CN113151198B - Gamma-glutamine synthetase mutant, coding gene, amino acid sequence and application thereof - Google Patents

Abstract

The invention discloses a mutant of gamma-glutamyl methylamine synthetase, its coding gene, amino acid and application in theanine production, specifically a gamma-glutamyl methylamine synthetase mutant is obtained by gene engineering method; the mutant can play a good catalytic effect without being in a buffer salt solution, and can be used for efficiently synthesizing theanine by coupling a polyphosphate kinase method.

Description

Gamma-glutamine synthetase mutant, coding gene, amino acid sequence and application thereof

Technical Field

The invention relates to an enzyme mutant, in particular to a mutant of gamma-glutamine synthetase, a coding gene, amino acid and application in theanine production.

Background

L-theanine (L-theanine) belongs to amide compounds, is the most abundant free amino acid in tea and accounts for more than 50 percent of the total free amino acid. Theanine is a main component of the fragrance and the taste of the tea, and the content of the theanine plays a key role in the flavor and the quality of the tea. The theanine has stable property, and can be boiled for 5min or dissolved in pH3.0 and stored at 25 deg.C for 12 months without change in theanine content. Therefore, the properties of the theanine are not changed in the common food processing and sterilization processes, and the theanine is not found to be toxic in a toxicity test.

L-theanine is a functional active factor which is safe and integrates various physiological functions, and is widely applied to the industries of food, health care products and medicines.

The method for producing theanine by the microbial enzyme method is an economic and mild method in recent years and has great prospect in future industrial application. Gamma-glutamylmethylmethylamine synthase (GMAS) is a catalytic enzyme capable of catalyzing the synthesis of N-methyl-L-glutamine from L-glutamic acid and methylamine, a reaction that requires the consumption of ATP. In patent CN201410316269, L-theanine is efficiently produced by using gamma-glutamyl methylamine synthetase produced by escherichia coli, and a gamma-glutamyl methylamine synthetase gene is expressed in the escherichia coli, the theanine can be produced by using glutamic acid and ethylamine as substrates, 50mM limits the substrates, and the conversion rate of the glutamic acid reaches 69.8% after 8 hours; patent CN201510755912 expresses gamma-glutamine synthetase gene in colibacillus, can produce theanine by taking glutamic acid and ethylamine as substrates, has 150mM limitation substrates, has conversion rate of less than 50 percent, production period of longer than 30h and low efficiency, and is not suitable for industrial production. In CN201510973289, gamma-glutamyl methylamine synthetase and phosphokinase are used as catalysts, and in imidazole solution, L-sodium glutamate and ethylamine hydrochloride are used as substrates to synthesize L-theanine. The maximum limit substrate is 200mM in a 100mL system, the conversion rate is 87%, the reaction system is small, and imidazole is used as a reaction environment and is not friendly to environment and cost. Patent CN201880024038 discloses a method for efficiently producing theanine without adding ethylamine from the outside and without accumulation of residual ethylamine as a by-product, using a microorganism having enhanced activity of producing ethylamine using acetaldehyde and alanine as substrates and enhanced activity of γ -glutamylmethylamine synthase or glutaminase, but acetaldehyde is not safe, which is not so beneficial. Although gamma-glutamyl methylamine synthetase is a better catalyst, the efficiency of producing theanine is not high according to the reports in the literature or the patent invention documents. One reason for hindering the efficiency of theanine production by the microbial enzymatic method is that gamma-glutamyl methylamine synthetase is easily inactivated. From the reports of the related literature, the production rate of theanine decreases with the increase of the reaction time, and the rate follows the inactivation curve of the enzyme, which is determined by the nature of the enzyme itself. Therefore, how to improve the thermal stability of the gamma-glutamyl methylamine synthetase and improve the efficiency of producing theanine by the gamma-glutamyl methylamine synthetase provides an effective way for the industrial production of theanine by an enzyme method is a technical problem which needs to be solved at present.

Disclosure of Invention

Aiming at the defects in the prior art, the invention obtains the gamma-glutamyl methylamine synthetase mutant by a genetic engineering method; and the optimal temperature of the gamma-glutamyl methylamine synthetase mutant is improved by about 10 ℃ while the thermal stability of the gamma-glutamyl methylamine synthetase mutant is improved, the mutant can play a good catalytic effect without being in a buffer salt solution, and the mutant is used for efficiently synthesizing theanine by a method of coupling polyphosphate kinase.

The invention provides a gamma-glutamine synthetase mutant, and the amino acid sequence of the mutant is shown as SEQ ID NO. 3.

Further, the gene sequence of the gamma-glutamine synthetase mutant is shown as SEQ ID NO. 2; or the gene sequence for coding the mutant is the nucleotide sequence for coding the amino acid sequence shown in SEQ ID NO. 3. The gamma-glutamine synthetase mutant is the M69 mutant in the embodiment.

The second aspect of the invention provides a method for constructing a gamma-glutamine synthetase mutant, which comprises the following steps; and (4) obtaining random mutants according to a random mutation kit, and screening mutants with excellent performance. The kit in the method is any commercially available gene random mutation kit.

The third aspect of the invention provides an application of a gamma-glutamine synthetase mutant in theanine production.

Further, the application comprises the step of using the whole cells of the gamma-glutamine synthetase mutant in a catalytic system for producing theanine to perform reaction.

Further, the catalytic system for producing theanine comprises 300-600 mM sodium glutamate and/or glutamic acid; 350-600 mM ethylamine and/or ethylamine hydrochloride; 120-180 mM of a salt containing magnesium ions, preferably at a concentration of 140-160 mM; 1-5 mM MATP and/or ADP, preferably at a concentration of 2mM; and 100 to 200mM polyphosphate;

furthermore, the temperature of the catalytic system for theanine production is controlled within the range of 40-50 ℃, and the reaction pH can fluctuate within the range of 6-9;

furthermore, in the catalytic system for theanine production, 40-70 g/L of M69 wet bacteria and 30-50 g/L of bacteria capable of performing ATP cycle regeneration by using ADP and/or AMP as substrates are added. Preferably, the thallus capable of performing ATP cycle regeneration by taking ADP and/or AMP as a substrate is a patent CN201910642412, a mixed culture process of recombinant escherichia coli for producing glutathione and a strain BL21-pET30a-ppk2 in the application thereof.

In the above-mentioned technical solutions, preferred salts containing magnesium ions include magnesium chloride, magnesium sulfate, and the like;

in the above technical solutions, the preferable polyphosphate includes sodium hexametaphosphate, sodium tripolyphosphate, and the like;

in the above technical scheme, the preferable concentration of the sodium glutamate and/or the glutamic acid is 350-450 mM;

in the above technical scheme, the preferred concentration of ethylamine and/or ethylamine hydrochloride is 420-450 mM;

in the above technical scheme, the preferable concentration of the salt containing magnesium ions is 140-160 mM;

for the above-described embodiments, the preferred concentration of ATP and/or ADP is 2mM;

for the above-described embodiments, the preferred concentration of polyphosphate is 160 to 180mM;

in the above technical solution, the concentration of the added M69 wet cells is preferably 55 to 65g/L;

in the above-mentioned embodiment, the concentration of the added bacteria capable of performing ATP cyclic regeneration using ADP and/or AMP as a substrate is preferably 35 to 45g/L;

in the technical scheme, the preferable system temperature is controlled at 43-46 ℃;

for the above-described embodiments, the preferred reaction pH may be in the range of 6.5 to 7.5.

Compared with the prior art, the invention has the following beneficial effects:

the invention obtains a gamma-glutamyl methylamine synthetase mutant M69 by a genetic engineering method; compared with wild plants, the property of the strain is obviously improved, and is embodied in the following aspects: (1) the optimum temperature of the mutant is 10 ℃ higher than that of the original strain; (2) The production intensity at the optimum temperature is 2.88 times of that of the original bacteria; (3) The thermal stability of the enzyme is obviously improved, the half-life of the mutant is 5.52 times that of the original bacterium at 35 ℃, and the half-life is improved to 8.19 times that of the original bacterium at 45 ℃; (4) The mutant can exert a good catalytic effect without being in a buffer salt solution, and improves the activity of enzyme in a water system, so that the reaction cost is reduced, the subsequent purification process is simplified, the production period is shortened, and the mutant has important significance for large-scale production; (5) And polyphosphate kinase is coupled, so that ATP inhibition is relieved, ATP regeneration is realized, and the industrial cost is reduced.

Drawings

FIG. 1 optimal temperature for original bacteria and mutants;

FIG. 2 thermostability of the original strain and the mutant at 35 ℃ and 45 ℃;

FIG. 3 optimal pH for original bacteria and mutants;

FIG. 4 shows the optimum amount of magnesium chloride;

FIG. 5 M69 addition;

FIG. 6 PPK addition.

Detailed Description

The following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments.

In the present invention, percentages and percentages are by mass unless otherwise specifically indicated. Unless otherwise specified, the experimental methods used are conventional methods, and the materials, reagents and the like used are commercially available.

In the embodiment of the application, the wet PPK thallus is a patent CN201910642412, namely a mixed culture process of recombinant escherichia coli for producing glutathione and a bacterial strain BL21-pET30a-PPK2 in the application of the mixed culture process. The following preparation of this strain is extracted from example 1 of the description, as follows:

carrying out codon optimization on a target Gene GshF from Streptococcus thermophilus and ppk2 (Gene ID:3718134, VERSION; meanwhile, after the plasmid pET-30a is subjected to enzyme digestion at any position of a multiple cloning site, cutting gel and recycling, respectively establishing a recombination system by the linearized plasmid and fragments of GshF, -and ppk2 which are recycled according to the proportion and the dosage required by an EasyGeno rapid recombination cloning kit of Tiangen biochemistry technology, reacting for 15min at 50 ℃, instantly centrifuging after the reaction is finished, then placing on ice to cool to obtain a recombination product, and waiting for a subsequent transformation reaction.

TABLE 1 primer sequences

Primer name	Primer sequences
			GshF-F	CTTTAAGAAGGAGATATACATATGaccctgaaccaactgc
GshF-R	GTGGTGGTGGTGGTGGTGCTCGAGttaggtttggcctgccacaatc
			ppk2-F	CTTTAAGAAGGAGATATACATATGgccgaagatcgtgctatg
ppk2-R	GTGGTGGTGGTGGTGGTGCTCGAGtcaaccttgacgcggtttac

Coli BL21 competent cells were placed in ice, 5-10. Mu.L of recombinant product was added to the competent cell suspension, gently mixed, and left to stand in ice bath for 30min. Placing the centrifuge tube in 42 deg.C water bath for 60-90s, then quickly transferring the tube into ice bath, and cooling the cells for 2-3min without shaking the centrifuge tube; adding 350 μ L sterile LB culture medium (without antibiotic) into each centrifuge tube, mixing, shaking and culturing at 37 deg.C and 180rpm for 45min to express related resistance marker gene on plasmid and recover thallus; the transformation system was mixed well, and 100. Mu.L of transformed competent cells were pipetted onto LB solid agar medium containing KanR antibiotic, and the cells were spread evenly with a spreading bar gently. The plate was left at room temperature until the liquid was absorbed, inverted and incubated at 37 ℃ for 12-16h.

Inoculating the obtained colony to 1-5mL LB (containing KanR antibiotic) culture medium, shaking and culturing overnight at 37 deg.C, preserving strain, extracting plasmid, and sending to sequencing company to determine whether the insert is correct. The correct strains were named BL21-pET-30a-GshF, BL21-pET-30a-ppk2 and were left for the next experiment.

Wherein:

the sequence of the target gene GshF derived from Streptococcus thermophilus as described above is as follows:

/>

the sequence of the GshF gene after codon optimization is as follows:

the sequence of ppk2 from Rhodobacter sphaeroides as described above is as follows:

/>

the codon optimised ppk2 gene sequence described above is as follows:

the enzymatic properties, thermostability and half-life detection methods referred to in the examples of the present application are as follows:

1. determination of enzymatic Properties

Definition of enzyme activity: 1U enzyme activity was defined as the amount of cells required to produce 1. Mu.M of theanine per minute at 35 ℃, the reaction system contained 50mM sodium glutamate, 55mM ethylamine, 40mM magnesium chloride and 30mM ATP and 15g/L of gmas cells, the reaction was carried out for 60min in PBS solution at pH =7, an equal volume of 20% trichloroacetic acid was added for termination, and the theanine production was measured by HPLC to determine the enzyme activity.

After mutation, the enzymatic properties of the gmas may be changed, the optimal enzyme activity conditions are explored, and the enzymatic properties of the non-mutated WT (original strain) and the mutant M69 under the same conditions are analyzed and compared.

2. Thermal stability and half-life assays

Determination of temperature stability: the enzyme solution was diluted to a concentration of 30g/L with PBS, incubated at 35 ℃ and 45 ℃ and the residual enzyme activity was measured at different times of incubation.

t _1/2 The value refers to the corresponding time when the residual enzyme activity is 50% after the enzyme is treated at a specific temperature for a period of time. The specific determination method is as follows: residual enzyme activities of the enzyme after treatment at 35 ℃ and 45 ℃ for different times were measured and calculated, respectively, taking the activity of the unmasked gmas enzyme as 100%. The treatment time is used as the abscissa and Ln (% residual enzyme activity) is used as the ordinate, a time-Ln (% residual enzyme activity) curve is drawn, and t is calculated according to the graph _1/2 ＝Ln2/K _d ，K _d Is the slope of the graph.

EXAMPLE 1 construction of mutants

The theanine synthetase gene gmas sequence derived from methylotrophic methanol mays is SEQ ID NO.1 after codon optimization, is connected with a plasmid pET28 (a) and is transformed into E.coli BL21 to obtain an original bacterium E.coli BL21-pET28 (a) -gmas which is named as WT.

The method for obtaining the gamma-glutamine synthetase mutant M69 comprises the following steps:

1. according to QuickMution ^TM Designing a primer and random mutation for the gene random mutation kit, wherein the primer sequence is as follows:

random-F：GATATACATATGAAGAGCCTGGAAG；SEQ ID NO.4；

random-R：cccaagcttGTAGAATTGAACATAGCGG；SEQ ID NO.5；

2. random mutation PCR reaction

Random mutation PCR reaction the random mutation PCR reaction system was set with reference to the following table:

TABLE 1

Reagent	Final concentration	Volume of
			Double distilled water or MilliQ water	-	12.2μL
RandomMut buffer(10×)	1×	2μL
			Mutation enhancer(10×)	1×	2uL
dNTP(2.5mM)	0.25mM	2μL
			Template DNA	0.2pg-5ng/μL	1μL
Primer mixtures (10. Mu.M each)	0.2. Mu.M each	0.4μL
			RandomMut DNA polymerase	-	0.4μL
Total volume	-	20μL

The PCR instrument was set up according to the following parameters:

TABLE 2

3. Transformation of competent cells

10 μ L of PCR product was taken, 1% agarose was used for detection, and after observing the target band, 1 μ L of DpnI enzyme was added to the remaining PCR product, and mixed and incubated for 1h. Adding 2-5 μ L of the digested product and 50 μ L of competent cells, mixing, ice-cooling for 30min, heating in 42 deg.C water bath for 45s, and immediately placing on ice for 2-5min. Then adding 250 mu LLB culture medium, culturing at 200rpm and 37 ℃ for 1h, and taking 100-200 mu L of bacterial liquid to culture on a kanamycin-resistant plate overnight. Coli BL21-pET28 (a) -gmas-M69 with excellent properties is named as mutant M69, the nucleotide sequence of the mutant M69 is shown as SEQ ID NO.2, and the amino acid sequence of the mutant M69 is shown as SEQ ID NO. 3.

Expression of wild and mutant enzymes:

culturing original bacteria and mutant M69 in LB culture medium, inoculating to fermentation medium at 37 deg.C overnight at 200rpm, inoculating 5% of inoculum size, and performing amplification culture until cell OD ₆₀₀ = 0.4-1.0, 0.1mM IPTG was added, induction was performed overnight at low temperature, and whole cells were harvested by centrifugation as a catalyst.

The seed culture medium and the fermentation culture medium are as follows: 5g/L yeast extract powder, 10g/L peptone and 10g/L NaCl, sterilizing at 121 ℃ for 20min, cooling, and adding 10-100 mg/mL kanamycin.

Example 2

The mutant M69 wet thallus is used as a biocatalyst, and sodium glutamate and ethylamine hydrochloride are used as substrates to prepare theanine through biotransformation. The catalytic system is 10L, and comprises 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mM MATP,160mM sodium hexametaphosphate, 60g/L M69 wet cells and 40g/LPPK wet cells. The reaction system was reacted in an aqueous solution at 45 ℃ and pH =7, after the reaction was completed, the cells were removed by centrifugation, and the sample was filtered through a 0.22 μm membrane and then subjected to HPLC to detect the amount of theanine produced. The highest yield of theanine is 372mM, 65g/L, the reaction time is 12h, and the production intensity is 5.42g/L/h, which is 2.88 times of that of the original bacteria.

Example 3 Effect of temperature on enzyme Properties

The temperature can change the catalytic reaction speed of the enzyme and can also lead to the reduction or inactivation of the activity of the enzyme. The optimal reaction temperatures of the non-mutated WT and the mutant M69 were determined simultaneously. Reacting at 30, 35, 40, 45 and 50 deg.C for 60min. In a PBS solution of pH =7, the reaction system contained 50mM sodium glutamate, 55mM ethylamine, 40mM magnesium chloride and 30mM ATP and 15g/L of gmas cells. And (3) periodically measuring the change condition of theanine in the reaction solution by HPLC, taking the enzyme activity value of WT measured at 35 ℃ as 100%, and calculating the relative enzyme activity at other temperatures. As shown in FIG. 1, the optimum temperature of WT was 35 ℃ and that of M69 was around 45 ℃.

The non-mutated WT and the mutant M69 were incubated at 35 ℃ and 45 ℃ and the residual enzyme activity was determined at different incubation times, taking the enzyme activity at the time of non-incubation as 100%. The half-life was calculated from the measurement results shown in FIG. 2, and as a result, as shown in Table 3, it was found that the half-life of the mutant was 5.52 times that of the original strain at 35 ℃ and increased to 8.19 times that at 45 ℃.

TABLE 3

Half life period/h	35℃	45℃
			WT	12.48	2.78
M69	68.96	22.78

Example 4 Effect of pH on enzyme Properties

The enzyme reactions have the optimal pH value range, the activity of the enzyme to catalyze the reaction can be influenced by the pH value which is too high or too low, and the optimal reaction pH of the non-mutated WT and the mutant M69 can be simultaneously measured in the experiment. Several groups of 100ml reactions were prepared, the reaction system containing 50mM sodium glutamate, 55mM ethylamine, 40mM magnesium chloride and 30mM ATP and 15g/L of gmas cells. Respectively adjusting the pH values to 5.0, 6.0, 7.0, 8.0 and 9.0, placing the mixture at 35 ℃ for reaction for 60min, periodically measuring the change condition of theanine in the reaction solution by HPLC, taking the enzyme activity value without mutation measured under the pH =7 as 100%, and calculating the relative enzyme activity under other pH values.

As a result, as shown in FIG. 3, the optimum reaction pH was 7.0 for both the non-mutated WT and the mutant M69. Indicating that the optimum pH of the gmas was not altered before and after the mutation.

Example 5 reaction in non-buffered System

50mM sodium glutamate, 55mM ethylamine, 40mM magnesium chloride and 30mM matp and 15g/L of cells of the original bacteria and the mutant M69 were dissolved in PBS and pure water, respectively, pH =7 was adjusted, the reaction was performed at the respective optimum temperatures of the original bacteria and the mutant M69, and the theanine production was measured by HPLC after 60min, and the results are shown in Table 4. It is known that mutant M69 is available in a non-buffer system and has higher enzyme activity.

TABLE 4

yield/mM	PBS	Water (W)
			WT	35.4	31.2
M69	42.3	46.7

Example 6 addition of energy cycle

ATP as one of the substrates has a possibility of a product substrate inhibitory effect in industrial production at high concentration, while increasing the cost. The cyclic regeneration of ATP using PPK can effectively avoid the above problems. BL21-pET30a-ppk2 cells were obtained according to the method of patent 110387379A, and ATP regeneration was carried out using ADP, AMP and sodium hexametaphosphate as substrates. Replacing 30mM ATP with 10g/L BL21-pET30a-ppk2 cells and 20mM sodium hexametaphosphate, 2mM ATP in a 100mL reaction system, and further comprising 50mM sodium glutamate, 55mM ethylamine, 40mM magnesium chloride and 15g/L M69 cells; the reaction was carried out at 45 ℃ in an aqueous solution of pH =7, and changes in theanine in the reaction solution were measured periodically by HPLC. The reaction time is 60min, the conversion rate reaches 95.6 percent, which is 1.06 times of that of the ATP directly added.

Example 7 increasing substrate concentration

The method has higher economical efficiency in industrial production by increasing the concentration of the substrate. However, higher substrate concentration reactions can suffer from substrate inhibition, excess activator, or inappropriate enzyme addition if directly doubled. 400mM sodium glutamate, 440mM ethylamine, 2mMATP,160mM sodium hexametaphosphate, 120g/L of M69 wet cells and 80g/L of PPK wet cells were added to a 100mL reaction system. 320mM, 240mM, 160mM, and 80mM of magnesium chloride were added to the reaction solution, respectively, and the reaction was carried out at 45 ℃ and pH =7, and the theanine production was measured by HPLC. According to the curve in FIG. 4, 160mM magnesium chloride was chosen as activator in the reaction.

In a 100mL reaction system, 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mM MATP,160mM sodium hexametaphosphate and 80g/L of wet cells of PPK were added. 120g/L, 90g/L, 60g/L and 30g/L of wet M69 cells were added to the cells, and the reaction was carried out at 45 ℃ and pH 7, and the amount of theanine produced was measured by HPLC. From the graph of FIG. 5, it is considered that 60g/L of wet cells was sufficient to complete the reaction.

In a 100mL reaction system, 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mM MATP,160mM sodium hexametaphosphate and 60g/LM69 wet cells were added, 80g/L, 60g/L, 40g/L and 20g/L M69 wet cells were added, and the reaction was carried out at 45 ℃ and pH =7, and the theanine production amount was measured by HPLC. According to the graph of FIG. 6, 40g/L of wet cells of PPK was sufficient to provide sufficient ATP in the reaction.

Comparative example 1

Transformation effect of original bacteria

The theanine is prepared by biotransformation by taking the wet thalli of the gmas wild bacteria as a biocatalyst and taking sodium glutamate and ethylamine hydrochloride as substrates. The catalytic system is 10L and comprises 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mM ATP,160mM sodium hexametaphosphate, 60g/L wet gram of wild bacteria and 40g/L wet gram of PPK. The reaction system was reacted in an aqueous solution at 35 ℃ and pH =7, after the reaction was completed, the cells were removed by centrifugation, and the sample was filtered through a 0.22 μm membrane and then subjected to HPLC to detect the amount of theanine produced. The highest yield of theanine is 282mM, 48.9g/L, the reaction time is 26h, and the production intensity is 1.88g/L/h.

Transformation effects of other mutants:

other mutants D103C and P337C wet cells obtained by the method of example 1 and having cysteine as the mutated amino acid were used as biocatalysts, and sodium glutamate and ethylamine hydrochloride were used as substrates to prepare theanine by biotransformation. The catalytic system is 10L, and comprises 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mM MATP,160mM sodium hexametaphosphate, 60g/L D103C or P337C wet cells and 40g/L PPK wet cells. The reaction system was reacted in an aqueous solution at 35 ℃ and pH =7, the cells were removed by centrifugation after the reaction was completed, and the sample was filtered through a 0.22 μm membrane and subjected to HPLC to detect the theanine production. The highest theanine yields were 142mM and 290mM, respectively, and 24.5g/L and 51g/L, the reaction times were 28h and 23h, and the production strengths were only 0.88g/L/h and 2.2g/L/h. The activity is lower or similar to that of the original bacteria.

In summary, comparative and example data analysis of the present application shows that: the obtained mutant M69 can obviously improve the production strength when being applied to the theanine synthesis process, and although the amino acids of the mutants D103C and P337C form cysteine, the mutants do not achieve the same positive effect.

The above description is only a preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and those skilled in the art can easily conceive of changes or substitutions within the technical scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Sequence listing

<110> Daliano Yi biological shares Ltd

<120> mutant of gamma-glutamine synthetase, coding gene, amino acid sequence and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1332

<212> DNA

<213> codon-optimized theanine synthetase gmas Gene (none)

<400> 1

atgaagagcc tggaagaagc acaaaagttt ctggaagacc accatgtcaa gtatgtcctg 60

gcacagttcg tcgatattca cggcgttgct aaagtgaaga gcgttccggc gtctcatctg 120

aatgatattc tgaccacggg tgcaggtttt gcaggcggtg ctatttgggg taccggtatc 180

gcaccgaacg gtccggatta tatggcaatt ggtgaactga gtacgctgtc cctgatcccg 240

tggcagccgg gttatgcacg tctggtctgc gacggccacg tgaatggtaa accgtatgaa 300

tttgataccc gtgtggttct gaaacagcaa attgcacgtc tggcagaaaa gggttggacc 360

ctgtatacgg gtctggaacc ggaattttca ctgctgaaaa aggatgaaca tggcgcggtg 420

cacccgttcg atgactcgga cacgctgcaa aaaccgtgtt atgattacaa gggtattacc 480

cgccatagcc cgtttctgga aaaactgacg gaatctctgg ttgaagtcgg cctggacatt 540

tatcagatcg atcacgaaga cgccaatggt caatttgaaa tcaactatac ctacgccgat 600

tgcctgaaaa gtgcagatga ctacattatg ttcaagatgg cggcctccga aatcgcgaac 660

gaactgggta ttatctgtag ttttatgccg aaaccgttct ccaatcgtcc gggcaacggt 720

atgcacatgc acatgtcaat tggcgacggt aaaaagtcgc tgtttcagga tgactcagat 780

ccgtcgggcc tgggtctgag taaactggct tatcatttcc tgggcggtat cctggcacac 840

gcaccggcac tggcagctgt ttgcgcaccg accgtcaatt cttacaaacg tctggtcgtg 900

ggtcgcagcc tgtctggtgc tacctgggct ccggcgtata ttgcgtacgg caacaataac 960

cgtagcacgc tggttcgcat cccgtatggc cgtctggaac tgcgcctgcc ggatggttct 1020

tgtaacccgt acctggcaac cgcagcagtg attgcagctg gtctggacgg tgttgcacgt 1080

gaactggatc cgggcacggg tcgcgatgac aatctgtatg attacagcct ggaacagctg 1140

gccgaatttg gcattggtat cctgccgcaa aacctgggtg aagcactgga tgctctggaa 1200

gcggaccagg tcatcatgga tgcgatgggc ccgggtctgt ccaaagaatt tgttgaactg 1260

aagcgcatgg aatgggtgga ctatatgcgt catgtgtcgg actgggaaat caaccgctat 1320

gttcaattct ac 1332

<210> 2

<211> 1332

<212> DNA

<213> gamma-glutaminemethylamine synthetase mutant nucleotide sequence (none)

<400> 2

atgaagagcc tggaagaagc acaaaagttt ctggaagacc accatgtcaa gtatgtcctg 60

gcacagttcg tcgatattca cggcgttgct aaagtgaaga gcgttccggc gtctcatctg 120

aatgatattc tgaccacggg tgcaggtttt gcaggcggtg ctatttgggg taccggtatc 180

gcaccgaacg gtccggatta tatgtgcatt ggtgaactga gtacgctgtc cctgatcccg 240

tggcagccgg gttatgcacg tctggtctgc gacggccacg tgaatggtaa accgtatgaa 300

tttgataccc gtgtggttct gaaacagcaa attgcacgtc tggcagaaaa gggttggacc 360

ctgtatacgg gtctggaacc ggaattttca ctgctgaaaa aggatgaaca tggcgcggtg 420

cacccgttcg atgactcgga cacgctgcaa aaaccgtgtt atgattacaa gggtattacc 480

cgccatagcc cgtttctgga aaaactgacg gaatctctgg ttgaagtcgg cctggacatt 540

tatcagatcg atcacgaaga cgccaatggt caatttgaaa tcaactatac ctacgccgat 600

tgcctgaaaa gtgcagatga ctacattatg ttcaagatgg cggcctccga aatcgcgaac 660

gaactgggta ttatctgtag ttttatgccg aaaccgttct ccaatcgtcc gggcaacggt 720

atgcacatgc acatgtcaat tggcgacggt aaaaagtcgc tgtttcagga tgactcagat 780

ccgtcgggcc tgggtctgag taaactggct tatcatttcc tgggcggtat cctggcacac 840

gcaccggcac tggcagctgt ttgcgcaccg accgtcaatt cttacaaacg tctggtcgtg 900

ggtcgcagcc tgtctggtgc tacctgggct ccggcgtata ttgcgtacgg caacaataac 960

cgtagcacgc tggttcgcat cccgtatggc cgtctggaac tgcgcctgcc ggatggttct 1020

tgtaacccgt acctggcaac cgcagcagtg attgcagctg gtctggacgg tgttgcacgt 1080

gaactggatc cgggcacggg tcgcgatgac aatctgtatg attacagcct ggaacagctg 1140

gccgaatttg gcattggtat cctgccgcaa aacctgggtg aagcactgga tgctctggaa 1200

gcggaccagg tcatcatgga tgcgatgggc ccgggtctgt ccaaagaatt tgttgaactg 1260

aagcgcatgg aatgggtgga ctatatgcgt catgtgtcgg actgggaaat caaccgctat 1320

gttcaattct ac 1332

<210> 3

<211> 444

<212> PRT

<213> amino acid sequence of gamma-glutamyl methylamine synthetase mutant (none)

<400> 3

Met Lys Ser Leu Glu Glu Ala Gln Lys Phe Leu Glu Asp His His Val

1 5 10 15

Lys Tyr Val Leu Ala Gln Phe Val Asp Ile His Gly Val Ala Lys Val

20 25 30

Lys Ser Val Pro Ala Ser His Leu Asn Asp Ile Leu Thr Thr Gly Ala

35 40 45

Gly Phe Ala Gly Gly Ala Ile Trp Gly Thr Gly Ile Ala Pro Asn Gly

50 55 60

Pro Asp Tyr Met Cys Ile Gly Glu Leu Ser Thr Leu Ser Leu Ile Pro

65 70 75 80

Trp Gln Pro Gly Tyr Ala Arg Leu Val Cys Asp Gly His Val Asn Gly

85 90 95

Lys Pro Tyr Glu Phe Asp Thr Arg Val Val Leu Lys Gln Gln Ile Ala

100 105 110

Arg Leu Ala Glu Lys Gly Trp Thr Leu Tyr Thr Gly Leu Glu Pro Glu

115 120 125

Phe Ser Leu Leu Lys Lys Asp Glu His Gly Ala Val His Pro Phe Asp

130 135 140

Asp Ser Asp Thr Leu Gln Lys Pro Cys Tyr Asp Tyr Lys Gly Ile Thr

145 150 155 160

Arg His Ser Pro Phe Leu Glu Lys Leu Thr Glu Ser Leu Val Glu Val

165 170 175

Gly Leu Asp Ile Tyr Gln Ile Asp His Glu Asp Ala Asn Gly Gln Phe

180 185 190

Glu Ile Asn Tyr Thr Tyr Ala Asp Cys Leu Lys Ser Ala Asp Asp Tyr

195 200 205

Ile Met Phe Lys Met Ala Ala Ser Glu Ile Ala Asn Glu Leu Gly Ile

210 215 220

Ile Cys Ser Phe Met Pro Lys Pro Phe Ser Asn Arg Pro Gly Asn Gly

225 230 235 240

Met His Met His Met Ser Ile Gly Asp Gly Lys Lys Ser Leu Phe Gln

245 250 255

Asp Asp Ser Asp Pro Ser Gly Leu Gly Leu Ser Lys Leu Ala Tyr His

260 265 270

Phe Leu Gly Gly Ile Leu Ala His Ala Pro Ala Leu Ala Ala Val Cys

275 280 285

Ala Pro Thr Val Asn Ser Tyr Lys Arg Leu Val Val Gly Arg Ser Leu

290 295 300

Ser Gly Ala Thr Trp Ala Pro Ala Tyr Ile Ala Tyr Gly Asn Asn Asn

305 310 315 320

Arg Ser Thr Leu Val Arg Ile Pro Tyr Gly Arg Leu Glu Leu Arg Leu

325 330 335

Pro Asp Gly Ser Cys Asn Pro Tyr Leu Ala Thr Ala Ala Val Ile Ala

340 345 350

Ala Gly Leu Asp Gly Val Ala Arg Glu Leu Asp Pro Gly Thr Gly Arg

355 360 365

Asp Asp Asn Leu Tyr Asp Tyr Ser Leu Glu Gln Leu Ala Glu Phe Gly

370 375 380

Ile Gly Ile Leu Pro Gln Asn Leu Gly Glu Ala Leu Asp Ala Leu Glu

385 390 395 400

Ala Asp Gln Val Ile Met Asp Ala Met Gly Pro Gly Leu Ser Lys Glu

405 410 415

Phe Val Glu Leu Lys Arg Met Glu Trp Val Asp Tyr Met Arg His Val

420 425 430

Ser Asp Trp Glu Ile Asn Arg Tyr Val Gln Phe Tyr

435 440

<210> 4

<211> 25

<212> DNA

<213> random primer-F (none)

<400> 4

gatatacata tgaagagcct ggaag 25

<210> 5

<211> 28

<212> DNA

<213> random primer-R (none)

<400> 5

cccaagcttg tagaattgaa catagcgg 28

Claims (8)

1. A gamma-glutaminemethylamine synthetase mutant, characterized in that: the amino acid sequence of the protein for coding the mutant is shown as SEQ ID NO. 3.

2. Use of the gamma-glutaminemethylamine synthetase mutant as claimed in claim 1 for the production of theanine.

3. Use according to claim 2, characterized in that: the application comprises the step of using the whole cells of the gamma-glutamine synthetase mutant of claim 1 in a catalytic system for theanine production to carry out reaction; the catalytic system for theanine production comprises 300-600 mM sodium glutamate or glutamic acid, 350-600 mM ethylamine or ethylamine hydrochloride, 120-180mM magnesium ion-containing salt, 1-5 mM ATP or ADP, 100-200 mM polyphosphate, and 30-50 g/L of thalli capable of performing ATP cyclic regeneration by taking the ADP as a substrate.

4. Use according to claim 3, characterized in that: the temperature of a catalytic system for producing theanine is 40-50 ℃, and the reaction pH is 6-9.

5. Use according to claim 3, characterized in that: in the catalytic system for theanine production, the concentration of the whole cells of the gamma-glutamyl methylamine synthetase mutant in claim 1 is 40 to 70 g/L.

6. Use according to claim 3, characterized in that: the salt containing magnesium ions is selected from magnesium chloride and/or magnesium sulfate; the polyphosphate is selected from sodium hexametaphosphate or sodium tripolyphosphate.

7. Use according to claim 3, characterized in that: the concentration of the sodium glutamate or the glutamic acid is 350 to 450mM; the concentration of the ethylamine or ethylamine hydrochloride is 420 to 450mM; the concentration of the salt containing magnesium ions is 140 to 160mM; the concentration of ATP or ADP is 2mM; the concentration of the polyphosphate is 160 to 180 mM.

8. Use according to claim 3, characterized in that: the concentration of the bacteria capable of performing ATP cyclic regeneration by using ADP as a substrate is 35 to 45g/L; the system temperature is 43 to 46 ℃; the reaction pH is 6.5 to 7.5.

Images