CN109486794B - Chitinase mutant with improved enzyme activity - Google Patents

Chitinase mutant with improved enzyme activity Download PDF

Info

Publication number
CN109486794B
CN109486794B CN201811484682.2A CN201811484682A CN109486794B CN 109486794 B CN109486794 B CN 109486794B CN 201811484682 A CN201811484682 A CN 201811484682A CN 109486794 B CN109486794 B CN 109486794B
Authority
CN
China
Prior art keywords
gly
asp
ala
lys
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811484682.2A
Other languages
Chinese (zh)
Other versions
CN109486794A (en
Inventor
刘龙
潘梦妍
吕雪芹
堵国成
李江华
陈坚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN201811484682.2A priority Critical patent/CN109486794B/en
Publication of CN109486794A publication Critical patent/CN109486794A/en
Application granted granted Critical
Publication of CN109486794B publication Critical patent/CN109486794B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2442—Chitinase (3.2.1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01014—Chitinase (3.2.1.14)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a chitinase mutant with improved enzyme activity, and belongs to the technical field of genetic engineering and enzyme engineering. According to the invention, the 43 th cysteine, the 273 rd phenylalanine and the 336 th glutamic acid near the catalytic structural domain of the chitinase molecule are mutated into aspartic acid, the 273 th phenylalanine and the 336 th glutamic acid are mutated into arginine through a site-specific mutation mode, so that the enzyme activity of the bacterial strain for expressing the chitinase is obviously improved, wherein the enzyme activities of the single mutant strains F273W and E336R are respectively improved by 1.37 times and 1.22 times compared with that of the original bacterial strain. The enzyme production capability and the catalytic efficiency of the modified strain are improved, and the content of chitooligosaccharide in the purified mutant is detected by HPLC, so that the sugar production of the F273W mutant is 1.65g/L after catalyzing for 3h, wherein the GlcNAc is 0.12g/L, (GlcNAc)21.53g/L, which is increased by 49.7 percent compared with the wild strain.

Description

Chitinase mutant with improved enzyme activity
Technical Field
The invention relates to a chitinase mutant with improved enzyme activity, and belongs to the technical field of enzyme engineering and gene engineering.
Background
The chitin enzyme (EC 3.2.1.14), also called chitinase, can catalyze the rupture of insoluble chitin sugar chain β -1,4 glycosidic bond to generate water-soluble chitin oligosaccharide, because the chitin enzyme can be used as a biological control agent for developing transgenic plants to achieve the purpose of disease resistance, and can also be used for protoplasm separation, cytochemical localization and single-cell protein production, the chitin enzyme has important application in agriculture, biotechnology, food and sanitation.
The chitinase is divided into 3 types, including endo-chitinase, exo-chitinase and β -N-acetylglucosaminidase, wherein the enzymes can cut chitin into chitooligosaccharide with different polymerization degrees by using chitin as a substrate, the endo-chitinase can randomly cut β -1,4 glycosidic bonds in chitin sugar chains to release N-acetylchitosane, and the exo-chitinase can continuously cut from the non-reducing end of the chitin sugar chains to release (GlcNAc)2(ii) a N-acetylglucosaminidase capable of hydrolyzing (GlcNAc)2Releasing GlcNAc.
Chitinase is widely found in animals, plants, and microorganisms (including bacteria, fungi, slime bacteria, protozoa, algae, etc.). The content of the chitinase in animals and plants is low, the extraction is difficult, and the production of the chitinase by a microbiological method has the advantages of easy culture, operation, low cost and the like, thereby becoming the key point of the research of broad students. At present, microorganisms for producing chitinase are mainly researched to comprise Paenibacillus barengoltzii, Marine Bacterium (Alteromonas sp. Strong 0-7), Streptomyces thermovirosus OPC-520, Bacillus cereus and the like, but the yield of the chitinase in wild strains is very low and is only 0.83-1.13U/mL.
At present, there are researches to try to improve the expression level of the chitinase by technical means such as heterologous expression, enzyme molecule modification and the like, for example, heterologous expression of the chitinase gene in escherichia coli or pichia pastoris and modification of a substrate binding domain and a catalytic domain of the chitinase by site-specific mutagenesis or random mutagenesis to improve the enzyme activity, but the heterologous expression of the chitinase gene in escherichia coli is easy to form an inclusion body; when the chitinase gene is expressed in escherichia coli and pichia pastoris in a heterologous way, the chitinase is intracellular secretion, so that the wall breaking is needed for extracting the chitinase, and the enzyme activity loss is caused; heterologous expression of chitinase genes in pichia pastoris is complex in operation and long in culture period; the substrate binding domain and the catalytic domain of the chitinase are modified in a random mutation mode to improve the uncertainty of random mutation of the enzyme activity, so that the screening is difficult, and the technologies cannot be really applied to industrial production.
Therefore, a new method capable of greatly improving the expression level of the chitinase by overcoming the defects of low expression level, easy formation of inclusion bodies, enzyme activity loss caused by wall breaking and the like is urgently needed to be found.
Disclosure of Invention
The first purpose of the invention is to provide a chitinase mutant, which contains an amino acid sequence shown as SEQ ID NO. 2-6.
The second objective of the invention is to provide a gene for encoding the above chitinase mutant.
In one embodiment of the invention, the nucleotide sequences of the genes encoding the chitinase mutants C43D, F273W, E336R, C43D/F273W and C43D/F273W/E336R are respectively shown in SEQ ID NO.10-14
The third object of the present invention is to provide a vector containing the above gene.
The fourth purpose of the invention is to provide a cell expressing the above chitinase mutant.
The fifth purpose of the invention is to provide a genetic engineering bacterium, which takes bacillus subtilis as a host to express the chitinase mutant.
In one embodiment of the present invention, bacillus subtilis WB600 is used as a host, and pP43NMK is used as an expression vector.
The sixth purpose of the invention is to provide a method for improving the enzymatic activity of the chitinase, which is to mutate the 43 th cysteine of the chitinase with the amino acid sequence shown as SEQ ID NO.1 into aspartic acid (the amino acid sequence is shown as SEQ ID NO. 2);
or, the 273 th phenylalanine is mutated into tryptophan (the amino acid sequence is shown as SEQ ID NO. 3);
or mutating the 336 th glutamic acid into arginine (the amino acid sequence is shown as SEQ ID NO. 4);
or, the 43 th cysteine is mutated into aspartic acid, and the 273 rd phenylalanine is mutated into tryptophan (the amino acid sequence is shown as SEQ ID NO. 5);
or, the cysteine at the 43 th position is mutated into aspartic acid, the phenylalanine at the 273 th position is mutated into tryptophan, and the glutamic acid at the 336 th position is mutated into arginine (the amino acid sequence is shown as SEQ ID NO. 6).
The seventh purpose of the invention is to provide the application of the genetic engineering bacteria in the field of fermentation.
The eighth purpose of the invention is to provide a method for producing the above chitinase mutant, which comprises the steps of inoculating the above genetic engineering bacteria into an LB liquid culture medium, culturing at 35-40 ℃ for 7-10h, transferring into a TB culture medium, wherein the inoculation amount is 2-5%, and culturing at 35-40 ℃ for 12-14 h.
The ninth purpose of the invention is to provide the application of the above chitin enzyme mutant in the fields of agriculture, biology, cosmetics, food or sanitation.
According to the invention, the 43 th amino acid (cysteine) near the catalytic domain of the chitinase molecule is mutated into aspartic acid, the 273 th amino acid (phenylalanine) is mutated into tryptophan, and the 336 th amino acid (glutamic acid) is mutated into arginine by means of site-specific mutagenesis, so that the enzymatic activity of the bacterial strain for expressing the chitinase is obviously improved, wherein the enzymatic activities of the single mutant strains F273W and E336R are respectively improved by 1.37 times and 1.22 times compared with that of the original bacterial strain. The enzyme production capability and the catalytic efficiency of the modified strain are improved, and the content of chitooligosaccharide in the purified mutant is detected by HPLC, so that the sugar production of the F273W mutant is 1.65g/L after catalyzing for 3h, wherein the GlcNAc is 0.12g/L, (GlcNAc)21.53g/L, which is increased by 49.7 percent compared with the wild strain.
Drawings
FIG. 1: the mutant has enzyme activity.
FIG. 2: protein electropherogram of purified mutants, M: marker; 1: C43D; 2: penetrating liquid; 3: 20% of B; 4: F273W; 5: penetrating liquid; 6: 15% of B; 7: 20% of B; 8: E336R; 9: penetrating liquid; 10: 15% of B.
FIG. 3: product content after mutant catalysis.
Detailed Description
LB culture medium: 10g/L of tryptone, 5g/L, NaCl 10g/L of yeast powder and 7.0 of pH.
TB culture medium: peptone 12g/L, yeast extract 24g/L, glycerin 5g/L, KH2PO4 17mmol/L、K2HPO472mmol/L。
Measuring the enzymatic activity of the chitinase by adopting a spectrophotometric method, wherein 1 unit of the enzymatic activity of the chitinase is defined as: the amount of enzyme required to release 1. mu. mol of reducing sugar per hour was one enzyme activity unit (U/mL) under the reaction conditions of 60 ℃. Enzyme activity determination conditions: at 60 ℃, 0.1mL of 1% colloidal chitin, 0.3mL of disodium hydrogen phosphate-citrate buffer solution (pH5.0) and 0.1mL of fermentation supernatant are subjected to heat preservation for 15min, heating is carried out at 100 ℃ for 5min to terminate the reaction, 1mL of LDNS reagent is added, heating is carried out in a boiling water bath for 10min, then rapid cooling is carried out, and the volume is adjusted to 5mL by deionized water. And (3) measuring an absorbance value at 540nm by using a spectrophotometer, drawing a standard curve by virtue of GlcNAc, and calculating the enzyme activity according to the standard curve.
EXAMPLE 1 construction of the Strain producing chitinase
Chemically synthesizing a chitinase gene fragment chisb (the nucleotide sequence is shown as SEQ ID NO. 9). The PCR conditions were: 3min at 98 ℃, 30 cycles (10 s at 98 ℃, 15s at 55 ℃ and 1min at 72 ℃) and 5min at 72 ℃. The linearized pP43NMK vector is obtained by performing whole-plasmid PCR amplification by using pP43NMK as a template and p43-F and p43-R as primers (see Table 1). The PCR conditions were: 5min at 98 ℃, 25 cycles (10 s at 98 ℃, 15s at 55 ℃, 4min at 72 ℃ for 30s), 5min at 72 ℃. And (3) after the amplification products are subjected to electrophoresis detection, purifying and recovering the PCR products by using a gel recovery kit. Clonexpress by one-step cloning kitTMOne StepCloning Kit (Vazyme Biotech co., ltd. nanking, China) fuses a chitinase gene fragment and a linearized vector pP43NMK to obtain a recombinant plasmid pP43 NMK-chisb.
The fused recombinant plasmid pP43NMK-chisb was transformed into competent E.coli JM109, and positive colonies were picked with ampicillin LB plate. After overnight shake culture at 37 ℃ plasmids were extracted and transformants were sequenced by Tianlin (tin-free) GmbH.
TABLE 1 primers
Figure BDA0001894201480000031
Figure BDA0001894201480000041
Example 2 verification of the production Strain of the chitinase
The correct plasmid, pP43NMK-chisb, sequenced in example 1 was transformed into Bacillus subtilis WB 600. Selecting a transformant, inoculating the transformant into an LB culture medium, and culturing for 8 hours at 37 ℃; transferring the cells into a TB culture medium, wherein the inoculum size is 2%, culturing the cells at 37 ℃ for 12h, collecting fermentation supernatant, and detecting the enzyme activity of the fermentation supernatant, wherein the result shows that the chitinase is secreted to the outside of the cells, and the enzyme activity is 28.98U/mL (the result is shown in figure 1).
EXAMPLE 3 obtaining of mutant strains
Utilizing a site-directed mutagenesis kit (purchased from TaKaRa, the commodity number: KM101) to design a primer (shown in table 2), taking constructed pP43NMK-chisb as a template to carry out PCR, and mutating the 43 th cysteine near the catalytic domain of the chitinase molecule into aspartic acid; phenylalanine 273 is mutated to tryptophan; or the 336 th glutamic acid is mutated into arginine which is named as C43D, F273W and E336R respectively. The PCR reaction conditions were 98 ℃ for 5min, 30 cycles (98 ℃ for 10s, 55 ℃ for 15s, 72 ℃ for 4min30s), and 72 ℃ for 5 min. And purifying and recovering the PCR product by using a gel recovery kit, and carrying out electrophoresis detection on the recovered product. Coli JM109 was transformed with the product, sequenced by Tianlin (tin-free) LLC, and the transformants were designated as pP43NMK-chisb-C43D, pP43NMK-chisb-F273W and pP43 NMK-chisb-E336R.
Taking a plasmid of a correctly sequenced strain pP43NMK-chisb-C43D as a template, carrying out compound mutation on 273 th phenylalanine of a chitinase molecule, carrying out mutation to obtain tryptophan, and naming the mutation as C43D/F273W, wherein a transformant is sequenced by Tianlin (tin-free) Limited liability company and named as pP43 NMK-chisb-C43D/F273W.
The plasmid of a correctly sequenced strain pP43NMK-chisb-C43D/F273W is used as a template, the 336 th glutamic acid of a chitinase molecule is subjected to compound mutation to obtain arginine, the mutation is named as C43D/F273W/E336R, a transformant is sequenced by Tianlin (tin-free) Limited liability company, and the transformant is named as pP43 NMK-chisb-C43D/F273W/E336R.
TABLE 2 site-directed mutagenesis primer sequences
Primer name Primer sequence (5'-3')
C43D-F GCATTTGCCGACATTGACTGGGAGGGACGC
C43D-R GTCAATGTCGGCAAATGCATAGTTTATATGAG
F273W-F CCGAACGCAGAAACGTGGAATATTGAGAGC
F273W-R CCACGTTTCTGCGTTCGGCACCCCTGCCTC
E336R-F CGATTTTTCTGATTTGAGAAAGAACTATATC
E336R-R TCTCAAATCAGAAAAATCGAACACTCCTTT
Example 4 verification of the production Strain of the chitinase
Transforming the plasmid with correct sequencing into Bacillus subtilis WB600, selecting a transformant, inoculating the transformant into an LB liquid culture medium, culturing at 37 ℃ for 8h, and transferring into a TB culture medium, wherein the inoculation amount is 2%, and the culture time is 37 ℃ for 12 h. Collecting the supernatant, and detecting the activity of the fermentation supernatant, the results are shown in FIG. 1. The experimental result shows that compared with the original strain, the enzyme activity is improved, and the enzyme activities of WT, C43D, F273W, E336R, C43D/F273W and C43D/F273W/E336R are 28.98U/mL, 32.43U/mL, 39.74U/mL, 32.46U/mL, 34.96U/mL and 30.42U/mL respectively; wherein the enzyme activities of the single mutant strains F273W and E336R are respectively improved by 1.37 times and 1.22 times compared with the original strain; compared with the original strain, the enzyme activity of the compound mutant strain C43D/F273W is improved by 1.14 times.
Example 5 purification of mutants
The supernatant after 12h of fermentation was collected according to the procedure described in example 4. And (3) performing nickel column purification by using a His tag carried by the C end of the chitinase gene chisb. The buffer solution required for purification is solution A: 40mM Tris-HCl, 150mM NaCl (pH 7.5); and B, liquid B: 40mM Tris-HCl, 150mM NaCl, 500mM imidazole (pH 7.5). The purification results are shown in FIG. 2. Research results show that the three mutant strains can be purified by using a Ni column, the C43D mutant strain can be completely eluted by using 20% of liquid B, and target proteins do not exist in penetrating liquid; the F273W and E336R mutants could be completely eluted with 15% B solution, and the penetrated solution was free of the target protein.
Example 6 detection of catalytic Activity of mutants
Reacting the purified enzyme solution with substrate colloidal chitin with final concentration of 2g/L at 60 deg.C for 3h, heating at 100 deg.C for 5min to terminate the reaction, centrifuging at 14000rpm for 10min to obtain supernatant, and using for HPLC detection. The reaction system was as follows (1 mL): 450 μ L buffer (disodium hydrogen phosphate-citric acid buffer, pH5.0), 300 μ L colloidal chitin, and 250 μ L pure enzyme solution. The results of the detection are shown in FIG. 3. The yield is respectively as follows: starting strain WT: 0.09g/L GlcNAc and 0.74g/L (GlcNAc)2(ii) a C43D: 0.09g/LGlcNAc and 1.15g/L (GlcNAc)2(ii) a F273W: 0.12g/L GlcNAc and 1.53g/L (GlcNAc)2(ii) a E336R: 0.17g/LGlcNAc and 1.31g/L (GlcNAc)2。
Comparative example
The constructed pP43NMK-chisb is used as a template, 57 th asparagine and 308 th proline of a chitinase molecule are respectively mutated into histidine by the same method, and mutation primers are shown in Table 3. The transformants were sequenced by Tianlin (tin-free) GmbH under the names of N57H (amino acid sequence shown in SEQ ID NO.7 and nucleotide sequence shown in SEQ ID NO. 15) and P308H (amino acid sequence shown in SEQ ID NO.8 and nucleotide sequence shown in SEQ ID NO. 16), and the transformants were named pP43NMK-chisb-N57H and pP43 NMK-chisb-P308H. The enzyme activities of the N57H mutant strain and the P308H mutant strain are reduced compared with the original strain, and are respectively 13.2U/mL and 8.7U/mL.
TABLE 3 mutant primers
Primer name Primer sequence (5'-3')
N57H-F GATCCTACAGGGCCACACCCACAGAAATGG
N57H-F GTGTGGCCCTGTAGGATCAGGATTCCCATG
P308H-F TGGAGTAATTGCGAACATGCTGATAACGGT
P308H-R ATGTTCGCAAATTACTCCAACCTCTACCGT
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> a chitinase mutant with improved enzyme activity
<160>30
<170>PatentIn version 3.3
<210>1
<211>563
<212>PRT
<213>Bacillus sp. DAU101
<400>1
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Cys Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro Asn Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150155 160
Asp Leu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Phe Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu Pro Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310315 320
Lys Glu Gly Thr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Glu
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420 425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475480
Thr Thr Tyr Ser Phe Thr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530 535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys
<210>2
<211>563
<212>PRT
<213> Artificial Synthesis
<400>2
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Asp Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro Asn Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150 155 160
Asp Leu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Phe Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu Pro Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310 315 320
Lys Glu Gly Thr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Glu
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420 425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475 480
Thr Thr Tyr Ser Phe Thr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530 535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys
<210>3
<211>563
<212>PRT
<213> Artificial Synthesis
<400>3
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Cys Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro Asn Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150 155 160
Asp Leu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Trp Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu Pro Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310 315 320
Lys Glu Gly Thr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Glu
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475 480
Thr Thr Tyr Ser Phe Thr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530 535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys
<210>4
<211>563
<212>PRT
<213> Artificial Synthesis
<400>4
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Cys Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro Asn Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150 155 160
AspLeu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Phe Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu Pro Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310 315 320
Lys Glu GlyThr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Arg
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420 425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475 480
Thr Thr Tyr Ser PheThr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530 535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys
<210>5
<211>563
<212>PRT
<213> Artificial Synthesis
<400>5
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Asp Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro Asn Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150 155 160
Asp Leu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Trp Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu Pro Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310 315 320
Lys Glu Gly Thr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Glu
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420 425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475 480
Thr Thr Tyr Ser Phe Thr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys
<210>6
<211>563
<212>PRT
<213> Artificial Synthesis
<400>6
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Asp Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro Asn Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150 155 160
Asp Leu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Trp Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu Pro Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310 315 320
Lys Glu Gly Thr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Arg
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420 425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475 480
Thr Thr Tyr Ser Phe Thr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530 535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys
<210>7
<211>569
<212>PRT
<213> Artificial Synthesis
<400>7
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Asp Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro His Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150 155 160
Asp Leu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Trp Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu Pro Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310 315 320
Lys Glu Gly Thr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Arg
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420 425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475 480
Thr Thr Tyr Ser Phe Thr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530 535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys His His His His His His
565
<210>8
<211>569
<212>PRT
<213> Artificial Synthesis
<400>8
Ser Ser Asp Lys Ser Tyr Lys Ile Ile Gly Tyr Tyr Pro Ser Trp Gly
1 5 10 15
Ala Tyr Gly Arg Asp Phe Gln Val Trp Asp Met Asp Ala Ser Lys Val
20 25 30
Ser His Ile Asn Tyr Ala Phe Ala Asp Ile Asp Trp Glu Gly Arg His
35 40 45
Gly Asn Pro Asp Pro Thr Gly Pro His Pro Gln Lys Trp Ser Cys Gln
50 55 60
Asp Glu Asn Gly Val Ile Asp Val Pro Asn Gly Ser Ile Val Met Gly
65 70 75 80
Asp Pro Trp Ile Asp Val Gln Lys Ser Asn Ala Gly Asp Thr Trp Asp
85 90 95
Glu Pro Ile Arg Gly Asn Phe Lys Gln Leu Leu Lys Leu Lys Lys Asn
100 105 110
His Pro His Leu Lys Thr Phe Ile Ser Val Gly Gly Trp Ser Trp Ser
115 120 125
Asn Arg Phe Ser Asp Val Ala Ala Asp Pro Ala Ala Arg Glu Asn Phe
130 135 140
Ala Ala Ser Ala Val Asp Phe Leu Arg Lys Tyr Gly Phe Asp Gly Val
145 150 155 160
Asp Leu Asp Trp Glu Tyr Pro Val Ser Gly Gly Leu Pro Gly Asn Ser
165 170 175
Thr Arg Pro Glu Asp Lys Arg Asn Tyr Thr Leu Leu Leu Gln Asp Val
180 185 190
Arg Glu Lys Leu Asp Ala Ala Glu Ala Lys Asp Gly Lys Lys Tyr Leu
195 200 205
Leu Thr Ile Ala Ser Gly Ala Ser Pro Glu Tyr Val Ser Asn Thr Glu
210 215 220
Leu Asp Lys Ile Ala Glu Thr Val Asp Trp Ile Asn Ile Met Thr Tyr
225 230 235 240
Asp Phe Asn Gly Gly Trp Gln Ser Ile Ser Ala His Asn Ala Pro Leu
245 250 255
Phe Tyr Asp Pro Lys Ala Lys Glu Ala Gly Val Pro Asn Ala Glu Thr
260 265 270
Trp Asn Ile Glu Ser Thr Val Lys Arg Tyr Lys Glu Ala Gly Val Lys
275 280 285
Ala Asp Lys Leu Val Leu Gly Thr Pro Phe Tyr Gly Arg Gly Trp Ser
290 295 300
Asn Cys Glu His Ala Asp Asn Gly Glu Tyr Gln Lys Cys Gly Pro Val
305 310 315 320
Lys Glu Gly Thr Trp Glu Lys Gly Val Phe Asp Phe Ser Asp Leu Arg
325 330 335
Lys Asn Tyr Ile Asn Lys Asn Gly Tyr Lys Arg Tyr Trp Asn Asp Arg
340 345 350
Ala Lys Val Pro Phe Leu Tyr Asn Ala Glu Asn Gly Asn Phe Ile Thr
355 360 365
Tyr Asp Asp Glu Glu Ser Tyr Gly Tyr Lys Thr Asp Leu Ile Gln Ser
370 375 380
Asn Gly Leu Ser Gly Ala Met Phe Trp Asp Phe Ser Gly Asp Ser Asn
385 390 395 400
Gln Thr Leu Leu Asn Lys Leu Ala Ala Asp Leu Gly Phe Ala Pro Gly
405 410 415
Gly Gly Asn Pro Glu Pro Pro Ala Ser Ala Pro Gly Asn Leu Arg Val
420 425 430
Thr Glu Lys Thr Ala Thr Ser Ile Ser Leu Val Trp Asp Ala Pro Ser
435 440 445
Asp Gly Ala Asn Ile Ala Glu Tyr Val Leu Ser Tyr Glu Gly Gly Ala
450 455 460
Val Ser Val Lys Asp Thr Ser Ala Thr Ile Gly Gln Leu Lys Pro Asn
465 470 475 480
Thr Thr Tyr Ser Phe Thr Val Ser Ala Lys Asp Ala Asp Gly Lys Leu
485 490 495
His Thr Gly Pro Thr Ile Glu Ala Thr Thr Asn Ser Asp Gln Thr Cys
500 505 510
Gly Tyr Asn Glu Trp Lys Asp Thr Ala Val Tyr Thr Gly Gly Asp Arg
515 520 525
Val Val Phe Asn Gly Lys Val Tyr Glu Ala Lys Trp Trp Thr Lys Gly
530 535 540
Glu Gln Pro Asp Gln Ala Gly Glu Ser Gly Val Trp Lys Leu Ile Gly
545 550 555 560
Asp Cys Lys His His His His His His
565
<210>9
<211>1710
<212>DNA
<213>Bacillus sp. DAU101
<400>9
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgc ctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacatttgct gggagggacg ccatgggaat cctgatccta cagggccaaa cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaat cgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa 540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgttta atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acctgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttggagaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>10
<211>1710
<212>DNA
<213> Artificial Synthesis
<400>10
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgc ctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacattgact gggagggacg ccatgggaat cctgatccta cagggccaaa cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaat cgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa 540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat 720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgttta atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acctgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttggagaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>11
<211>1710
<212>DNA
<213> Artificial Synthesis
<400>11
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgc ctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacatttgct gggagggacg ccatgggaat cctgatccta cagggccaaa cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaatcgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa 540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat 720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgtgga atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acctgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttggagaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>12
<211>1710
<212>DNA
<213> Artificial Synthesis
<400>12
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgc ctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacatttgct gggagggacg ccatgggaat cctgatccta cagggccaaa cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaat cgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat 720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgttta atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acctgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttgagaaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>13
<211>1710
<212>DNA
<213> Artificial Synthesis
<400>13
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgc ctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacattgact gggagggacg ccatgggaat cctgatccta cagggccaaa cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaat cgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa 540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat 720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgtgga atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acctgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttggagaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>14
<211>1710
<212>DNA
<213> Artificial Synthesis
<400>14
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgcctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacattgact gggagggacg ccatgggaat cctgatccta cagggccaaa cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaat cgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa 540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat 720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgtgga atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acctgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttgagaaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>15
<211>1710
<212>DNA
<213> Artificial Synthesis
<400>15
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgc ctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacatttgct gggagggacg ccatgggaat cctgatccta cagggccaca cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaat cgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa 540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat 720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgttta atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acctgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttggagaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>16
<211>1710
<212>DNA
<213> Artificial Synthesis
<400>16
agttccgaca agtcttataa gataataggt tattaccctt cttggggtgc ctacggacgg 60
gattttcagg tgtgggatat ggatgcgtct aaggtgtctc atataaacta tgcatttgcc 120
gacatttgct gggagggacg ccatgggaat cctgatccta cagggccaaa cccacagaaa 180
tggagctgtc aagacgagaa tggcgtgatt gatgtgccta atggatcaat cgtgatgggt 240
gacccgtgga ttgatgtcca aaaaagcaac gcaggagata catgggatga gccgattaga 300
ggaaatttca aacaactcct caagttgaag aaaaatcatc cgcaccttaa gacgtttatc 360
tctgtggggg gttggagttg gtcaaataga ttttctgatg tagcggctga cccggcagca 420
cgtgaaaact tcgccgccag cgcagtggac tttctgcgga agtacggttt tgacggcgtt 480
gacttggact gggaataccc agtcagtggg ggtctccctg gcaactcaac aagaccagaa 540
gacaaacgta attacacgtt attgcttcag gatgtgcggg agaaattgga cgccgctgaa 600
gcaaaagatg gtaaaaagta cctcctcacg atcgcgagtg gggctagccc ggaatatgta 660
agcaatacag aattggataa gatcgctgaa acggtcgact ggattaatat tatgacatat 720
gacttcaacg ggggatggca gtcaattagc gcgcataacg ctccactgtt ctatgacccg 780
aaggcaaaag aggcaggggt gccgaacgca gaaacgttta atattgagag cacggtgaag 840
cgctacaagg aagctggcgt gaaggcggat aagctggtac tcggaacccc tttttacggt 900
agaggttgga gtaattgcga acatgctgat aacggtgagt atcagaagtg tggtccagta 960
aaagagggta cctgggaaaa aggagtgttc gatttttctg atttggagaa gaactatatc 1020
aacaaaaatg gctataagcg ctactggaac gatcgggcaa aggttccgtt cttatataac 1080
gctgagaacg ggaactttat tacctatgac gatgaggaaa gctatggcta caagacggac 1140
ttgatccaat caaacggact gtccggggcg atgttttggg atttctcagg agatagcaac 1200
cagaccttac ttaacaaatt agccgctgat ttgggatttg ctccgggcgg tggtaatcct 1260
gaaccgccag caagtgcacc tgggaatctc cgtgtcacag agaagacagc cacttctatc 1320
agtcttgttt gggacgctcc aagtgatggg gctaacatag ccgagtacgt attatcttac 1380
gagggtggag ctgtgagcgt taaggacaca tcagctacaa taggtcagct gaaacctaat 1440
acaacgtact cttttactgt ctcagccaaa gatgctgatg ggaagctgca cacggggccg 1500
acgatcgaag ccaccactaa ctcagatcag acctgtggct ataatgaatg gaaggatact 1560
gcagtttaca ccgggggtga tagagttgtc tttaacggaa aagtgtacga agccaagtgg 1620
tggacaaagg gagaacagcc tgaccaggct ggcgagtcag gcgtttggaa gttaataggc 1680
gactgcaagc accaccacca ccaccactaa 1710
<210>17
<211>22
<212>DNA
<213> Artificial Synthesis
<400>17
tgatgaaagc ttggcgtaat ca 22
<210>18
<211>24
<212>DNA
<213> Artificial Synthesis
<400>18
agctgaggca tgtgttacaa aaac 24
<210>19
<211>30
<212>DNA
<213> Artificial Synthesis
<400>19
gcatttgccg acattgactg ggagggacgc 30
<210>20
<211>32
<212>DNA
<213> Artificial Synthesis
<400>20
gtcaatgtcg gcaaatgcat agtttatatg ag 32
<210>21
<211>30
<212>DNA
<213> Artificial Synthesis
<400>21
ccgaacgcag aaacgtggaa tattgagagc 30
<210>22
<211>30
<212>DNA
<213> Artificial Synthesis
<400>22
ccacgtttct gcgttcggca cccctgcctc 30
<210>23
<211>31
<212>DNA
<213> Artificial Synthesis
<400>23
cgatttttct gatttgagaa agaactatat c 31
<210>24
<211>30
<212>DNA
<213> Artificial Synthesis
<400>24
tctcaaatca gaaaaatcga acactccttt 30
<210>25
<211>30
<212>DNA
<213> Artificial Synthesis
<400>25
gatcctacag ggccacaccc acagaaatgg 30
<210>26
<211>30
<212>DNA
<213> Artificial Synthesis
<400>26
gtgtggccct gtaggatcag gattcccatg 30
<210>27
<211>30
<212>DNA
<213> Artificial Synthesis
<400>27
tggagtaatt gcgaacatgc tgataacggt 30
<210>28
<211>30
<212>DNA
<213> Artificial Synthesis
<400>28
tggagtaatt gcgaacatgc tgataacggt 30
<210>29
<211>49
<212>DNA
<213> Artificial Synthesis
<400>29
ttgtaacaca tgcctcagct agttccgaca agtcttataa gataatagg 49
<210>30
<211>41
<212>DNA
<213> Artificial Synthesis
<400>30
attacgccaa gctttcatca ttagtggtgg tggtggtggt g 41

Claims (10)

1. A chitinase mutant is characterized in that the amino acid sequence of the mutant is shown in any one of SEQ ID NO. 2-6.
2. A gene encoding the mutant chitinase of claim 1.
3. A vector comprising the gene of claim 2.
4. A cell expressing the mutant chitinase of claim 1.
5. A genetically engineered bacterium which expresses the chitinase mutant of claim 1 by using Bacillus subtilis as a host.
6. The genetically engineered bacterium of claim 5, wherein Bacillus subtilis WB600 is used as a host and pP43NMK is used as an expression vector.
7. A method for improving the enzymatic activity of chitinase is characterized in that cysteine at the 43 th site of the chitinase with an amino acid sequence shown as SEQ ID NO.1 is mutated into aspartic acid;
or, the phenylalanine at position 273 is mutated to tryptophan;
or, mutating the 336 th glutamic acid into arginine;
or, cysteine at position 43 is mutated to aspartic acid and phenylalanine at position 273 is mutated to tryptophan;
or, cysteine at position 43 is mutated to aspartic acid, phenylalanine at position 273 is mutated to tryptophan, and glutamic acid at position 336 is mutated to arginine.
8. The use of the genetically engineered bacteria of claim 5 or 6 in the field of fermentation.
9. A method for producing the chitinase mutant of claim 1, characterized in that, the genetic engineering bacteria of claim 5 or 6 are inoculated into LB liquid culture medium, cultured for 7-10h at 35-40 ℃, and then transferred into TB culture medium, the inoculum size is 2-5%, and cultured for 12-14h at 35-40 ℃.
10. The use of the mutant chitinase of claim 1 in the preparation of products containing chitooligosaccharide in the fields of agriculture, biology, cosmetics, food or hygiene.
CN201811484682.2A 2018-12-06 2018-12-06 Chitinase mutant with improved enzyme activity Active CN109486794B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811484682.2A CN109486794B (en) 2018-12-06 2018-12-06 Chitinase mutant with improved enzyme activity

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811484682.2A CN109486794B (en) 2018-12-06 2018-12-06 Chitinase mutant with improved enzyme activity

Publications (2)

Publication Number Publication Date
CN109486794A CN109486794A (en) 2019-03-19
CN109486794B true CN109486794B (en) 2020-06-09

Family

ID=65709378

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811484682.2A Active CN109486794B (en) 2018-12-06 2018-12-06 Chitinase mutant with improved enzyme activity

Country Status (1)

Country Link
CN (1) CN109486794B (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112831510B (en) * 2019-12-13 2022-04-22 中国科学院天津工业生物技术研究所 Construction of recombinant bacterium for efficiently expressing chitinase and screening of high-enzyme-activity mutant
CN113073091B (en) * 2020-01-03 2023-07-04 高雄科技大学 Recombinant chitosan hydrolase and method for preparing chitosan oligosaccharide by using same
CN111286498B (en) * 2020-03-26 2024-03-29 汪利平 Efficient chitinase for producing acetamido glucose
CN113249360B (en) * 2021-07-06 2021-10-01 深圳润康生态环境股份有限公司 Chitinase mutant ChiM and application
CN114369589A (en) * 2021-12-03 2022-04-19 中国科学院天津工业生物技术研究所 Preparation and application of chitinase mutant
CN114807094B (en) * 2022-05-05 2023-11-28 中国海洋大学 Chitosan SvChiAJ54 and encoding gene and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101144066A (en) * 2007-08-21 2008-03-19 山东省科学院中日友好生物技术研究中心 Burkholderia multifunctional engineering strain and construction method thereof
CN104232607A (en) * 2014-09-01 2014-12-24 湖北大学 Preparation and application of mutant enzymes of bacillus thuringiensis chitinase
CN106399335A (en) * 2016-10-19 2017-02-15 大连理工大学 Preparation method and application of efficient chitinase mutant
CN107418941A (en) * 2016-05-24 2017-12-01 中国科学院大连化学物理研究所 A kind of recombined Aspergillus flavus chitosan enzyme and encoding gene and preparation and application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003217746A1 (en) * 2002-02-28 2003-09-16 New England Biolabs, Inc. Modified chitin binding domain and uses thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101144066A (en) * 2007-08-21 2008-03-19 山东省科学院中日友好生物技术研究中心 Burkholderia multifunctional engineering strain and construction method thereof
CN104232607A (en) * 2014-09-01 2014-12-24 湖北大学 Preparation and application of mutant enzymes of bacillus thuringiensis chitinase
CN107418941A (en) * 2016-05-24 2017-12-01 中国科学院大连化学物理研究所 A kind of recombined Aspergillus flavus chitosan enzyme and encoding gene and preparation and application
CN106399335A (en) * 2016-10-19 2017-02-15 大连理工大学 Preparation method and application of efficient chitinase mutant

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
chitinase [Bacillus sp. DAU101];GenBank登录号: ABC66095.1;《GenBank数据库》;20061029;参见序列及相关信息 *
Cloning, puriWcation, and characterization of chitinase from Bacillus sp. DAU101;Lee YS等;《Bioresource Technology》;20061114;参见全文 *

Also Published As

Publication number Publication date
CN109486794A (en) 2019-03-19

Similar Documents

Publication Publication Date Title
CN109486794B (en) Chitinase mutant with improved enzyme activity
CN110438136B (en) Beta-glucosidase and mutant gene, amino acid sequence and application thereof
CN108795916B (en) Lysine decarboxylase mutant, coding gene thereof, expression and application thereof
CN108467860B (en) Method for high yield of gamma-aminobutyric acid
CN108070581B (en) L-aspartate beta-decarboxylase mutant with improved enzyme activity and application thereof
CN108330119A (en) A kind of chitosan enzyme and its application in chitosan oligosaccharide preparation
CN104789539B (en) A kind of mutant of trehalose synthase and its preparation method and application
CN112725319B (en) Alginate lyase FaAly7 with polyG substrate specificity and application thereof
CN113151198B (en) Gamma-glutamine synthetase mutant, coding gene, amino acid sequence and application thereof
CN110846296A (en) Cloning expression and application of bacillus subtilis β -mannase
CN113621600B (en) High-activity nitrile hydratase mutant and application thereof
CN109777793B (en) GDSL lipase, genetically engineered bacterium and application thereof
CN112301012B (en) Cyclodextrin glucosyltransferase mutant and construction method thereof
CN111876399B (en) Arctic-pole-derived beta-glucosidase gene, and encoded protein and application thereof
CN107603994B (en) Kappa-carrageenase and gene and application thereof
CN111893125A (en) Chitosan enzyme gene, chitosanase, preparation method and application thereof
CN109576239A (en) Heat-resisting phosphorylase and its application
CN111187764B (en) Deep-sea-derived chitosanase CSN5, and coding gene and application thereof
CN106434715B (en) Malt oligosaccharide based mycose synthetase and its expressing gene and application
CN111424048A (en) Gene for expressing acidic β -mannase, vector and application thereof
CN104877983B (en) A kind of trehalose synthase mutant and its preparation and application
CN113481186B (en) GH18 chitinase ChiA and application thereof
CN111534498B (en) Cyclodextrin glucosyltransferase mutant with improved disproportionation specific activity and AA-2G yield
CN113817697A (en) Phenylalanine dehydrogenase mutant and application thereof in synthesis of L-homophenylalanine
CN109762801B (en) Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant