CN111286498B

CN111286498B - Efficient chitinase for producing acetamido glucose

Info

Publication number: CN111286498B
Application number: CN202010224411.4A
Authority: CN
Inventors: 汪利平
Original assignee: Individual
Current assignee: Individual
Priority date: 2020-03-26
Filing date: 2020-03-26
Publication date: 2024-03-29
Anticipated expiration: 2040-03-26
Also published as: CN111286498A

Abstract

The invention relates to a high-efficiency chitinase for producing acetylglucosamine, wherein the amino acid sequence (Chitinolytic bacter meiyuanensis, genBank: ATN 39892.1) of the enzyme is mutated at 266 th, 270 th and 342 nd positions and is respectively mutated into S, I, M from the original T, Y, K, and the invention has the beneficial effect that the enzyme activity of the improved chitinase for producing acetylglucosamine is improved by 10.07-34.90% compared with that of the wild-type enzyme.

Description

Efficient chitinase for producing acetamido glucose

Technical Field

The invention belongs to the fields of genetic engineering and enzyme engineering, and in particular relates to preparation of efficient chitinase for producing acetylglucosamine.

Background

Chitin (chitin), also known as chitin, is a linear polymer biopolymer formed by connecting N-acetyl-D-glucosamine with beta-1, 4-glycosidic bonds, and is the second largest natural polymer with a content inferior to cellulose. Chitin is an important component of the wall structure of pathogenic organisms such as crustaceans, insects, fungi and nematodes, and has supporting and protecting effects on organisms. Chitinase EC3.2.1.14 is first isolated and discovered in the process of researching bacillus chitinae to decompose chitin in 1905, and can thoroughly hydrolyze chitin into N-acetylglucosamine oligomer or N-acetylglucosamine (GlcNAc), and Chitinase is widely distributed in fungi, bacteria, actinomycetes and the like, and also exists in a large number of insects, crustaceans, higher plants and even viruses. Chitinase is a key for degrading or utilizing chitin in organisms, and can play a role in biological control by hydrolyzing cell walls of pathogenic fungi, destroying body walls of pests, killing insects, enhancing efficiency and other mechanisms, and on the other hand, the chitinase can promote natural circulation and maintain ecological system balance by catalyzing chitin hydrolysis. Chitinase catalyzes chitin to hydrolyze into N-acetylglucosamine oligomer or GlcNAc, and the N-acetylglucosamine oligomer or GlcNAc has the functions of resisting bacteria, regulating body's immunity, inhibiting tumor cell growth, and has great market potential.

After the first discovery and isolation of microbial chitinase from bacillus chitinans (Bacillus chitinovrous) in 1905, scholars of each country have subsequently discovered that approximately 70 species of microorganisms of 46 genera, such as bacteria, actinomycetes, fungi, and even viruses, can secrete chitinase. In addition, marine microorganisms such as coral, psychrophilia, streptomyces marinus (Streptomyces olivaceus), streptomyces albus (Streptomyces albosporeus) and Bacillus alvei (Bacillus pluton) all show extremely strong chitinase secretion, while Bacillus thuringiensis (Bacillus thuringiensis), bacillus circulans (Bacillus circulans) and Bacillus subtilis (Bacillus subtilis) have been studied to increase the activity of N-acetyl-beta-d-glucosamine by using a relatively large amount of chitinase-derived microorganisms, such as Bacillus thuringiensis (Aeromonas hydrophila H-2330) and the like, and the yield of GlcNAc produced from chitin was 77%, and Alei Zhang cloned from Chitinolyticbacter meiyuanensis SYBC-H1 to obtain a novel chitinase having an external, internal and N-acetyl-beta-d-glucosamine activity of 15.3U/mg for colloidal chitinase.

Disclosure of Invention

In order to solve the above problems, an object of the present invention is to provide chitinase having a higher activity.

The preparation process of the invention is as follows:

1. obtaining chitinase sequences (Chitinolyticbacter meiyuanensis, genBank: ATN 39892.1) from NCBI, synthesizing by a biological company, adopting HindIII to enzyme-cut pET20b (+) plasmid, designing a PCR primer F: GCTCGAATTCGGATCATGTCGCAAATCAATCGCT, adding 20 mu l Cloning Enhancer into a PCR system after the reaction of R: GAATTAATTCGGATCTTACTTGTTCATGTTGCCCAT, PCR is finished, incubating for 15min at 37 ℃, incubating for 15min at 80 ℃, tangentially dissolving the pET20b (+) plasmid with HindIII enzyme, carrying out agarose gel electrophoresis on the enzyme-cut product, recovering, dissolving In sterilized double distilled water, uniformly mixing the incubated PCR product with a purified linear vector, adding In-Fusion enzyme, reacting for 15min at 50 ℃, transforming E.coli JM109, picking up positive clones, sequencing by the biological company, and carrying out transformation host E.coli BL21 for expression by the plasmid with the right identification, thus obtaining genetically engineered bacteria containing wild sequence plasmids;

2. extraction of plasmid DNA

E.coli BL21 gene engineering bacteria carrying plasmid pET20b (+)/CmChi 1 are inoculated into LB/Amp (Amp final concentration 100 mug/ml) liquid culture medium, and after overnight culture at 37 ℃ and 200r/min, plasmid is extracted by using a plasmid small-amount extraction kit, and specific operations are carried out according to the specification;

3. error-prone PCR amplification and construction of mutation libraries

Taking the plasmid obtained in the second step as a template, linearizing the plasmid by using NcoI digestion, and designing a primer CmChi1-F: ATTCCGATATCCATGATGTCGCAAATCAATCGCT and CmChi-R: CCGGCGATGGCCATGTTACTTGTTCATGTTGCCCAT, error-prone PCR amplification of the gene was performed with an error-prone PCR amplification system (50. Mu.l) of 10X TaKaRa Taq Buffer, dNTPs mix, primers of 0.2. Mu. Mol/L each, 200ng of template DNA, 2.5U of Taq DNA polymerase, PCR reaction conditions: 95 ℃ 5min,94 ℃ 1min,55 ℃ 1min,72 ℃ 2min,35 cycles, 72 ℃ 10min, mn ²⁺ Concentration of 0.5mmol/l, mg ²⁺ Adding 20 mu l Cloning Enhancer to a PCR system with a concentration of 7.0mmol/l, incubating for 15min at 37 ℃ and 15min at 80 ℃, tangentially dissolving pET20b (+) plasmid with NcoI enzyme, recovering the enzyme-digested product after 0.75% agarose gel electrophoresis, dissolving In sterilized double distilled water, uniformly mixing the incubated PCR product with purified linear carrier, adding In-Fusion enzyme, reacting for 15min at 50 ℃ to convert E.coliBL 21, and coating on a solid LB plate (100 mug/ml Amp) resistance screening positive transformants, all of which constitute a mutant library;

4. high throughput screening of mutant libraries

Selecting single clone colonies from an LB plate, inoculating the single clone colonies into 96 holes containing 300 mu l of LB culture medium (50 mu g/ml Amp is contained), wherein each hole corresponds to a specific transformant, simultaneously inoculating wild type clones into each 96 hole plate, carrying out shake culture for 12 hours at 37 ℃ and 200r/min as positive control, taking 20 mu l of bacterial liquid from the 96 hole plate under the aseptic condition, temporarily refrigerating seeds at 4 ℃ in the 96 deep hole plate, carrying out shake culture for 48 hours at 25 ℃ and 200r/min, taking 10 mu l of bacterial liquid according to the principle of one-to-one correspondence of each hole, correspondingly coating the bacterial liquid on a selective solid culture medium with chitin as a unique carbon source, carrying out shake culture for 5 days at 35 ℃, and picking out rescreening on clones larger than transparent rings of a control group;

5. the positive clones passing through the re-screening are sent to a biological company for sequencing;

6. producing mutants, and fermenting and culturing E.coli BL21 containing mutant plasmids in the step five;

7. purifying the mutant, namely purifying the mutant by adopting a molecular sieve method;

8.SDS-PAGE electrophoresis is carried out on the mutants;

9. protein concentration was determined using Bradford.

The beneficial effects of the invention are as follows:

higher activity of N-acetyl-beta-d-glucosaminase is obtained.

Drawings

FIG. 1 SDS-PAGE electrophoresis

FIG. 2 three-dimensional map of wild-type chitinase and mutation sites

Detailed Description

The present invention will be described in further detail by the following examples, which are only for the purpose of illustrating the present invention and are not to be construed as limiting the scope of the present invention.

Example 1

The materials and reagents involved in this example are shown in Table 1, and the laboratory apparatus is shown in Table 2;

table 1 experimental materials and reagents

Table 2 laboratory apparatus

AB104-N electronic analytical balance	Metrele-tolidol Shanghai Co., ltd
		PTC-200 type PCR instrument	MJ Research Co., ltd
DYY-6D type nucleic acid electrophoresis apparatus	BEIJING LIUYI INSTRUMENT FACTORY
		Mini Protein 3 Protein electrophoresis system	Bio-Rad Co Ltd
Geldoc gel imaging system	Bio-Rad Co Ltd
		UV2450 ultraviolet visible spectrophotometer	Shimadzu Corp Japan
Sigma 3K-15 high-speed refrigerated centrifuge	Sigma Germany Co
		TAZ-C type constant temperature shaking table	Experimental facility factory in Taicang city in Jiangsu province
Electrothermal incubator	Tianjin Tianyu mechanical and electrical Co., ltd
		Protein nucleic acid quantitative determination instrument	Eppendorf, germany

LB medium formula of 10g/l tryptone, 5g/l yeast powder, 10g/l NaCl, pH7.0;

solid LB medium: adding 2g agar powder into 100ml liquid LB culture medium, and autoclaving;

solid medium with chitin as sole carbon source: colloid chitin 2.5g/l, K ₂ HPO ₄ 0.7g/l，KH ₂ PO ₄ 0.3g/l，MgSO ₄ ·7H ₂ O 0.5g/l，FeSO ₄ ·7H ₂ 0.01g/l of O, 15g/l of agar, pH7.0 and sterilization at 121 ℃ for 20min;

2. extraction of plasmid DNA

3. error-prone PCR amplification and construction of mutation libraries

Taking the plasmid obtained in the second step as a template, linearizing the plasmid by using NcoI digestion, and designing a primer CmChi1-F: ATTCCGATATCCATGATGTCGCAAATCAATCGCT and CmChi-R: CCGGCGATGGCCATGTTACTTGTTCATGTTGCCCAT, error-prone PCR amplification of the gene was performed with an error-prone PCR amplification system (50. Mu.l) of 10X TaKaRa Taq Buffer, dNTPs mix, primers of 0.2. Mu. Mol/L each, 200ng of template DNA, 2.5U of Taq DNA polymerase, PCR reaction conditions: 95 ℃ 5min,94 ℃ 1min,55 ℃ 1min,72 ℃ 2min,35 cycles, 72 ℃ 10min, mn ²⁺ Concentration of 0.5mmol/l, mg ²⁺ Adding 20 mu l Cloning Enhancer to a PCR system with the concentration of 7.0mmol/l, incubating for 15min at 37 ℃, incubating for 15min at 80 ℃, tangentially dissolving pET20b (+) plasmid with NcoI enzyme, recovering the enzyme-digested product after 0.75% agarose gel electrophoresis, dissolving In sterilized double distilled water, uniformly mixing the incubated PCR product with a purified linear carrier, adding In-Fusion enzyme, reacting for 15min at 50 ℃, converting E.coli BL21, coating on a solid LB plate (100 mu g/ml Amp), screening positive transformants with resistance, and forming a mutant library by all transformants;

4. high throughput screening of mutant libraries

Selecting single clone colonies from an LB plate, inoculating the single clone colonies into 96 holes containing 300 mu l of LB culture medium (50 mu g/ml Amp is contained), wherein each hole corresponds to a specific transformant, simultaneously inoculating wild type clones into each 96 hole plate, carrying out shake culture for 12 hours at 37 ℃ and 200r/min as positive control, taking out 20 mu l of bacterial liquid from the 96 hole plate under the aseptic condition, temporarily refrigerating seeds at 4 ℃ in the 96 deep hole plate, carrying out shake culture for 48 hours at 25 ℃ and 200r/min, taking 10 mu l of bacterial liquid according to the principle of one-to-one correspondence of each hole, correspondingly coating the bacterial liquid on a selective solid culture medium with chitin as a unique carbon source, carrying out shake culture for 5 days at 35 ℃, and picking out rescreening on clones larger than transparent rings of a control group;

5. the positive clones passing through the re-screening are sent to a biological company for sequencing, and the sequencing result is shown in Table 3;

6. production of mutants

Seed culture: e.coli BL21 containing the mutant plasmid is inoculated into a 250ml triangular flask filled with 25ml LB culture medium, and cultured for 8 hours in a shaking table at 37 ℃ and 200 r/min;

fermentation culture: inoculating the cultured seed culture solution into 500ml triangular flask containing 100ml TB culture medium according to inoculation amount of 4% (V/V), culturing in shaking table at 37deg.C and 200r/min, and culturing when thallus reaches OD ₆₀₀ When the concentration is 0.6, adding IPTG to 0.01mmol/l, rapidly transferring to a 25 ℃ shaking table, and continuously inducing for 90 hours;

100 mug/ml ampicillin was added to each medium before use;

7. purification of mutants

1) Sample preparation

Centrifuging the fermented and cultured bacterial liquid at 4 ℃ and 8000r/min for 20min, collecting supernatant, filtering and sterilizing at 4 ℃;

2) Salting out

Slowly adding the ground ammonium sulfate into the crude enzyme solution to 80% saturation, stirring by a magnetic stirrer, and standing at 4 ℃ overnight; centrifuging at 10000rpm at 4deg.C for 15min, discarding supernatant, and dissolving precipitate with 50mM Tris-HCl buffer solution (pH 7.5);

3) DEAE-Sephadex anion exchange column chromatography

Sephadex column pretreatment

The DEAE-Sephadex anion exchange column (phi 1.6cm×20cm) is equilibrated with Tris-HCl buffer solution with pH 8.0 and 0.05mol/l for overnight, enzyme protein obtained by ammonium sulfate precipitation is dissolved back in Tris-HCl buffer solution with pH 8.0 and 0.05mol/l, the loading amount is 1ml each time, the enzyme protein is eluted with Tris-HCl buffer solution with pH 8.0 and 0.05mol/l until no protein is separated out, then the enzyme protein is eluted with NaCl solution with 0-1mol/l in linear gradient, the flow rate is 0.5ml/min, 3ml is collected per tube, absorbance value of collected liquid is detected at 280nm by an ultraviolet spectrophotometer, absorption peaks are combined, enzyme activity and specific activity are measured after PEG20000 concentration, and active components are collected and purified further;

b. column

After the Sephadex G-100 gel is swelled, the gel is loaded on a column (phi 2.6cm multiplied by 80 cm), the gel is balanced by PBS buffer solution with pH of 5.3 and 0.05mol/l in advance for overnight, 1ml of sample is loaded, the sample is eluted by the same buffer solution, the eluting flow rate is 0.3ml/min, 3ml is collected for each tube, and OD of each tube is detected _280nm Combining absorption peaks, concentrating PEG20000, measuring enzyme activity and specific activity, collecting active fraction, and storing at-20deg.C;

c. dialysis

Adding 10g/l anhydrous sodium carbonate and 500ml of 1mmol/l EDTA solution into a beaker, putting a dialysis bag cut according to the requirement into the beaker, boiling for 30min to remove metal ions on the dialysis bag, preserving at 4 ℃ for standby, filling a proper amount of protein extract into the dialysis bag, clamping both ends of the protein extract by using a dialysis clamp, dialyzing for 24h at 4 ℃ in PBS buffer solution with pH of 5.3 and 0.05mol/l, and replacing the dialysate every 2-4 h;

d. concentrating the precipitated protein solution

Uniformly smearing PEG20000 powder outside a dialysis bag, placing in a refrigerator during concentration, and timely replacing the dried PEG20000 powder until the sample is concentrated to a required volume;

SDS-PAGE electrophoresis

Preparation of SDS-PAGE electrophoresis gel referring to the kit instructions, staining was performed with 0.1% Coomassie Brilliant blue R-250 using a concentration of 10% separation gel and 5% concentration of concentration gel, see FIG. 1;

9. protein concentration determination

Specific methods of operation were performed according to the Bradford method protein quantification kit instructions.

The wild type and mutant Chitinases enzymes have no obvious difference in extracellular production level, the recovery rate of the purified enzyme is about 10-14%, the purity and molecular weight of the purified mutant enzyme are estimated by SDS-PAGE analysis, the molecular weight of the mutant enzyme is about 70KD as compared with the wild type, and the three-dimensional diagrams of the wild type chitinase and the mutation site are shown in figure 2.

TABLE 3 sequencing results of mutants

Mutant numbering	Original nucleic acid sequence	Post-mutation nucleic acid sequences	Original amino acid sequence	Post-mutation amino acid sequence
					Mutant 266	ACC	AGC	T	S
Mutant 270	TAC	ATC	Y	I
					Mutant 342	AAG	ATG	K	M

Experiment one: method for measuring enzyme activity

Taking 0.5ml of diluted enzyme solution, adding 1ml of 0.1M acetic acid-sodium acetate buffer solution (pH 6.5), preserving heat for 30min at 37 ℃, taking out, adding 0.5ml of DNS reagent, after boiling water bath for 10min, rapidly cooling to room temperature by ice water, centrifuging at 6000rpm for 8min, colorizing at 530nm, repeating for three times, taking an average value as a test result, finally calculating the content of reducing sugar by the average value of OD530, calculating enzyme activity, wherein the experimental result is shown in Table 4, and the enzyme activity is defined as the enzyme activity unit (U) required for releasing 1mmol of GlcNAc per minute under the above conditions.

TABLE 4 enzyme activity measurement results

Name of the name	Enzyme activity (U/ml)	Increasing the ratio
			Wild type	14.9±0.05	-
Mutant 266	20.1±0.06	34.90％
			Mutant 270	17.8±0.04	19.46％
Mutant 342	16.4±0.05	10.07％

Claims

1. A highly efficient chitinase for producing acetylglucosamine, characterized in that the amino acid sequence of said enzyme is based on the sequence of ATN39892.1 with a mutation of T at position 266 to S or Y at position 270 to I or K at position 342 to M in genbankid.