CN111662831A

CN111662831A - Aspergillus niger Rha-N1 and application thereof

Info

Publication number: CN111662831A
Application number: CN202010533944.0A
Authority: CN
Inventors: 郑建永; 李露园; 汪钊; 章银军; 袁围; 肖延铭
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2020-06-12
Filing date: 2020-06-12
Publication date: 2020-09-15

Abstract

The invention discloses an Aspergillus niger Rha-N1 and application thereof, the invention obtains recombinant plasmid by connecting alpha-L-rhamnosidase gene to pCAMBIA vector, introduces Agrobacterium into the recombinant plasmid, performs fermentation expression after Agrobacterium-mediated transformation of Aspergillus niger, and obtains recombinase enzyme activity of 0.471U/mL. Then, normal-temperature plasma mutagenesis is utilized to obtain a mutant strain with the enzyme activity of the fermentation liquid of 0.652U/mL. The recombinant Aspergillus niger can be applied to the hydrolysis of rutin, hesperidin and naringin, and finally the substrate is completely converted to obtain isoquercitrin, hesperetin monoglucoside and prunin with the purity of more than 98%.

Description

Aspergillus niger Rha-N1 and application thereof

(I) technical field

The invention relates to a recombinant aspergillus niger expressing alpha-L-rhamnosidase and application thereof, belonging to the technical field of genetic engineering and biological medicine.

(II) background of the invention

alpha-L-rhamnosidase (alpha-L-rhamnosidase, E.C.3.2.1.40) is mostly a glucopyranose carbohydrate family 78(GH78), and can specifically hydrolyze substances containing alpha-L-rhamnose at the terminal, such as naringin, hesperidin and rutin of flavonoids; saponins such as saikosaponin and ginsenoside. alpha-L-rhamnosidase is a glycoside hydrolase with wide sources and is commonly present in animal and plant tissues, bacteria and fungi. The alpha-L-rhamnosidase from the microorganism is the most extensive, wherein the alpha-L-rhamnosidase from the bacteria can be used for hydrolyzing flavonoid glycoside compounds widely existing in nature, and common bacteria such as Lactobacillus and Bacillus; alpha-L-rhamnosidase enzymes of fungi were first found in enzyme preparations of Penicillium decumbens and Aspergillus (e.g.Aspergillus niger, Aspergillus terreus, Aspergillus aculeatus, Emericella nidulans). alpha-L-rhamnosidase is also found in yeast fungi such as Saccharomyces cerevisiae, Debaryomyces ploymorphus, Pichia angusta, and the like.

The application of alpha-L-rhamnosidase in the food industry is mainly to improve the mouthfeel and aroma of beverages and as a food additive. Research shows that the alpha-L-rhamnosidase can hydrolyze two bitter substances, namely naringin and limonin, so that the citrus juice has pleasant taste. In the medical industry, the bioavailability of many flavonoids is affected by glycosidic bonds, and the flavonoids have the effects of diminishing inflammation, resisting viruses, resisting oxidation and the like. The flavone glucoside isoquercitrin, pranin and hesperetin monoglucoside are products of alpha-L-rhamnoside enzyme catalytic hydrolysis of natural flavone glucoside rutin, naringin and hesperidin respectively, and compared with the corresponding aglycon diglycoside, the biological activity is higher, the bioavailability is better and the cytotoxicity is lower.

The microorganism-derived alpha-L-rhamnosidase is an inducible enzyme, can be synthesized only in the presence of inducers such as rutin, hesperidin and naringin, and is regulated by metabolism of carbon sources such as rhamnose and glucose during induction to prevent the microorganism from fermenting to produce the enzyme. Wild aspergillus niger can secrete alpha-L-rhamnosidase, but the expression level is low, the aspergillus niger often exists in the form of complex enzyme, the aspergillus niger is difficult to separate from other enzyme components, and the requirement for producing flavone monoglycoside cannot be met. With the increasingly wide application of the alpha-L-rhamnosidase, the traditional fermentation production mode can not meet the requirement and can not achieve very high purity. Therefore, it is a necessary trend to study the enzyme using molecular biotechnology.

Disclosure of the invention

The invention aims to provide a new strain-Aspergillus niger Rha-N1 and application thereof, wherein the Aspergillus niger Rha-N1 constructed by genetic engineering can singly produce alpha-L-rhamnosidase and avoid the existence of complex enzyme, thereby realizing the enzymatic preparation of high-purity flavone monoglycoside products.

The technical scheme adopted by the invention is as follows:

the invention provides a new strain-Aspergillus niger Rha-N1, which is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020035, the preservation date of 2020, 1, 13 days, the preservation address: wuhan university, Wuhan, China, zip code 430072.

The Aspergillus niger Rha-N1 is obtained by transferring a nucleotide sequence shown by SEQ ID No.2 into Aspergillus niger and performing normal-temperature plasma mutagenesis, and specifically, the nucleotide sequence shown by SEQ ID No.2 is connected with a vector to obtain a recombinant plasmid; transforming the recombinant plasmid into agrobacterium; agrobacterium is co-cultured with Aspergillus niger, the gene shown in SEQ ID NO.2 is transferred into Aspergillus niger, and mutagenesis is performed.

The invention provides an application of Aspergillus niger Rha-N1 in hydrolyzing flavonoids compounds, which is to centrifuge fermentation liquor obtained by fermentation culture of Aspergillus niger Rha-N1 (preferably at 12000rpm for 10min), take supernatant fluid to mix with flavonoids compounds and acetic acid-sodium acetate buffer solution with pH4.0-5.5 (preferably pH4.5), and after complete reaction at 50-65 ℃ (preferably 60 ℃), separate and purify reaction liquid to obtain flavone mono-glycosides compounds; the flavonoid compounds comprise rutin, hesperidin or naringin, and are added in the form of flavonoid compound aqueous solution with the mass concentration of 2-20%. The volume ratio of the supernatant to the flavonoid aqueous solution is 1:1, and the volume ratio of the supernatant to the buffer solution is 1: 8. The corresponding product of the flavonoid compound is isoquercitrin if the flavonoid compound is rutin, the corresponding product of hesperidin is pranin, and the corresponding product of naringin is hesperetin monoglucoside.

The application of Aspergillus niger Rha-N1 in hydrolyzing rutin is to centrifugate fermentation liquor (preferably 12000rpm centrifugates for 10min) obtained by fermenting and culturing Aspergillus niger Rha-N1, take supernatant fluid to mix with rutin aqueous solution with the mass concentration of 2-20% and acetic acid-sodium acetate buffer solution with the pH value of 4.5, and after complete reaction at 60 ℃, the reaction liquid is separated and purified to obtain isoquercitrin; the volume ratio of the supernatant to the rutin aqueous solution is 1:1, and the volume ratio of the supernatant to the buffer solution is 1: 8.

The application of Aspergillus niger Rha-N1 in naringin hydrolysis is to centrifugate fermentation liquor obtained by fermentation culture of Aspergillus niger Rha-N1 (preferably to centrifugate at 12000rpm for 10min), take supernatant fluid to mix with naringin aqueous solution with the mass concentration of 2% -20% and acetic acid-sodium acetate buffer solution with the pH value of 4.5, and after complete reaction at 60 ℃, the reaction liquid is separated and purified to obtain the prunin. The volume ratio of the supernatant to the naringin aqueous solution is 1:1, and the volume ratio of the fermentation liquid to the buffer solution is 1: 8.

The application of Aspergillus niger Rha-N1 in hydrolysis of hesperidin is to perform centrifugation (preferably at 12000rpm for 10min) on fermentation broth obtained by performing fermentation culture on Aspergillus niger Rha-N1, mix supernatant with 2-20% hesperidin aqueous solution and acetic acid-sodium acetate buffer solution with pH4.5, and after complete reaction at 60 ℃, separate and purify reaction liquid to obtain hesperetin monoglucoside. The volume ratio of the supernatant to the hesperidin aqueous solution is 1:1, and the volume ratio of the fermentation liquid to the buffer solution is 1: 8.

The supernatant is prepared by the following method: inoculating Aspergillus niger Rha-N1 on PDA plate, activating at 30 deg.C for 4d, inoculating to fermentation culture medium, fermenting at 30 deg.C and 150rpm for 4d, centrifuging at 12000rpm for 10min,collecting the supernatant; the fermentation culture medium comprises the following components in percentage by weight: 1% of bran, 4% of bean cake powder and 0.1% of anhydrous CaCl₂，0.1％NH₄H₂PO₄，0.5％MgSO₄·7H₂O, water as solvent and natural pH.

Compared with the prior art, the invention has the following beneficial effects: the invention obtains recombinant plasmid by connecting alpha-L-rhamnosidase gene to pCAMBIA vector, introduces agrobacterium, performs fermentation expression after agrobacterium-mediated transformation of Aspergillus niger, and obtains recombinase with enzyme activity of 0.471U/mL. Then, normal-temperature plasma mutagenesis is utilized to obtain a mutant strain with the enzyme activity of the fermentation liquid of 0.652U/mL. The recombinant Aspergillus niger can be applied to the hydrolysis of rutin, hesperidin and naringin, and finally the substrate is completely converted to obtain isoquercitrin, hesperetin monoglucoside and prunin with the purity of more than 98%. Compared with chemical synthesis and other methods, the enzymatic method for preparing the product has the advantages of mild reaction conditions, simple operation steps, higher product purity and contribution to environmental protection.

(IV) description of the drawings

FIG. 1: recombinant plasmid map.

FIG. 2: an electrophoresis picture of the alpha-L-rhamnosidase gene PCR amplification.

FIG. 3: SDS-PAGE electrophoresis of A.niger transformant proteins.

FIG. 4: the alpha-L-rhamnosidase catalyzes and hydrolyzes rutin.

FIG. 5: isoquercitrin standard curve.

FIG. 6: the recombinant Aspergillus niger expresses an alpha-L-rhamnosidase hydrolysis rutin HPLC map.

FIG. 7: alpha-L-rhamnosidase catalyzes the hydrolysis of naringin.

FIG. 8: pranine standard curve.

FIG. 9: the recombinant Aspergillus niger expresses an alpha-L-rhamnosidase hydrolysis naringin HPLC map.

FIG. 10: alpha-L-rhamnosidase catalyzes the hydrolysis of hesperidin.

FIG. 11: standard curve of hesperetin monoglucoside.

FIG. 12: the recombinant Aspergillus niger expresses an alpha-L-rhamnosidase hydrolysis hesperidin HPLC map.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the culture medium used in the examples of the present invention:

the LB liquid culture medium comprises the following components in percentage by mass: 0.5% yeast powder, 1.0% peptone, 1% NaCl, 2mol/L NaOH to adjust pH to 7.0, and deionized water as solvent. On the basis, agar powder with the mass concentration of 2% is added to prepare an LB solid culture medium.

IM liquid medium formula: 10mL of 200g/L aqueous glucose solution, 1.25mol/L of pH 4.8 potassium phosphate buffer (with KH)₂PO₄And K₂HPO₄Prepared) 0.8mL of MN buffer (30g/L MgSO₄·7H₂O，15g/L NaCl)20mL、0.01g/LCaCl₂·2H₂O aqueous solution 1mL, 0.1mg/L FeSO₄Aqueous solution 10mL, 2g/L NH₄NO₃2.5mL of aqueous solution, 10mL of glycerol aqueous solution with volume concentration of 50%, 1mol/L of pH 5.5 (pH adjusted by NaOH) MES 40mL, 5mL of microelement stock solution, and adding water to 1L; the microelement stock solution comprises the following components: 100mg/L ZnSO₄·7H₂O，100mg/L CuSO₄·H₂O，100mg/L H₃BO₃，100mg/L Na₂MoO₄·7H₂O。

The IM solid culture medium is prepared by changing 200g/L glucose aqueous solution in an IM liquid culture medium to 5mL, and adding agar powder with the mass concentration of 2%.

AIM liquid medium: 100 μ L of Acetosyringone (AS) was added to 100mL of IM broth at a concentration of 2mol/L (dissolved in DMSO).

AIM solid medium: add 100. mu.L Acetosyringone (AS) at a concentration of 2mol/L (DMSO dissolved) to 100mL IM solid medium.

Screening a culture medium: hygromycin B was added to the AIM medium at a final concentration of 200. mu.g/mL, cephalexin at a final concentration of 500. mu.g/mL, and kanamycin at a final concentration of 200. mu.g/mL.

The PDA solid culture medium comprises the following components in parts by mass: boiling 20% peeled potato for 20min, adding 2% glucose and 2% agar, and adding water as solvent.

The quality composition of the culture medium is as follows: 0.3% NaNO₃，0.1％K₂HPO₄，0.05％MgSO₄·7H₂O，0.05％KCl，0.001％FeSO₄3% of cane sugar and water as solvent, and the pH value is natural.

The fermentation culture medium comprises the following components in percentage by weight: 1% of bran, 4% of bean cake powder and 0.1% of anhydrous CaCl₂，0.1％NH₄H₂PO₄，0.5％MgSO₄·7H₂O, water as solvent and natural pH.

The room temperature of the invention is 25-30 ℃.

Example 1 Synthesis of alpha-L-rhamnosidase Gene and construction of recombinant plasmid

The alpha-L-rhamnosidase gene (GenBank: XP-001389086.1) derived from Aspergillus niger (Aspergillus niger) searched by NCBI was subjected to gene synthesis by Oncaceae, and the final gene sequence was shown as SEQ ID NO.2 and the encoded amino acid sequence was shown as SEQ ID NO. 1.

Designing a primer pair for amplifying an alpha-L-rhamnosidase gene sequence with a homologous arm,

N1-S：CCGCTTGAGCAGACATCACAATGTGGTCTTCCTGGCTGCTGTC

N1-N：GGCTTTCGCCACGGAGCTCTAGTGGTGGTGGTGGTGGTGATTAT

PCR amplification was performed using the synthetic sequence of SEQ ID NO.2 as a template and the Primer pair (N1-S and N1-N) by selecting high fidelity enzyme Primer Star MasterMix (Takara Co.) under conditions of pre-denaturation 98 ℃ for 3 min; the amplification stage is carried out for 30 cycles according to the conditions of 98 ℃, 10s, 55 ℃, 5s, 72 ℃ and 15 s; extension 72 ℃ for 10 min. The PCR product was digested and purified to obtain a purified fragment (target gene with homology arms) which was designated as fragment 1.

A primer pair for amplifying a vector is designed,

p-S：AGCTCCGTGGCGAAAGCCTG

p-N：TGTGATGTCTGCTCAAGCGGGG

PCR amplification was performed using a plasmid with pCAMBIA vector (purchased from institute of Biotechnology, Innovation and Biotechnology, Beijing) as a template and the Primer pair (p-S and p-N), and Primer Star MasterMix (Takara) high fidelity enzyme was selected under conditions of pre-denaturation 98 ℃ and 3 min; the amplification stage is carried out for 30 cycles according to the conditions of 98 ℃, 10s, 55 ℃, 5s, 72 ℃ and 90 s; extension 72 ℃ for 10 min. The PCR product was digested and purified to obtain a purified fragment (linearized vector pCAMBIA) which was designated as fragment 2.

Two purified fragments (fragment 1 and fragment 2) were recombined using a one-step cloning ligation kit (purchased from Nanjing Novozam Biotech Co., Ltd.), sent to the department of Otsuwas sequencing, aligned correctly and extracted as recombinant plasmid (see FIG. 1) for transformation of Agrobacterium AGL-1.

EXAMPLE 2 Agrobacterium transformation

Agrobacterium tumefaciens (Agrobacterium tumefaciens) competent cells AGL-1 were removed from a-80 ℃ freezer, thawed in an ice bath, 10. mu.l of the recombinant plasmid prepared in example 1 was added, ice-cooled for 5min, frozen in liquid nitrogen for 5min, heat-shocked at 37 ℃ for 5min, ice-cooled for 5min, 1mL of LB liquid medium was added, cultured at 28 ℃ for 2h, spread on LB solid plates containing 50. mu.g/mL kanamycin and 50. mu.g/mL rifampicin, and cultured at 28 ℃ for 2 d.

Well-grown single colonies on the pick plates were labeled and suspended in 10. mu.L ddH₂O preparing bacterial suspension, boiling water bath for 10min, cooling to room temperature, using it as template, identifying positive clone by colony PCR method, designing primer pair for verifying target gene,

YZ-S：CCCGCTTGAGCAGACATCAC

YZ-N：CCGTCATGATACGGGCTCAC

performing PCR amplification with the Primer pair by using the bacterial suspension as a template, and selecting high-fidelity enzyme Primer Star MasterMix (Takara corporation) under the conditions of pre-denaturation of 98 ℃ and 3 min; the amplification stage is carried out for 30 cycles according to the conditions of 98 ℃, 10s, 55 ℃, 5s, 72 ℃ and 15 s; extension 72 ℃ for 10 min. The PCR products were electrophoretically determined on a 1% agarose gel (FIG. 2), and the apparent molecular weights were in agreement with the theoretical values for the gene for alpha-L-rhamnosidase. The correct length of Agrobacterium was used for subsequent transformation of A.niger.

EXAMPLE 3 Agrobacterium mediated transformation of Aspergillus niger

(1) Aspergillus niger host strain (available from Yiyuan Congyuan Biotech Co., Ltd., product No. 3.350) was inoculatedPDA slant culture medium, 30 ℃ culture 5 d. The spores were washed off the slant with 10mL sterile water and filtered through two layers of sterile lens-wiping paper to obtain a spore suspension. Spore concentration was measured with a cell counting plate and diluted to 10⁷Per mL, a suspension of aspergillus niger spores was obtained for agrobacterium transformation.

(2) A single colony of Agrobacterium transformed with the recombinant plasmid was picked from the LB plate of example 2, inoculated into LB liquid medium containing 50. mu.g/mL kanamycin and 50. mu.g/mL rifampicin, and cultured at 28 ℃ for 24 hours with shaking at 200 rpm; the culture solution was centrifuged, and the cells were diluted to OD with AIM liquid medium₆₀₀The cultivation was continued at about 0.4, 28 ℃ and 200rpm for about 6h to OD₆₀₀And when the concentration is 0.6, obtaining agrobacterium liquid for later use.

(3) And (3) mixing the agrobacterium liquid obtained in the step (2) with the aspergillus niger spore suspension obtained in the step (1) according to the volume ratio of 1:1, and coating 200 mu L of mixed liquid on an AIM solid culture medium containing a glass film (with the thickness of 0.1-3mm, the specification: 1 x 1.2 m, Hai jin ear Biotech Co., Ltd.). After the co-culture at 23 ℃ for 48h, taking out the glass membrane, transferring the glass membrane to a screening culture medium, pouring a layer of screening culture medium on the glass membrane, and culturing at 30 ℃, wherein the Aspergillus niger growing under the condition is a transformant (see figure 2). And (3) selecting a transformant, inoculating the transformant to a fermentation medium, carrying out fermentation culture at 30 ℃ and 150rpm for 4 days, centrifuging at 12000rpm, taking a supernatant (namely a crude enzyme solution), and measuring the enzyme activity by using a pNPR method, wherein the highest transformant fermentation enzyme activity is 0.471U/mL.

The pNPR method is used for determining enzyme activity:

adding 480 μ L of phosphate-citric acid buffer solution with pH4.5 and 10 μ L p-NPR (10mM, dissolved in acetonitrile, and stored in refrigerator at 4 deg.C in dark place), preheating in water bath at 60 deg.C for 5min, adding 10 μ L of crude enzyme solution, reacting for 10min, adding 500 μ L of 1M NaCO₃The reaction was stopped (using the inactivated enzyme solution as a blank control) and the absorbance (OD) at 405nm was measured₄₀₅). Definition of enzyme activity: under the conditions of this assay, the amount of enzyme required to catalyze the production of 1. mu. mol of p-nitrophenol per minute was defined as 1U.

Example 4 Normal temperature plasma mutagenesis

The Aspergillus niger transformant with the highest enzyme activity in example 3 is inoculated in a PDA solid medium and cultured for 4 days at 30 DEG CWashing with sterile water, inoculating into observation type culture medium, culturing at 30 deg.C and 150rpm for 6-8 hr to make spore in just germinated state, measuring spore concentration with cell counting plate, and diluting with sterile water to obtain a concentration of 1 × 10⁷Spore suspension per mL. 5 mul of spore suspension is taken, 5 mul of glycerol aqueous solution with volume concentration of 10 percent is added to be evenly coated on a slide glass, a plasma mutagenic instrument ARTP-II (No-Sn source Qingtian Wood Biotech Co., Ltd.) is utilized, helium is adopted as working gas, the flow rate of the working gas is 8SLM, the processing distance is 2mm, the power output power is 120WE, and the processing time is 180 s. After irradiation, the slide glass is cleaned by a check type culture medium, the washing liquid is properly diluted by sterile water and coated on a screening culture medium plate, the screening culture medium plate is cultured for 4d in a constant temperature incubator at 30 ℃ to obtain 16 mutant bacteria, the mutant bacteria are respectively numbered 1-16, single colonies are selected and respectively inoculated to a fermentation culture medium, the fermentation culture is carried out for 4d at 30 ℃ and 150rpm, the enzyme activity is measured by adopting the method of the embodiment 3, and the results are compared with the enzyme activity before mutation, and are shown in the table 1.

TABLE 1 mutant strains enzyme Activity

After mutagenesis is carried out according to the method, the finally obtained mutant strain with the alpha-L-rhamnosidase yield obviously higher than that of the original strain is numbered 10, the enzyme activity reaches 0.652U/mL, and is improved by 38.4 percent compared with the original strain. Mutant genome is extracted, genome is used as a template, the PCR method is verified according to the example 2, the PCR product is subjected to electrophoresis determination by using 1% agarose gel, and the alpha-L-rhamnosidase gene is successfully introduced into Aspergillus niger. It is marked as Aspergillus niger Rha-N1 and is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020035, the address of Wuhan university, Wuhan, China.

Example 5 isolation and purification of A.niger Rha-N1 expressing alpha-L-rhamnosidase

Crude enzyme liquid of Aspergillus niger Rha-N1: inoculating Aspergillus niger Rha-N1 on a PDA plate, activating at 30 ℃ for 4d, inoculating on a fermentation culture medium, fermenting at 30 ℃ and 150rpm for 4d, centrifuging at 12000rpm, and taking supernatant to obtain crude Aspergillus niger Rha-N1 enzyme solution.

After the crude enzyme liquid of the Aspergillus niger Rha-N1 is concentrated and desalted by ultrafiltration (10KDa), the filtrate is subjected to gradient elution by a nickel ion affinity chromatography column, the impure protein is eluted by buffers containing imidazole (5mM, 50mM, 100mM, 150mM, 200mM, 250mM and 500mM) with different concentrations in sequence, the eluent corresponding to the buffer containing the imidazole (50 mM) is collected, the eluent is subjected to ultrafiltration concentration by an ultrafiltration tube (10KDa), and the trapped fluid is analyzed by SDS-PAGE. The results of protein purification are shown in FIG. 3. The size of the target protein is 72.3KDa, is consistent with the predicted theoretical value of the protein molecular weight, and simultaneously proves that Aspergillus niger Rha-N1 can singly and efficiently express the alpha-L-rhamnosidase.

Example 6 Aspergillus niger Rha-N1 hydrolysis of rutin (see FIG. 4 for a reaction scheme)

Wild type aspergillus niger WZ001 crude enzyme solution: inoculating wild type Aspergillus niger WZ001 (China center for type culture Collection, preservation number CCTCCNO.206047) to a PDA plate, activating at 30 ℃ for 4d, inoculating to a fermentation culture medium containing 0.1% of rutin (inducing the generation of alpha-L-rhamnosidase) by mass concentration, fermenting at 30 ℃ and 150rpm for 4d, centrifuging at 12000rpm, and taking supernatant to obtain crude enzyme liquid of wild type Aspergillus niger WZ 001.

Taking 1mL of crude Aspergillus niger Rha-N1 enzyme solution, adding 8mL of acetic acid-sodium acetate buffer solution with pH of 5.0, and putting 1mL of rutin aqueous solution with mass concentration of 2% -20% in a 10mL ep tube. The crude enzyme solution of Aspergillus niger Rha-N1 inactivated by boiling water is used as a control, and after the reaction is carried out for 5 hours at the temperature of 60 ℃, the crude enzyme solution is inactivated for 10 minutes in boiling water. Filtering with 0.22 μm water film, and analyzing rutin and isoquercitrin content in filtrate by HPLC. Under the same conditions, the crude Aspergillus niger Rha-N1 enzyme solution is replaced by the crude Aspergillus niger WZ001 enzyme solution, and the condition of catalyzing rutin is shown in Table 2. Because the natural alpha-L-rhamnosidase secreted by the wild type Aspergillus niger WZ001 exists in the form of complex enzyme, the isoquercetin is further hydrolyzed into the quercetin, and the yield of the isoquercetin is low.

TABLE 2 yield of isoquercitrin from rutin in different concentrations

Rutin and isoquercitrin HPLC assay (see FIGS. 5, 6):

the column was a SunfireC18 column (250X 4.6mm), mobile phase A was 80% acetonitrile in water (V/V) containing 0.02% phosphoric acid, and mobile phase B was 0.02% phosphoric acid (V/V). The detection method comprises the following steps: 30% of A, 1-3 min; 30-100% A for 4-8 min; 100-30% of A for 8-8.5 min; 30% of A, 8.5-10 min. The flow rate is 1mL/min, the sample amount is 10 mu L, the detection wavelength is 254nm, and the column temperature is 30 ℃.

Example 6 Aspergillus niger Rha-N1 hydrolysis of naringin (see FIG. 7 for reaction)

Crude enzyme liquid of Aspergillus niger Rha-N1: inoculating Aspergillus niger Rha-N1 on a PDA flat plate, activating at 30 ℃ for 4d, inoculating to a fermentation culture medium, fermenting at 30 ℃ and 150rpm for 4d, centrifuging at 12000rpm, and taking supernatant to obtain crude Aspergillus niger Rha-N1 enzyme solution.

Wild type aspergillus niger WZ001 crude enzyme solution: inoculating wild type Aspergillus niger WZ001 on PDA plate, activating at 30 deg.C for 4 days, inoculating into fermentation culture medium containing naringin (inducing the production of alpha-L-rhamnosidase) with mass concentration of 0.1%, fermenting at 30 deg.C and 150rpm for 4 days, centrifuging at 12000rpm, and collecting supernatant to obtain crude enzyme solution of wild type Aspergillus niger WZ 001.

Taking 1mL of crude Aspergillus niger Rha-N1 enzyme solution, adding 8mL of acetic acid-sodium acetate buffer solution with pH4.5, and putting 1mL of naringin aqueous solution with mass concentration of 2-20% in a 10mL ep tube. The crude enzyme solution of Aspergillus niger Rha-N1 inactivated by boiling water is used as a control, and the reaction is carried out for 5h at the temperature of 60 ℃ and is inactivated for 10min in boiling water. Filtering with 0.22 μm water film, and analyzing naringin and pravastatin content by HPLC. Under the same conditions, the crude Aspergillus niger Rha-N1 enzyme solution is replaced by the crude Aspergillus niger WZ001 enzyme solution, and the catalytic activity of naringin is shown in Table 3. Because the natural alpha-L-rhamnosidase secreted by the wild type Aspergillus niger WZ001 exists in the form of complex enzyme, the pulutinine is further hydrolyzed into naringenin, and the yield of the pulutinine is low.

TABLE 3 yield of conversion of naringin to pranine at different concentrations

Naringin and prunin HPLC assay (see fig. 8, 9):

the column was a Sun fire C18 column (250X 4.6mm), mobile phase A was 100% aqueous methanol (V/V) containing 0.02% phosphoric acid, and mobile phase B was 0.02% phosphoric acid (V/V). The detection method comprises the following steps: 35% A, 65% B, 30 min. The flow rate is 1mL/min, the sample amount is 10 mul, the detection wavelength is 283nm, and the column temperature is 30 ℃.

Example 7 Aspergillus niger Rha-N1 hydrolysis of hesperidin (see FIG. 10 for reaction scheme)

Wild type aspergillus niger WZ001 crude enzyme solution: inoculating wild type Aspergillus niger WZ001 on a PDA plate, activating at 30 ℃ for 4 days, inoculating to a fermentation culture medium containing 0.1% of hesperidin (inducing the generation of alpha-L-rhamnosidase), fermenting at 30 ℃ and 150rpm for 4 days, centrifuging at 12000rpm, and taking supernatant to obtain crude enzyme liquid of wild type Aspergillus niger WZ 001.

Taking 1mL of crude Aspergillus niger Rha-N1 enzyme solution, adding 8mL of acetic acid-sodium acetate buffer solution with pH4.5, and putting 1mL of hesperidin aqueous solution with mass concentration of 2-20% in a 10mL ep tube. The crude enzyme solution of Aspergillus niger Rha-N1 inactivated by boiling water is used as a control, the reaction is carried out for 5h under the condition of 60 ℃, and the inactivation is carried out for 10min in the boiling water. Filtering with 0.22 μm water film, and analyzing hesperidin and hesperetin monoglucoside contents by HPLC. Under the same conditions, the crude Aspergillus niger Rha-N1 enzyme solution is replaced by the crude Aspergillus niger WZ001 enzyme solution, and the condition of catalyzing hesperidin is shown in Table 4. Because the natural alpha-L-rhamnosidase secreted by the wild type Aspergillus niger WZ001 exists in the form of complex enzyme, the hesperetin monoglucoside is further hydrolyzed into hesperetin, and the yield of the hesperetin monoglucoside is low.

TABLE 4 yield of hesperidin converted into hesperetin monoglucoside at different concentrations

Hesperidin and hesperetin monoglucoside HPLC determination (see FIGS. 11 and 12):

the column was a Sunfire C18 column (250X 4.6mm), mobile phase A was 80% acetonitrile in water (V/V) containing 0.02% phosphoric acid, and mobile phase B was 0.02% phosphoric acid (V/V). The detection method comprises the following steps: 40% A, 60% B, 10 min. The flow rate is 1mL/min, the sample amount is 10 mul, the detection wavelength is 283nm, and the column temperature is 30 ℃.

Sequence listing

<110> Zhejiang industrial university

<120> Aspergillus niger Rha-N1 and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>452

<212>PRT

<213> Aspergillus niger (Aspergillus niger)

<400>1

Met Pro Arg Lys Arg Gly Thr Ser Thr Ile Lys Ser Pro Gly Asp Ser

1 5 10 15

Lys Leu Arg Glu Lys Asp Arg Thr Gln Asp Glu Gly Ser Lys Glu Thr

20 25 30

Arg Gly Ser Leu Trp Ser Asn Val Ala Leu Ala Ile Gly Val Leu Ala

35 40 45

Val Gly Ala Ser Ile Pro Met Ile Leu Ser Arg Leu Asp Lys Ala Tyr

50 55 60

Lys Thr Thr Ser Ile Asp Leu Lys Lys Leu Pro Ala Thr Ala Gln Val

65 70 75 80

Ile Asp Gln Lys Ser Phe Asn Val Leu Gln His Val Pro Pro Pro Lys

85 90 95

Glu Val Asn Ala Thr Thr Arg Phe Leu Trp Pro Gly Val Thr Tyr Glu

100 105 110

Ser Leu Thr Lys Gln Pro Phe His Val Tyr Asp Ala Glu Phe Leu Asp

115 120 125

Ile Ile Gly Asn Asp Pro Thr Leu Thr Leu Ile Ala Thr Ser Asn Thr

130 135 140

Asp Pro Ile Phe His Glu Ala Val Val Trp Ser Pro Asp Thr Glu Glu

145 150 155 160

Val Phe Phe Ala Gln Asn Ala Gly Asp Pro Ala Ala Gly Thr Gly Leu

165 170 175

Glu Lys Ser Ser Val Val Gln Lys Ile Ser Leu Ser Asp Ala Glu Ala

180 185 190

Val Lys Asn Glu Thr His Ile Ser Glu Glu Val Glu Val Lys Ile Val

195 200 205

Asp Ser Thr Pro Gln Ile Ile Asn Pro Asn Gly Gly Thr Asn Tyr Lys

210 215 220

Gly Gln Ile Ile Phe Ala Gly Glu Gly Gln Gly Asp Asn Ile Pro Ser

225 230 235 240

Ala Leu Tyr Leu Met Asn Pro Arg Ser Pro His Asn Thr Thr Ile Leu

245 250 255

Val Asn Asn Tyr Phe Gly Arg Gln Phe Asn Ser Ile Asn Asp Val Ser

260 265 270

Val Asn Pro Arg Asn Gly Asp Ile Tyr Phe Thr Asp Thr Met Tyr Gly

275 280 285

Tyr Trp Gln Tyr Phe Arg Pro Gln Pro Gly Leu Gln Asn Gln Val Tyr

290 295 300

Arg Phe Asn Pro Glu Thr Gly Ser Leu Thr Val Val Ala Asp Gly Phe

305 310 315 320

Val Ala Pro Asn Gly Leu Thr Phe Ser Pro Asp Gly Gln His Ala Tyr

325 330 335

Val Thr Asp Thr Gly Ile Ser Asn Ala Leu Phe Gly Leu Asn Phe Thr

340 345 350

Arg Pro Ala Ser Ile Tyr Arg Phe Asp Val Gln Lys Asp Gly Thr Trp

355 360 365

Glu Asn Arg Lys Thr Phe Ala Tyr Val Ala Ala Arg Leu Pro Asp Gly

370 375 380

Ile His Cys Asp Ser Lys Gly Asn Val Tyr Ala Gly Cys Gly Asp Gly

385 390 395 400

Val His Val Trp Asn Ser Ser Gly Lys Leu Ile Gly Lys Ile Tyr Thr

405 410 415

Gly Val Asn Ala Ala Asn Phe Gln Phe Ala Gly Lys Gly Arg Met Val

420 425 430

Ile Met Gly Arg Thr Lys Leu Phe Tyr Ala Thr Leu Ala Ala Ser Gly

435 440 445

Ala Pro Leu Ser

450

<210>2

<211>1359

<212>DNA

<213> Aspergillus niger (Aspergillus niger)

<400>2

atgcctcgga agcggggtac atcgacgata aaaagcccag gcgactccaa acttcgtgag 60

aaggacagaa cccaagatga aggatcgaaa gaaacaagag gctcactttg gagtaacgtc 120

gctctggcga taggagtact tgccgttggt gcatcaatcc caatgattct tagtcgcctc 180

gacaaagcct acaagaccac cagtatcgac ctcaagaagc taccggccac tgctcaagta 240

atcgaccaga agagcttcaa cgttctccaa catgttccgc cgccaaaaga agtcaatgca 300

acaacacgat ttctgtggcc aggagtcacg tacgaatccc tcaccaagca gccatttcat 360

gtctatgacg cagaattcct agacattatt ggcaacgatc ccactttgac cctgatcgct 420

acttcaaaca cagacccaat ctttcacgaa gctgttgtgt ggagccctga caccgaagag 480

gtctttttcg cccaaaacgc aggcgatcct gcagctggca ctggccttga aaagtcctca 540

gttgttcaga agatttcctt gagtgacgcc gaagctgtaa agaatgagac tcatatatct 600

gaagaagtag aggtcaagat tgtggattca acaccacaaa ttattaaccc gaatggcgga 660

acaaactata aaggccaaat catctttgca ggggaaggac aaggagacaa tatcccatcg 720

gctctttatc tgatgaaccc caggagcccg cataatacaa caatactggt taacaactac 780

tttggaagac agttcaactc aatcaacgac gtctctgtca atccccgtaa tggcgacatt 840

tacttcacgg acaccatgta cggctactgg cagtatttcc gcccacagcc aggactgcag 900

aaccaagtat atcgcttcaa cccggagact ggatctttga ctgttgtcgc tgatggtttt 960

gtggccccaa acggcctcac gttctctcca gatggacaac atgcgtatgt gacagatact 1020

ggtatcagca atgcactctt cggtttgaac tttacccgtc ctgcttctat ctaccgtttc 1080

gacgtccaaa aagatggaac ctgggagaat cgaaagactt tcgcatacgt agcagcgcgt 1140

ctgcctgatg ggatacactg tgattccaag ggtaatgtgt acgcgggctg tggagatggt 1200

gtgcatgttt ggaattcttc ggggaagctc attggaaaga tctatacagg agtcaacgca 1260

gccaactttc agttcgctgg aaagggccgc atggtgatta tggggaggac gaagctattc 1320

tatgccacgc tcgcggcctc tggggcaccc ctgagctga 1359

Claims

1. Aspergillus niger (Aspergillus niger) Rha-N1, preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020035, the preservation date of 2020, 1, 13 days, the preservation address: wuhan university, Wuhan, China, zip code 430072.

2. Use of the aspergillus niger Rha-N1 according to claim 1 for the hydrolysis of flavonoids.

3. Use according to claim 2, characterized in that said flavonoids comprise rutin, hesperidin or naringin.

4. The application of claim 2, wherein the application comprises the steps of centrifuging fermentation liquor obtained by fermenting and culturing Aspergillus niger Rha-N1, mixing supernate with flavonoid compounds and acetic acid-sodium acetate buffer solution with the pH value of 4.0-5.5, and after completely reacting at the temperature of 50-65 ℃, separating and purifying reaction liquid to obtain the flavonoid monoglycoside compounds.

5. The use as claimed in claim 4, wherein the flavonoids are added in the form of an aqueous solution of flavonoids with a mass concentration of 2% -20%, the volume ratio of the supernatant to the aqueous solution of flavonoids is 1:1, and the volume ratio of the supernatant to the buffer is 1: 8.

6. Use according to claim 4, characterized in that the supernatant is prepared as follows: inoculating Aspergillus niger Rha-N1 on a PDA flat plate, activating at 30 ℃ for 4d, inoculating to a fermentation culture medium, fermenting at 30 ℃ and 150rpm for 4d, centrifuging at 12000rpm for 10min, and collecting supernatant; the fermentation culture medium comprises the following components in percentage by weight: 1% of bran, 4% of bean cake powder and 0.1% of anhydrous CaCl₂，0.1％NH₄H₂PO₄，0.5％MgSO₄·7H₂O, water as solvent and natural pH.