gln Leu Val Pro

465 470 475 480

Val Leu Ala Glu Val Glu Ser Leu Pro Thr Arg Thr Ser Gly Lys Val

485 490 495

Asp Arg Lys Ala Leu Pro Trp Pro Leu Pro Ser Ala Pro Val Asp Ser

500 505 510

Ala Thr Gly Asp Pro Ala Thr Ala Leu Asp Gly Thr Ala Ala Arg Leu

515 520 525

Ala Gly Ile Trp Glu Glu Leu Leu Gly Val Arg Pro Gly Pro Asp Ser

530 535 540

Asp Phe Val Ser Leu Gly Gly Thr Ser Leu Val Ala Ala Arg Met Ala

545 550 555 560

Ser Gln Leu Arg Ile His His Pro Gly Val Ser Val Ala Asp Leu Tyr

565 570 575

Arg His Pro Val Leu Arg Asp MetAla Glu His Leu Asp Ser Leu Gly

580 585 590

Gly Pro Val Asp Glu Val Arg Pro Val Arg Pro Val Pro Arg Arg Thr

595 600 605

Gly Phe Val Gln Leu Leu Val Gln Thr Gly Leu Tyr Gly Ile Ala Gly

610 615 620

Leu Arg Gly Leu Val Gly Leu Ala Leu Ala Asp Asn Val Leu Gly Leu

625 630 635 640

Leu Ala Pro Gln Val Trp Ala Pro His Thr Ala Trp Trp Leu Ile Ile

645 650 655

Val Gly Trp Val Val Leu Tyr Ser Ala Pro Met Arg Cys Ala Leu Gly

660 665 670

Ala Leu Ala Ala Arg Ala Leu Ala Gly Thr Ile Lys Pro Gly Ala Tyr

675 680 685

Pro Arg Gly Gly Ala Thr His Leu Arg Leu Trp Thr Ala Glu Arg Val

690 695 700

Val Ala Ala Phe Gly Val Pro Ser Leu Leu Gly Thr Pro Trp Ala Arg

705 710 715 720

Leu Tyr Ala Arg Ser Leu Gly Cys Ala Thr Gly Arg Asn Val Ala Leu

725 730 735

His Thr Met Pro Pro Val Thr Gly Leu AlaGlu Leu Gly Asp Gly Cys

740 745 750

Ser Val Glu Pro Glu Ala Asp Ile Ser Gly Trp Trp Leu Asp Gly Asp

755 760 765

Thr Leu His Ile Gly Ala Val Arg Ile Gly Ala Gly Ala Arg Val Ala

770 775 780

His Arg Ser Met Leu Met Pro Gly Ala Val Val Gly Gln Gly Ala Glu

785 790 795 800

Leu Ala Ser Gly Ala Cys Leu Asp Gly Glu Ile Pro Asp Gly Ala Ser

805 810 815

Trp Ser Gly Ser Pro Ala Arg Pro Ala Gly Ala Ala Glu Arg Met Ala

820 825 830

Gly Ala Ala Trp Pro Ala Pro Ala Trp Gln Arg Ser Arg Arg Trp Ser

835 840 845

Ala Ala Tyr Gly Leu Thr Leu Leu Gly Leu Pro Leu Leu Ala Leu Leu

850 855 860

Ser Thr Ala Pro Ala Leu Val Gly Ala Tyr Phe Leu Leu Arg Asp Ser

865 870 875 880

Gly Thr Leu Ala Thr Ala Gly Leu Arg Leu Leu Leu Ala Val Pro Val

885 890 895

Phe Thr Leu Leu Thr Thr Gly Cys Ser Leu Leu ValThr Ala Ala Val

900 905 910

Val Arg Leu Leu Gly Arg Gly Ile Thr Pro Gly Leu His Pro Ala Ser

915 920 925

Gly Gly Val Ala Trp Arg Ala Trp Leu Val Thr Arg Leu Leu Asp Gly

930 935 940

Ala Arg Gly Ser Leu Phe Pro Leu Tyr Ala Ser Leu Gly Thr Pro His

945 950 955 960

Trp Leu Arg Leu Leu Gly Ala Lys Val Gly Arg His Ala Glu Ile Ser

965 970 975

Thr Val Leu Pro Leu Pro Ser Leu Leu His Val Glu Asp Gly Ala Phe

980 985 990

Leu Ala Asp Asp Thr Leu Val Ala Pro Phe Glu Leu Arg Gly Gly Trp

995 1000 1005

Leu Arg Leu Gly Thr Val Arg Ile Gly Arg Arg Ala Phe Val Gly

1010 1015 1020

Asn Ser Gly Ile Val Asp Pro Gly His Asp Val Pro Asp His Ser

1025 1030 1035

Leu Val Gly Val Leu Ser Asn Ala Pro Ala Asp Gly Glu Pro Gly

1040 1045 1050

Ser Ser Trp Leu Gly Arg Pro Ala Met Pro Leu Pro Arg Val Ala

1055 1060 1065

Thr Gln Ala Asp Pro Ala Arg Thr Phe Ala Pro Pro Arg Arg Leu

1070 1075 1080

Val Arg Ala Arg Ala Ala Val Glu Leu Cys Arg Val Leu Pro Leu

1085 1090 1095

Met Cys Gly Leu Ala Leu Ala Glu Gly Val Phe Leu Thr Glu Gln

1100 1105 1110

Asp Ala Phe Ala Gln Gly Gly Leu Gly Leu Ala Ala Leu Val Gly

1115 1120 1125

Ala Pro Leu Leu Leu Ala Ser Gly Leu Val Ala Leu Leu Val Thr

1130 1135 1140

Thr Leu Ala Lys Trp Leu Leu Val Gly Arg Phe Thr Val Ser Glu

1145 1150 1155

His Pro Leu Trp Ser Ser Phe Val Trp Arg Asn Glu Leu Tyr Asp

1160 1165 1170

Thr Phe Val Glu Ser Leu Ala Val Pro Ser Met Ala Gly Ala Phe

1175 1180 1185

Thr Gly Thr Pro Val Leu Asn Trp Trp Leu Arg Thr Leu Gly Ala

1190 1195 1200

Lys Ile Gly Arg Gly Val Trp Leu Glu Ser Tyr Trp Leu Pro Glu

1205 1210 1215

Thr Asp Leu IleThr Val Ala Asp Gly Val Ser Val Asn Arg Gly

1220 1225 1230

Cys Val Leu Gln Thr His Leu Phe His Asp Arg Ile Met Arg Leu

1235 1240 1245

Asp Thr Val Arg Leu Ala Glu Gly Ser Ser Leu Gly Pro His Gly

1250 1255 1260

Ile Val Leu Pro Gly Thr Glu Val Gly Ala Arg Ala Ser Ile Ala

1265 1270 1275

Pro Ser Ser Leu Val Met Arg Gly Glu Ser Val Pro Ala His Thr

1280 1285 1290

Arg Trp Ala Gly Asn Pro Ile Ala Gly Glu Arg Pro Ala Arg Pro

1295 1300 1305

Val Pro Ala Arg Ala Glu Gly Gly Ala Ala Ala

1310 1315

<210>2

<211>3960

<212>DNA

<213>Streptomyces albulus

<400>2

atgtcgtcgc cccttctcga atcgtccttc gagccgtccg agccagcgcc ccaacaggcc 60

ctgtaccgca ccgccggcaa cccggccccg cggaccctgc tcgacgtgct cgatgccacc 120

gccgccgcac atccccaggc gatcgccctg gacacgggct ccgaggcgct cacctaccgc 180

gacctgtgta tcgagatcga acgccgcgca cggcagctca gggaccgcgg catcggtccc 240

ggcgaccggg tcggagtccg cgtcccctcc gggaccgccg agctgtacct gtccatcctc 300

gccgtcctgc gcagcggagc ggcctacgtg ccggtcgacg ccgacgaccc cgacgagcgg 360

gccgccaccg tcttccgcga ggccgccgtc tgcgccgtcc tcggccccga cggcccgctg 420

cccggcccgg cccggcccct cggcgacccg cgttccgcgg gcccccagga cgacgcctgg 480

atcatcttca cctcgggttc gaccggcgcg cccaagggcg tggcggtcag ccaccgctcc 540

gccgccgcct tcgtcgacgc cgaggccgac ctgttctgcc aggaccagcc gttgggcccc 600

ggcgaccggg tgctggccgg gctgtccgtc gccttcgacg cctcctgcga ggagatgtgg 660

ctcgcctggc ggtacggcgc ctgcctggtg cccgcacccc gcgcgctggt ccgggccggc 720

cacgaactcg gcccctggct cgtcgagcgc ggcatcaccg tcgtctccac cgtgcccacc 780

ctcgccgcgc tctggccgga cgaggcgatg cgccgggtcc gcctgctgat cgtcggcggc 840

gaatcctgcc cggccgggct cgtcgaccgc ttcgccggac ccggccgcga gatgtggaac 900

acctacggcc cgaccgagac caccgtcgtc gcctgcgccg cccgcctgct gccgggcgag 960

ccggtccgca tcggcctgcc cctgaagggc tggcagctcg ccgtcgtcga ccgcaccggg 1020

cagccggtgc ccttcggcgc cgagggcgaa ctgctgatca gcggcgtcgg cacggcccgc 1080

tacctcgacc ccgccaagga cgccgaacgg ttccggcccg acgacgccct gggggccgcc 1140

cgcgtctacc gcaccggcga cctggtccgg gccgaacccg agggcctgct cttcgtcggc 1200

cgcgccgacg accagatcaa actcggcggc cgccgcatcg agctgggcga gatcgacgcc 1260

gccctggccg ccctgcccgg cgtccgcggg gccgccgcgg ccgtccagac gacgccggcc 1320

ggcacccagg tgctggtcgg ctacgtcgtt cccgagcagc gcaccgccga cggttccagc 1380

ttccagcagg acaaggcccg cgcactgctc caggaacgcc tgcccgcgca gttggtcccg 1440

gtcctcgcgg aggtcgagtc cctgcccacc cggacctccg gcaaggtcga ccgcaaggcg 1500

ctgccctggc cgctgccgtc cgccccggtc gactccgcca ccggcgatcc ggccacggcg 1560

ctggacggca ccgccgcccg gctcgccggg atctgggagg aactcctcgg cgtccggccc 1620

ggcccggaca gcgacttcgt ctccctcggc ggcaccagcc tggtcgccgc ccgcatggcg 1680

tcccagctcc gcatccacca ccccggcgtc tcggtcgccg acctctaccg ccacccggtg 1740

ctgcgcgaca tggccgagca cctcgactcg ctgggcggcc cggtggacga ggtccgcccg 1800

gtccgccccg tcccgcgccg caccggattc gtccaactcc tcgtccagac cggcctgtac 1860

ggcatcgccg gcctgcgcgg actggtcggg ctcgcgctcg cggacaacgt cctcggcctg 1920

ctcgccccgc aggtctgggc cccgcacacc gcgtggtggc tgatcatcgt cggctgggtg 1980

gtgctctaca gcgccccgat gcgttgcgcc ctcggcgcac tggccgcccg cgcgctcgcc 2040

ggcaccatca agcccggcgc ctacccgcgc ggcggcgcca cccacctgcg cctgtggacc 2100

gccgaacgcg tcgtcgccgc cttcggcgtc ccctccctgc tcggcacccc ctgggcgcgg 2160

ctctacgccc ggagcctggg ctgcgccaca gggcggaacg tggcgctgca caccatgccg 2220

ccggtcaccg gcctcgccga actcggcgac ggctgcagcg tcgaacccga ggccgacatc 2280

tccggctggt ggctcgacgg cgacaccctg cacatcggcg cggtccggat cggcgccggc 2340

gcccgggtcg cccaccgcag catgctgatg cccggcgccg tcgtcggcca gggcgccgaa 2400

ctcgcctccg gcgcctgcct ggacggagag atccccgacg gcgcctcgtg gtccggctcc 2460

ccggcccgcc cggccggcgc cgccgagcgg atggccggcg ccgcctggcc cgcccccgcc 2520

tggcagcgct cgcgccgctg gagcgccgcc tacggactga ccctgctggg cctgccgctg 2580

ctggccctgc tgtccaccgc gcccgccctg gtcggcgcgt acttcctgct ccgcgacagc 2640

ggcaccctcg ccacagccgg gcttcgcctg ctgctggccg tcccggtctt cacgctcctg 2700

accactggct gctccctcct cgtcaccgcc gccgtggtgc gcctcctcgg ccgcggcatc 2760

acgccgggac tgcaccccgc gagcggtggc gtcgcctggc gcgcctggct ggtcacccgc 2820

ctcctggacg gcgcccgcgg cagcctcttc ccgctctacg ccagcctcgg caccccgcac 2880

tggctgcggc tgctcggcgc caaggtcggc cggcacgcgg agatctccac cgtgctgccg 2940

ctgccctccc tgctgcacgt cgaggacggc gcgttcctcg ccgacgacac cctggtggcg 3000

cccttcgaac tccgcggcgg ctggctgcgg ttggggaccg tccggatcgg tcgccgggcc 3060

ttcgtcggca actccggcat cgtcgacccc ggccacgacg tgcccgatca cagcctggtc 3120

ggcgtgctct ccaacgcccc cgccgacggc gagcccggct cgtcctggct gggccggccc 3180

gccatgccgc tgccccgggt ggcgacccag gccgacccgg cgcgcacctt cgcaccgccg 3240

cgcaggctgg tccgggcccg cgccgccgtc gagctgtgcc gggtgctgcc gctgatgtgc 3300

ggcctggcgc tcgccgaggg cgtgttcctc accgagcagg acgccttcgc ccagggcggc 3360

ctcggtctcg ccgcactggt cggcgccccg ctgctgctgg cctcgggcct cgtggcgctg 3420

ctcgtcacca ccctcgcgaa gtggctgctg gtcggccgct tcacggtgag cgagcacccc 3480

ctgtggtcgt cgttcgtgtg gcgcaacgag ctctacgaca ccttcgtcga atcgctcgcc 3540

gtgccgtcga tggccggcgc gttcaccggc accccggtcc tgaactggtg gctgcgcacc 3600

ctcggcgcca agatcgggcg cggggtctgg ttggagagct actggctgcc ggagaccgac 3660

ctgatcaccg tcgccgacgg cgtcagcgtc aaccgcggct gcgtcctgca gacccacctc 3720

ttccacgacc ggatcatgcg gctggacacc gtccgcctcg ccgaaggctc ctcgctcggc 3780

ccgcacggca tcgtgctccc cggcaccgag gtcggggcgc gcgcctcgat cgcgccgtcg 3840

tccctggtca tgcgcggcga gagcgtcccg gcccacaccc ggtgggccgg caacccgatc 3900

gccggcgaac gccccgcccg ccccgtcccg gcacgcgcgg agggaggtgc ggccgcgtga 3960

<210>3

<211>3960

<212>DNA

<213> Artificial sequence

<400>3

atgagtagtc cgctgctgga gagcagcttt gaacctagcg agcccgctcc gcagcaagcc 60

ttatatcgca ccgctggtaa ccccgctcct cgcactttat tagatgttct ggatgcaaca 120

gcagccgcac acccgcaagc cattgcactg gatactggta gcgaggcact gacataccgt 180

gatctgtgca ttgaaatcga acgccgcgca cgccagctgc gtgatcgtgg cattggcccc 240

ggtgatcgtg ttggcgtgcg tgttccgagc ggcacagccg agttatattt aagtatttta 300

gcagttctgc gtagtggcgc agcctatgtt ccggttgatg ccgatgatcc cgatgagcgt 360

gccgccacag tttttcgcga ggccgccgtt tgcgcagtgt taggcccgga tggtccttta 420

cccggtcccg ctcgtcctct gggcgatcct cgtagcgctg gtccgcaaga tgacgcttgg 480

attatcttta ccagcggtag cactggtgca cctaaaggtg tggccgtgag ccatcgtagt 540

gccgccgcct ttgttgacgc cgaagcagac ttattttgcc aagatcaacc gctgggtccg 600

ggtgatcgcg tgttagccgg tttaagtgtg gcctttgacg caagctgcga agaaatgtgg 660

ctggcatggc gttatggcgc ttgtttagtt ccggcccctc gtgccttagt tcgtgccggt 720

catgagctgg gtccgtggct ggtggaacgc ggcatcacag ttgtgagtac cgtgccgact 780

ttagcagcac tgtggccgga tgaagcaatg cgtcgtgtcc gtttactgat cgttggtggc 840

gaaagctgtc cggctggttt agtggatcgt tttgccggtc cgggtcgtga gatgtggaac 900

acctatggtc cgacagagac caccgtggtt gcttgtgcag cacgtctgct gcccggtgag 960

ccggttcgta tcggtttacc gttaaagggt tggcaactgg ccgttgtgga tcgcaccggt 1020

caaccggtgc cgtttggcgc cgaaggcgaa ctgctgatta gtggcgtggg caccgcccgc 1080

tatttagatc cggcaaagga tgccgagcgc tttcgccccg atgatgcact gggtgccgca 1140

cgtgtgtatc gtactggtga tttagttcgt gccgaaccgg agggtctgct gtttgttggt 1200

cgtgccgatg accagattaa gctgggtggt cgccgtattg agctgggtga gatcgacgca 1260

gccttagccg cactgcccgg tgttcgtggc gccgcagcag cagttcagac aaccccggct 1320

ggtacccaag tgttagttgg ctacgttgtt ccggaacagc gcacagccga tggcagcagc 1380

tttcaacaag ataaggcccg cgcattactg caagaacgtc tgccggcaca actggtgccg 1440

gtgctggcag aagttgaaag tctgccgaca cgcaccagtg gcaaagtgga tcgtaaagca 1500

ctgccttggc ctctgcctag cgcaccggtg gatagtgcca ccggtgatcc cgctacagca 1560

ctggatggca cagcagcccg tctggctggt atctgggaag agttactggg cgttcgcccg 1620

ggcccggata gtgatttcgt ttctttaggt ggcacttctt tagttgcagc ccgtatggcc 1680

agccagctgc gcatccatca cccgggcgtt agcgtggcag atctgtaccg ccatcccgtt 1740

ctgcgcgata tggccgaaca tctggatagt ttaggcggtc cggttgatga ggttcgtccg 1800

gtgcgtccgg ttcctcgtcg tactggtttt gttcaattac tggttcagac cggtctgtac 1860

ggcatcgccg gtttacgcgg tctggttggt ctggctttag cagacaatgt gctgggtctg 1920

ttagcacctc aagtttgggc cccgcataca gcttggtggc tgatcattgt tggctgggtt 1980

gtgctgtaca gcgcacctat gcgttgtgca ttaggtgcat tagccgcacg cgcactggct 2040

ggtaccatta aaccgggtgc ataccctcgt ggtggtgcca cacatttacg tttatggacc 2100

gcagagcgcg tggtggcagc attcggtgtt ccgtctttac tgggtacacc gtgggcacgt 2160

ttatatgccc gcagcttagg ctgtgcaact ggtcgcaatg ttgctttaca taccatgcct 2220

ccggtgaccg gtctggccga gttaggtgat ggttgcagcg tggaaccgga agcagacatc 2280

agtggctggt ggctggacgg cgatacttta catatcggtg cagttcgcat cggtgccggt 2340

gcacgtgtgg cccatcgcag catgctgatg ccgggcgcag tggttggtca aggcgcagag 2400

ctggccagtg gtgcttgtct ggatggtgag attccggatg gcgccagttg gagcggtagt 2460

cccgctcgcc cggctggtgc cgccgaacgt atggctggtg cagcttggcc cgctcccgct 2520

tggcagcgta gccgtcgttg gagcgccgca tatggtctga cactgctggg tctgccttta 2580

ttagcactgc tgagcaccgc ccccgctctg gttggtgcct attttttact gcgtgatagc 2640

ggtacattag ccaccgccgg cttacgctta ctgctggccg tgccggtttt tactttactg 2700

acaaccggct gtagcttact ggtgaccgca gccgtggttc gcttactggg tcgtggtatt 2760

accccgggtc tgcatccggc cagcggtggc gttgcatggc gcgcatggct ggttacacgt 2820

ctgctggacg gcgcacgtgg tagcttattt ccgctgtacg catctttagg taccccgcat 2880

tggctgcgtc tgttaggtgc aaaggtgggt cgccacgcag aaattagcac agtgctgccg 2940

ttacctagtc tgttacatgt tgaagacggc gcatttctgg cagatgatac actggtggca 3000

ccgtttgaac tgcgtggtgg ctggttacgt ctgggtaccg ttcgcattgg tcgtcgcgcc 3060

tttgtgggca acagtggtat tgtggatccg ggccatgacg tgccggatca cagtttagtt 3120

ggcgttctga gcaacgcacc ggcagacggt gagcccggta gcagttggct gggtcgcccc 3180

gctatgcctt taccgcgtgt tgccacccaa gctgatcccg ctcgtacctt cgcaccccct 3240

cgtcgtctgg tgcgtgcacg tgcagccgtg gaactgtgtc gcgttctgcc gctgatgtgc 3300

ggtttagcac tggccgaagg tgtgttttta acagagcaag acgcctttgc ccaaggtggc 3360

ttaggcttag ctgcactggt cggtgcaccg ctgctgctgg caagtggctt agttgcactg 3420

ctggttacca cactggcaaa atggctgtta gtgggccgtt tcaccgtgag cgaacatccg 3480

ctgtggagca gctttgtgtg gcgtaacgag ctgtacgata cattcgtgga atctttagca 3540

gtgcctagca tggctggtgc cttcaccggt accccggtgc tgaactggtg gctgcgcact 3600

ttaggtgcaa aaattggtcg tggcgtgtgg ctggaaagtt attggctgcc cgaaacagat 3660

ctgatcaccg tggccgatgg tgtttctgtg aatcgcggct gcgttctgca aacccatctg 3720

tttcacgacc gcatcatgcg tttagataca gtgcgtctgg cagagggtagcagcttaggt 3780

cctcacggca ttgttctgcc gggcacagag gttggtgcac gtgcaagcat tgcacctagt 3840

tctttagtta tgcgcggtga aagtgttccg gcccataccc gctgggctgg taatcctatt 3900

gctggtgaac gtccggcccg tcccgttccg gcccgcgccg agggtggcgc agcagcataa 3960

<210>4

<211>43

<212>DNA

<213> Artificial sequence

<400>4

aaaaggagcg atttacatat gatgagtagt ccgctgctgg aga 43

<210>5

<211>43

<212>DNA

<213> Artificial sequence

<400>5

gagctcgact ctagaggatc cttatgctgc tgcgccaccc tcg 43

Claims

1. A recombinant Bacillus subtilis which expresses a pls gene encoding polylysine synthase using Bacillus subtilis as a host.

2. The recombinant Bacillus subtilis of claim 1 wherein the polylysine synthase has an amino acid sequence as set forth in SEQ ID No. 1.

3. The recombinant Bacillus subtilis according to claim 1 or 2, wherein the pls gene encoding polylysine synthase has the nucleotide sequence shown in SEQ ID No.2 or SEQ ID No. 3.

4. The recombinant Bacillus subtilis according to any one of claims 1 to 3, wherein the recombinant Bacillus subtilis expresses the polylysine synthase-encoding gene pls in Bacillus subtilis as a host and in the pMA5 plasmid, pHT01 plasmid or pHT43 plasmid.

5. A method for producing polylysine, which comprises the steps of inoculating the recombinant Bacillus subtilis of any one of claims 1 to 4 into a reaction system containing L-lysine for reaction to obtain a reaction solution containing polylysine, and separating the reaction solution containing polylysine to obtain polylysine.

6. The method for producing polylysine according to claim 5, wherein the concentration of L-lysine in the reaction system is 10 to 100 g/L.

7. A process for producing-polylysine according to claim 5 or 6, wherein the reaction system has a pH of 2.0 to 7.0.

8. Use of a recombinant bacillus subtilis according to any one of claims 1-4 or a method according to any one of claims 5-7 for the production of polylysine.

9. A method for producing polylysine synthase, which comprises the steps of inoculating the recombinant Bacillus subtilis of any one of claims 1 to 4 into a fermentation medium, fermenting to obtain a recombinant Bacillus subtilis containing polylysine synthase, crushing the recombinant Bacillus subtilis containing polylysine synthase to obtain a cell crushing liquid, and finally separating the cell crushing liquid to obtain the polylysine synthase.

10. Use of the recombinant Bacillus subtilis of any one of claims 1-4 or the method of claim 9 for the production of a polylysine synthase.