CN111454873A

CN111454873A - Streptomyces albus genetic engineering bacterium and application thereof in polylysine production

Info

Publication number: CN111454873A
Application number: CN202010283789.1A
Authority: CN
Inventors: 秦加阳; 王爱霞; 薛宇斌; 王秀文; 于波
Original assignee: Institute of Microbiology of CAS; Binzhou Medical College
Current assignee: Institute of Microbiology of CAS; Binzhou Medical College
Priority date: 2019-11-29
Filing date: 2020-04-13
Publication date: 2020-07-28
Anticipated expiration: 2040-04-13
Also published as: CN111454873B

Abstract

The invention discloses a genetically engineered bacterium Streptomyces albus (Streptomyces albulus) Q-P L2, which is obtained by overexpressing a polylysine synthase gene in a Streptomyces albus wild bacterium Q-P L by using a genetic engineering method, and also discloses application of the genetically engineered bacterium in polylysine fermentation production, namely, the yield of the polylysine reaches up to 42.9 g/l, the production rate reaches 11.7 g/l/day, and the production capacity of the polylysine is 2-5 times of that of the Streptomyces albus wild bacterium Q-P L.

Description

Streptomyces albus genetic engineering bacterium and application thereof in polylysine production

Technical Field

The invention relates to a genetic engineering bacterium and application thereof, in particular to a streptomyces albidoides genetic engineering bacterium, a construction method thereof and a method for producing polylysine by utilizing the strain through fermentation.

Background

Polylysine (-P L) is a polymer formed by connecting L- α -amino and-carboxyl of lysine through amido bond, P L has strong bacteriostatic activity, wide bacteriostatic spectrum, high safety, no toxic or side effect, biodegradability and edibility, in the last 80 th century, P L is approved to be used as a food preservative in Japan, America, Korea and other countries, in 2014, P L and hydrochloride thereof are approved to be used as food preservatives by relevant departments in China, at present, P L is used as a preservative in the industries of food, cosmetics, medical health and the like, and P L can be used as a gene carrier, a weight-reducing health-care product, a medicine carrier, a novel water-absorbing material, a chip, a biological electronic coating agent and the like besides being used as a food preservative.

At present, the main production method of-P L is a microbial fermentation method, the commonly used microorganism for fermentation is streptomyces albidoflavus, and the industrial production of-P L with kiloton-scale annual production has been realized by a streptomyces albidoflavus mutant strain by a Japan asphyxia company (Chisso Corporation). the breeding work of the streptomyces albidoflavus strain with high yield-P L is continuously promoted and has achieved certain success in China.

The research of the prior art shows that Chinese patent document No. CN201610665007.4, granted publication No. 2019-06-11, discloses a high-yield strain-P L and a method for producing-P L, wherein the strain is obtained by mutagenesis and screening, the yield of the strain-P L reaches 7.5 g/L after fermentation for 42 hours, and the production speed is 4.3 g/L/day.

Chinese patent document No. CN201110274326.X, application date 2011-09-16 discloses a method for producing-P L by fermenting a mixed carbon source of glucose and glycerol, wherein the production speed of producing-P L by the method is 3-5 g/L/day.

Chinese patent document No. CN201510886138.0, Announcet No. 2019-01-18, discloses a Streptomyces albus genetic engineering bacterium and a construction method and application thereof, the strain is used for over-expressing an ammonium transporter gene amtB in Streptomyces albus, the utilization rate of the strain on a nitrogen source in a fermentation liquid is improved, so that the yield of-P L is improved, the strain is used for producing-P L35.7.7 g/l in 168 hours, and the production speed is 5.1 g/l/day.

Chinese patent document No. CN201610551417.6, granted publication No. 2019-07-02, discloses a method for increasing the yield of-P L, which is to add exogenous substances such as calcium gluconate, lysine, aspartic acid and the like into a fermentation culture medium, so that the yield of-P L of streptomyces in a total synthesis culture medium for 46 hours is increased to 5.12 g/l, and the production speed is 2.7 g/l/day.

Disclosure of Invention

Aiming at the defect of low production speed of P L in the prior art, the invention aims to provide a streptomyces albus genetic engineering strain and realize high-efficiency production of P L by using the strain.

According to one aspect of the invention, the invention provides a streptomyces albus genetically engineered bacterium Q-P L2, wherein the streptomyces albus genetically engineered bacterium Q-P L2 comprises one or more-P L synthetase genes introduced by genetic engineering and expression elements thereof.

According to some embodiments of the invention, the expression elements are in particular a promoter and a ribosome binding site.

According to some embodiments of the invention, the nucleotide sequence of the-P L synthetase gene comprises the sequence of SEQ id No.2 or a homologous sequence thereof.

According to some embodiments of the invention, the homologous sequence refers to a nucleotide sequence that is at least 70% identical to the sequence.

According to certain embodiments of the invention, the homologous sequences have substantially the same activity as the sequences disclosed herein.

According to some embodiments of the invention, the Streptomyces albus genetically engineered bacterium Q-P L2 has 2-25 times of the capability of producing-P L by fermentation compared with a Streptomyces albus wild strain.

According to one aspect of the invention, the invention provides a method for producing-P L by using streptomyces albus genetically engineered bacterium Q-P L2.

According to certain embodiments of the invention, the method uses a medium comprising citrate to ferment the S.albidoides genetically engineered bacterium Q-P L2 to produce-P L.

According to certain embodiments of the invention, the medium is a fermentation medium.

According to some embodiments of the invention, the fermentation medium comprises 1 to 20 g/l citrate.

According to some embodiments of the invention, the method comprises:

plating, namely inoculating the streptomyces albidoflavus Q-P L2 to an MS solid culture medium containing 60-120 micrograms/ml apramycin, and culturing for 4-7 days at 25-35 ℃ until black spores are grown on the surface of the culture medium for later use;

seed culture: collecting spores from the plate, inoculating the spores into a seed culture medium containing 60-120 micrograms/ml of apramycin, and culturing for 36-72 hours at 25-35 ℃;

and (2) fermentation culture, namely inoculating the cultured seed culture solution to a fermentation tank filled with a fermentation culture medium for culture, controlling the culture temperature to be 25-35 ℃, controlling the dissolved oxygen to be 10-100%, controlling the aeration ratio to be 1-5 vvm, maintaining the pH value of the fermentation solution unchanged by using alkali when the pH value of the fermentation solution is reduced to 3.8-4.2, monitoring the concentration of a carbon source in the fermentation solution in the culture process, feeding a fed-batch culture medium when the concentration of the carbon source is 5-15 g/L, adjusting the feeding speed by monitoring the concentration of the carbon source in the fermentation solution in a fed-back manner, measuring the yield of-P L in the fermentation solution at intervals, wherein the total time of the fermentation culture is 36-144 hours.

According to some embodiments of the present invention, the fermentation medium comprises 40 to 100 g/L of a carbon source, 2 to 20 g/L of a nitrogen source, 1 to 20 g/L of citrate, 0.2 to 2 g/L of dipotassium hydrogen phosphate, 0.5 to 5 g/L of potassium dihydrogen phosphate, 0.01 to 0.1 g/L of zinc sulfate heptahydrate, 0.1 to 2 g/L of magnesium sulfate heptahydrate, 0.01 to 0.1 g/L of ferrous sulfate heptahydrate, and a pH of 5.5 to 7.0.

According to some embodiments of the present invention, the feed medium comprises 0-600 g/L carbon source, 20-200 g/L nitrogen source, and 10-100 g/L citrate.

According to certain embodiments of the invention, the carbon source, nitrogen source and citrate in the feed medium are the same as the carbon source, nitrogen source and citrate in the fermentation medium.

According to certain embodiments of the invention, the carbon source is one or more combinations of glucose, glycerol, xylose, fructose, mannitol.

According to certain embodiments of the invention, the nitrogen source is one or more combinations of ammonium sulfate, ammonium chloride, urea, ammonium nitrate, yeast powder, soy peptone, corn steep liquor, peanut meal, peptone.

According to certain embodiments of the invention, the citrate salt is one or more combinations of sodium citrate, ammonium citrate, potassium citrate, zinc citrate, calcium citrate, magnesium citrate, sodium dihydrogen citrate, potassium dihydrogen citrate, sodium potassium citrate, ferric citrate, diammonium hydrogen citrate.

Genetically engineered bacterium Streptomyces albus (Streptomyces albulus) Q-P L2

The genetically engineered bacterium is named as Streptomyces albulus Q-P L2 in a laboratory, is obtained by over-expressing-P L synthetase in Streptomyces albulus wild bacteria, is preserved in a China general microorganism strain preservation management center (CGMCC for short, and the address is CGMCC institute of Microscosuriaceae institute of Sichuan institute of China, No.1 Hospital, Ind. of the south Korea of Beijing) within 10 and 30 days of 2019, and has the preservation registration number of CGMCC NO. 18772.

The Streptomyces albidoflavus wild strain is selected from soil samples in the school of Binzhou medical college in Laishu, Taiwan, Shandong province, and the laboratory of the strain is named as Streptomyces albulus Q-P L.

The genetic engineering strain Streptomyces albus (Streptomyces albulus) Q-P L2 contains genetic elements capable of over-expressing polylysine synthetase, wherein the length of a strong promoter kasOp and a ribosome binding site sequence from phage phi C31 capsid protein is 96 bases, the nucleotide sequence is shown as SEQ ID NO.1, the length of a gene sequence of a used-P L synthetase gene pls is 3960 bases, and the nucleotide sequence is shown as SEQ ID NO. 2.

In SEQ ID NO.1, the sequence of the strong promoter kasOp is "tgttcacattcgaacggtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggcca". The sequence of the ribosome binding site from the capsid protein of bacteriophage φ C31 is "tctaagtaaggagtgtccat".

The genetic engineering bacterium Streptomyces albus (Streptomyces albulus) Q-P L2 can be used for producing-P L by fermentation by taking glucose, glycerol, xylose and the like as substrates.

The preferred culture temperature of the genetically engineered bacterium Streptomyces albus (Streptomyces albulus) Q-P L2 is 25-35 ℃, and the genetically engineered bacterium Streptomyces albus can grow on a culture medium containing 60-120 micrograms/ml of apramycin.

The invention relates to application of a genetically engineered bacterium Streptomyces albus (Streptomyces albulus) Q-P L2 in production of-P L.

The application relates to the following implementation steps:

(1) plate culture

Inoculating streptomyces albidoflavus Q-P L2 to an MS solid culture medium containing 60-120 micrograms/ml apramycin, culturing for 4-7 days at 25-35 ℃, and waiting until the surface of the culture medium is full of black spores for later use.

(2) Seed culture

Collecting spores from the plate, inoculating the spores into a seed culture medium containing 60-120 micrograms/ml apramycin, and culturing for 36-72 hours at 25-35 ℃.

(3) Fermentation culture

The strain is fermented in a shake flask during fermentation comparison and culture medium optimization, and is fermented in a fermentation tank during production.

And (3) shaking flask fermentation, namely inoculating the cultured seed culture solution into a conical flask filled with a fermentation culture medium according to the inoculation amount of 5-20% (volume ratio), performing shaking culture on a shaking table at 25-35 ℃ at 200-300 r/min for 48-84 hours, and measuring the yield of-P L in the fermentation liquid.

And (2) fermenting in a fermentation tank, namely inoculating the cultured seed culture solution to the fermentation tank filled with a fermentation culture medium according to the inoculation amount of 5-20% (volume ratio) for culturing, wherein the culture temperature is 25-35 ℃, the dissolved oxygen is controlled to be more than 5-30% by adjusting the stirring speed of the fermentation tank to be 200-1200 r/min, the aeration ratio is 1-5 vvm, when the pH value of the fermentation solution is naturally reduced to 3.8-4.2, ammonia water is used for maintaining the pH value of the fermentation solution unchanged, the concentration of a carbon source in the fermentation solution is monitored in the culture process, the carbon source, a nitrogen source and citrate are supplemented when the concentration of the carbon source is lower than 10 g/l, the yield of-P L in the fermentation solution is measured every 4-12 hours, and the total time of fermentation culture is 36-.

Wherein the formula of the MS solid culture medium in the step (1) comprises 10-30 g/L of mannitol, 10-30 g/L of soybean meal and 15-20 g/L of agar powder.

The formula of the MS solid culture medium in the step (1) is as follows: 10-30 g/L of mannitol, 10-30 g/L of soybean meal and 15-20 g/L of agar powder.

The formula of the seed culture medium in the step (2) comprises 10-100 g/L of glucose, 2-20 g/L of yeast powder, 2-20 g/L of ammonium sulfate, 1-20 g/L of sodium citrate, 0.1-2 g/L of dipotassium hydrogen phosphate, 0.5-5 g/L of monopotassium phosphate, 0.01-0.1 g/L of zinc sulfate heptahydrate, 0.1-2 g/L of magnesium sulfate heptahydrate and 0.01-0.1 g/L of ferrous sulfate heptahydrate.

The formula of the seed culture medium in the step (2) is as follows: 10-100 g/L of glucose, 2-20 g/L of yeast powder, 2-20 g/L of ammonium sulfate, 1-20 g/L of sodium citrate, 0.1-2 g/L of dipotassium hydrogen phosphate, 0.5-5 g/L of potassium dihydrogen phosphate, 0.01-0.1 g/L of zinc sulfate heptahydrate, 0.1-2 g/L of magnesium sulfate heptahydrate and 0.01-0.1 g/L of ferrous sulfate heptahydrate.

The formula of the fermentation medium in the step (3) comprises 40-100 g/L of carbon source, 2-20 g/L of nitrogen source, 1-20 g/L of citrate, 0.2-2 g/L of dipotassium hydrogen phosphate, 0.5-5 g/L of potassium dihydrogen phosphate, 0.01-0.1 g/L of zinc sulfate heptahydrate, 0.1-2 g/L of magnesium sulfate heptahydrate and 0.01-0.1 g/L of ferrous sulfate heptahydrate.

The formula of the fermentation medium in the step (3) is as follows: 40-100 g/L of carbon source, 2-20 g/L of nitrogen source, 1-20 g/L of citrate, 0.2-2 g/L of dipotassium hydrogen phosphate, 0.5-5 g/L of potassium dihydrogen phosphate, 0.01-0.1 g/L of zinc sulfate heptahydrate, 0.1-2 g/L of magnesium sulfate heptahydrate and 0.01-0.1 g/L of ferrous sulfate heptahydrate.

The carbon source in the formula of the fermentation medium is one or more of glucose, glycerol, xylose, fructose and mannitol. The nitrogen source is an organic nitrogen source, an inorganic nitrogen source or a combination of the two. According to certain embodiments of the present invention, the nitrogen source, organic nitrogen source or inorganic nitrogen source, may be combined in any proportion in the fermentation medium. The organic nitrogen source is one or more of yeast powder, soybean peptone, corn steep liquor, peanut cake powder and peptone. The inorganic nitrogen source is one or more of ammonium sulfate, ammonium chloride, urea and ammonium nitrate. The citrate is one or more of sodium citrate, ammonium citrate, potassium citrate, zinc citrate, calcium citrate, magnesium citrate, sodium dihydrogen citrate, potassium sodium citrate, ferric citrate, and diammonium hydrogen citrate.

The genetically engineered strain Streptomyces albus (Streptomyces albulus) Q-P L2 takes the carbon sources such as glucose and glycerol as substrates, the yield of-P L is high-efficiently fermented and produced in a fermentation tank at the temperature of 28-32 ℃, the highest yield of-P L reaches 42.9 g/L, the production rate reaches 11.7 g/L/day, and the production capacity of-P L is 2-5 times of that of a wild strain Streptomyces albulus Q-P L.

Detailed Description

Streptomyces albus

According to certain embodiments of the present invention, the present invention provides a strain of streptomyces albus genetically engineered bacterium Q-P L2, wherein the streptomyces albus genetically engineered bacterium Q-P L2 comprises one or more-P L synthetase genes introduced by genetic engineering and expression elements thereof.

According to some embodiments of the invention, the Streptomyces albus genetically engineered bacterium Q-P L2 is genetically engineered to include in its genome one or more genetically engineered-P L synthetase genes and expression elements thereof.

According to some embodiments of the invention, the Streptomyces albus genetically engineered bacterium Q-P L2 comprises a genetically engineered introduced-P L synthetase gene and expression elements thereof.

According to certain embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L comprises two genetically engineered introduced-P L synthase genes and expression elements thereof, according to certain embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L comprises three genetically engineered introduced-P L synthase genes and expression elements thereof, according to certain embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L2 comprises four genetically engineered introduced-P L synthase genes and expression elements thereof, according to certain embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L comprises five genetically engineered-P L synthase genes and expression elements thereof.

According to certain embodiments of the present invention, the-P L synthetase gene and its expression elements are integrated into the genome of the genetically engineered strain of S.albus Q-P L2 via the pSET152-pro-pls plasmid, according to certain embodiments of the present invention, the-P L synthetase gene can also be integrated into the genome of the genetically engineered strain of S.albus Q-P L2 via other plasmids known in the art.

According to certain embodiments of the present invention, the construction of the pSET152-pro-pls plasmid comprises one-P L synthetase gene and its expression elements the construction of the pSET152-pro-pls plasmid comprises two-P L synthetase genes and their expression elements according to certain embodiments of the present invention the construction of the pSET152-pro-pls plasmid comprises three-P L synthetase genes and their expression elements the construction of the pSET152-pro-pls plasmid comprises four-P L synthetase genes and their expression elements according to certain embodiments of the present invention the construction of the pSET152-pro-pls plasmid comprises five-P L synthetase genes and their expression elements according to certain embodiments of the present invention the construction of the pSET152-pro-pls plasmid comprises more-P L synthetase genes and their expression elements according to certain embodiments of the present invention.

According to some embodiments of the invention, the-P L synthetase gene is 3960 bases in length.

According to some embodiments of the invention, the nucleotide sequence of the-P L synthetase gene is shown in SEQ ID NO. 2.

According to some embodiments of the invention, the-P L synthetase gene expression elements are in particular a promoter and a ribosome binding site.

According to some embodiments of the invention, the promoter is a constitutive promoter. According to some embodiments of the invention, the promoter is a strong promoter. According to some embodiments of the invention, the promoter is a strong promoter, kasOp. According to certain embodiments of the invention, the promoter is another promoter that can be used for expression in S.albus.

According to certain embodiments of the invention, the ribosome binding site is the ribosome binding site from the capsid protein of bacteriophage φ C31. According to certain embodiments of the invention, the ribosome binding site is another ribosome binding site that can be used in S.albidus.

According to some embodiments of the invention, the-P L synthetase gene expression elements are in particular strong promoter and ribosome binding site sequences.

According to some embodiments of the invention, the-P L synthetase gene expression elements are in particular the strong promoter kasOp and the ribosome binding site sequence, 96 bases in length.

According to some embodiments of the invention, the-P L synthetase gene expression element is specifically a strong promoter and a ribosome binding site sequence from the phage Φ C31 capsid protein according to some embodiments of the invention, the nucleotide sequence of the-P L synthetase gene expression element is shown in SEQ ID No. 1.

According to certain embodiments of the invention, the-P L synthetase gene is the-P L synthetase gene of S.albidus according to certain embodiments of the invention, the-P L synthetase gene is the-P L synthetase gene of other species known in the art.

According to some embodiments of the invention, the nucleotide sequence of the-P L synthetase gene is the sequence of SEQ ID NO.2 or a homologous sequence thereof.

According to certain embodiments of the invention, the nucleotide sequence of the-P L synthetase gene comprises the sequence of SEQ ID No.2 according to certain embodiments of the invention, the nucleotide sequence of the-P L synthetase gene is the sequence of SEQ ID No. 2.

According to some embodiments of the invention, the homologous sequence refers to a nucleotide sequence that is at least 70% identical to the sequence. According to certain embodiments of the invention, the homologous sequences have a nucleotide sequence that is at least 70% identical, such as a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98%, or at least 99% identical.

According to certain embodiments of the invention, the homologous sequences have substantially the same activity as the sequences disclosed herein. According to certain embodiments of the invention, the homologous sequence has an activity that is at least 70% identical, e.g., at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 93%, at least 95%, at least 97%, at least 98%, or at least 99% identical to a sequence disclosed herein.

According to some embodiments of the present invention, when a-P L synthetase gene and an expression element thereof are integrated into the Streptomyces albus genetically engineered bacterium Q-P L2, the ability to produce-P L by fermentation is 2-5 times, such as 2-4 times, 2-3 times, 3-5 times, 3-4 times or 4-5 times, that of the Streptomyces albus wild strain, and according to some embodiments of the present invention, the ability to produce-P L by fermentation is 2 times, 2.2 times, 2.5 times, 2.8 times, 3 times, 3.2 times, 3.5 times, 3.8 times, 4 times, 4.2 times, 4.5 times, 4.8 times or 5 times, that of the Streptomyces albus wild strain.

According to some embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L2 has 4 to 10 times, such as 4 to 8 times, 4 to 6 times, 6 to 10 times, 6 to 8 times or 8 to 10 times, of the ability to produce-P L by fermentation when two-P L synthase genes and expression elements thereof are integrated, and according to some embodiments of the present invention, the ability to produce-P L by fermentation when two-P L synthase genes and expression elements thereof are integrated in the Streptomyces albus genetically engineered bacterium Q-P L2 has 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times or 10 times, of the ability to produce-P L by fermentation when two-P L synthase genes and expression elements thereof are integrated.

According to some embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L2 has a fermentation production capacity of-P L6 to 15 times, for example, 6 to 12 times, 6 to 10 times, 6 to 8 times, 8 to 15 times, 8 to 12 times, 8 to 10 times, 10 to 15 times, 10 to 12 times or 12 to 15 times, of a Streptomyces albus wild strain when three-P L synthase genes and expression elements thereof are integrated, and the fermentation production capacity of-P L is 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 10.5 times, 11 times, 11.5 times, 12 times, 12.5 times, 13 times, 13.5 times, 14.5 times or 15 times, of the Streptomyces albus wild strain when three-P L synthase genes and expression elements thereof are integrated in the Streptomyces albus genetically engineered bacterium Q-P L2.

According to some embodiments of the invention, when the four-P L synthetase genes and expression elements thereof are integrated in the Streptomyces albus genetically engineered bacterium Q-P L2, the capability of producing-P L through fermentation is 8-20 times, such as 8-18 times, 8-15 times, 8-12 times, 8-10 times, 10-20 times, 10-18 times, 10-15 times, 10-12 times, 12-20 times, 12-18 times, 12-15 times, 15-20 times, 15-18 times or 18-20 times, that of a Streptomyces albus wild strain, and when the four-P L synthetase genes and expression elements thereof are integrated in the Streptomyces albus genetically engineered bacterium Q-P L2, the capability of producing-P L through fermentation is 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times or 20 times, that of the Streptomyces albus wild strain.

According to some embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L2 has a fermentation production capability of-P L10 to 25 times, for example, 10 to 20 times, 10 to 15 times, 15 to 25 times, 15 to 20 times or 20 to 25 times, of the Streptomyces albus wild strain when five-P L synthase genes are integrated, and according to some embodiments of the present invention, the fermentation production capability of-P L is 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 21 times, 22 times, 23 times, 24 times or 25 times, of the Streptomyces albus wild strain when five-P L synthase genes are integrated in the Streptomyces albus genetically engineered bacterium Q-P L2.

According to certain embodiments of the present invention, the ability to produce-P L by fermentation is increased by the fold of the ability to produce-P L by fermentation when a plurality of-P L synthase genes are integrated in the genetically engineered strain of Streptomyces albus Q-P L2, and the ability to produce-P L by fermentation is increased by the fold of the wild strain of Streptomyces albus when a plurality of-P L synthase genes are integrated in the genetically engineered strain of Streptomyces albus Q-P L2.

According to some embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L2 has a fermentation production capacity of-P L that is 2 to 25 times, such as 2 to 20 times, 2 to 15 times, 2 to 10 times, 2 to 5 times, 5 to 25 times, 5 to 20 times, 5 to 15 times, 5 to 10 times, 10 to 25 times, 10 to 20 times, 10 to 15 times, 15 to 25 times, 15 to 20 times, or 20 to 25 times, that of a Streptomyces albus wild strain, and according to some embodiments of the present invention, the Streptomyces albus genetically engineered bacterium Q-P L2 has a fermentation production capacity of-P L that is 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 21 times, 22 times, 23 times, 24 times, or 25 times that of the Streptomyces albus wild strain.

Process for producing-P L

According to certain embodiments of the present invention, the present invention provides methods for producing-P L using the Streptomyces albus genetically engineered bacterium Q-P L2.

According to certain embodiments of the invention, the process for producing-P L is a fermentation process.

According to certain embodiments of the invention, the method of producing-P L uses a medium comprising citrate to fermentatively produce the genetically engineered strain of S.albus Q-P L2.

According to certain embodiments of the present invention, the medium of the method of producing-P L includes a fermentation medium and a feed medium, according to certain embodiments of the present invention, the fermentation medium includes 1-20 grams/liter citrate.

According to some embodiments of the invention, the fermentation medium comprises 1 to 20 g/L citrate, such as 1 to 15 g/L, 1 to 10 g/L, 1 to 5 g/L, 5 to 20 g/L, 5 to 15 g/L, 5 to 10 g/L, 10 to 20 g/L, 10 to 15 g/L or 15 to 20 g/L. According to certain embodiments of the invention, the fermentation medium comprises citrate 1 g/l, 2 g/l, 3 g/l, 4 g/l, 5 g/l, 6 g/l, 7 g/l, 8 g/l, 9 g/l, 10 g/l, 11 g/l, 12 g/l, 13 g/l, 14 g/l, 15 g/l, 16 g/l, 17 g/l, 18 g/l, 19 g/l or 20 g/l.

According to some embodiments of the invention, the feed medium comprises citrate 10-100 g/l.

According to some embodiments of the invention, the feed medium comprises citrate 10-100 g/L, such as 10-80 g/L, 10-50 g/L, 10-30 g/L, 30-100 g/L, 30-80 g/L, 30-50 g/L, 50-100 g/L, 50-80 g/L or 80-100 g/L. According to certain embodiments of the invention, the feed medium comprises citrate 10 g/l, 20 g/l, 30 g/l, 40 g/l, 50 g/l, 60 g/l, 70 g/l, 80 g/l, 90 g/l or 100 g/l.

According to certain embodiments of the invention, the citrate salt in the fermentation medium is one or more combinations of sodium citrate, ammonium citrate, potassium citrate, zinc citrate, calcium citrate, magnesium citrate, sodium dihydrogen citrate, potassium dihydrogen citrate, sodium potassium citrate, ferric citrate, diammonium hydrogen citrate. According to certain embodiments of the invention, the citrate may be combined in any ratio in the fermentation medium. According to certain embodiments of the invention, the citrate in the fermentation medium is sodium citrate. According to some embodiments of the invention, the citrate in the fermentation medium is 5 g/l sodium citrate.

(1) Plate culture

According to some embodiments of the invention, the seeding comprises streaking, coating, or the like.

According to some embodiments of the present invention, the MS solid medium contains apramycin at 60-120. mu.g/ml, such as 60-100. mu.g/ml, 60-80. mu.g/ml, 80-120. mu.g/ml, 80-100. mu.g/ml, or 100-120. mu.g/ml. According to certain embodiments of the invention, the MS solid medium comprises apramycin at 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 micrograms/ml.

According to some embodiments of the invention, S.albidoidis Q-P L2 is cultured at 25-35 ℃, e.g., 25-32 ℃, 25-30 ℃, 25-28 ℃, 28-35 ℃, 28-32 ℃, 28-30 ℃, 30-35 ℃, 30-32 ℃ or 32-35 ℃.

According to certain embodiments of the invention, Streptomyces albus Q-P L2 is cultured for 4-7 days, e.g., 4 days, 5 days, 6 days, or 7 days.

According to some embodiments of the invention, Streptomyces albus Q-P L2 is inoculated onto MS solid medium containing 80. mu.g/ml apramycin, and cultured at 30 ℃ for 5 days until the surface of the medium is full of black spores for use.

MS solid culture medium

According to some embodiments of the invention, the formulation of the MS solid medium comprises 10-30 g/L of mannitol, 10-30 g/L of soybean meal and 15-20 g/L of agar powder.

According to some embodiments of the invention, the formulation of the MS solid medium is: 10-30 g/L of mannitol, 10-30 g/L of soybean meal and 15-20 g/L of agar powder.

According to certain embodiments of the present invention, the formulation of the MS solid medium comprises 10 to 30 g/L, such as 10 to 20 g/L or 20 to 30 g/L, of mannitol. According to certain embodiments of the invention, the formulation of the MS solid medium comprises mannitol 10 g/l, 11 g/l, 12 g/l, 13 g/l, 14 g/l, 15 g/l, 16 g/l, 17 g/l, 18 g/l, 19 g/l, 20 g/l, 21 g/l, 22 g/l, 23 g/l, 24 g/l, 25 g/l, 26 g/l, 27 g/l, 28 g/l, 29 g/l or 30 g/l.

According to some embodiments of the invention, the formulation of the MS solid medium comprises 10 to 30 g/L, such as 10 to 20 g/L or 20 to 30 g/L of soy flour. According to some embodiments of the invention, the formulation of the MS solid medium comprises soybean meal 10 g/l, 11 g/l, 12 g/l, 13 g/l, 14 g/l, 15 g/l, 16 g/l, 17 g/l, 18 g/l, 19 g/l, 20 g/l, 21 g/l, 22 g/l, 23 g/l, 24 g/l, 25 g/l, 26 g/l, 27 g/l, 28 g/l, 29 g/l or 30 g/l.

According to some embodiments of the invention, the formulation of the MS solid medium comprises 15 to 20 g/l, such as 15 g/l, 16 g/l, 17 g/l, 18 g/l, 19 g/l or 20 g/l, of agar powder.

According to some embodiments of the invention, the formulation of the MS solid medium comprises 20 g/l mannitol, 20 g/l soybean meal and 20 g/l agar powder.

According to some embodiments of the invention, the formulation of the MS solid medium is mannitol 20 g/l, soy flour 20 g/l, agar powder 20 g/l.

(2) Seed culture

According to certain embodiments of the invention, the inoculation includes direct inoculation by scraping or cutting off spores from a plate, liquid inoculation after washing spores from a plate, and the like.

According to some embodiments of the invention, the seed medium comprises apramycin in an amount of 60 to 120. mu.g/ml, such as 60 to 100. mu.g/ml, 60 to 80. mu.g/ml, 80 to 120. mu.g/ml, 80 to 100. mu.g/ml, or 100 to 120. mu.g/ml. According to certain embodiments of the invention, the seed medium comprises apramycin at 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 micrograms/ml.

According to some embodiments of the invention, the spores are cultured at 25-35 ℃, such as 25-32 ℃, 25-30 ℃, 25-28 ℃, 28-35 ℃, 28-32 ℃, 28-30 ℃, 30-35 ℃, 30-32 ℃ or 32-35 ℃. According to certain embodiments of the invention, the spores are cultured at 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃, 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃ or 35 ℃.

According to some embodiments of the invention, the spores are cultured for 36 to 72 hours, such as 36 to 60 hours, 36 to 48 hours, 48 to 72 hours, 48 to 60 hours, or 60 to 72 hours. According to certain embodiments of the invention, the spores are cultured for 36 hours, 40 hours, 44 hours, 48 hours, 52 hours, 56 hours, 60 hours, 64 hours, 68 hours, or 72 hours.

According to some embodiments of the invention, the culturing is shaking culture.

According to some embodiments of the invention, the rotational speed of the rocking platforms is 200 to 300 revolutions per minute, such as 200 to 280 revolutions per minute, 200 to 260 revolutions per minute, 200 to 240 revolutions per minute, 200 to 220 revolutions per minute, 220 to 300 revolutions per minute, 220 to 280 revolutions per minute, 220 to 260 revolutions per minute, 220 to 240 revolutions per minute, 240 to 300 revolutions per minute, 240 to 280 revolutions per minute, 240 to 260 revolutions per minute, 260 to 300 revolutions per minute, 260 to 280 revolutions per minute or 280 to 300 revolutions per minute. According to some embodiments of the invention, the rotational speed of the rocking platforms is 200 rpm, 210 rpm, 220 rpm, 230 rpm, 240 rpm, 250 rpm, 260 rpm, 270 rpm, 280 rpm, 290 rpm or 300 rpm. According to some embodiments of the invention, the rotational speed of the rocking platforms is 220 rpm.

According to some embodiments of the invention, spores are collected from the plate, inoculated into seed medium containing 80. mu.g/ml apramycin, and incubated at 30 ℃ for 72 hours.

Seed culture medium

According to some embodiments of the present invention, the formula of the seed culture medium comprises 10 to 100 g/L of glucose, 2 to 20 g/L of yeast powder, 2 to 20 g/L of ammonium sulfate, 1 to 20 g/L of sodium citrate, 0.1 to 2 g/L of dipotassium hydrogen phosphate, 0.5 to 5 g/L of monopotassium phosphate, 0.01 to 0.1 g/L of zinc sulfate heptahydrate, 0.1 to 2 g/L of magnesium sulfate heptahydrate, 0.01 to 0.1 g/L of ferrous sulfate heptahydrate, and pH5.5 to 7.0.

According to some embodiments of the invention, the formulation of the seed culture medium is: 10-100 g/L of glucose, 2-20 g/L of yeast powder, 2-20 g/L of ammonium sulfate, 1-20 g/L of sodium citrate, 0.1-2 g/L of dipotassium hydrogen phosphate, 0.5-5 g/L of potassium dihydrogen phosphate, 0.01-0.1 g/L of zinc sulfate heptahydrate, 0.1-2 g/L of magnesium sulfate heptahydrate, 0.01-0.1 g/L of ferrous sulfate heptahydrate, and pH of 5.5-7.0.

According to some embodiments of the invention, the seed medium comprises glucose 10-100 g/L, such as 10-80 g/L, 10-50 g/L, 10-30 g/L, 30-100 g/L, 30-80 g/L, 30-50 g/L, 50-100 g/L, 50-80 g/L or 80-100 g/L. According to certain embodiments of the invention, the seed medium comprises glucose 10 g/l, 20 g/l, 30 g/l, 40 g/l, 50 g/l, 60 g/l, 70 g/l, 80 g/l, 90 g/l or 100 g/l.

According to some embodiments of the present invention, the seed medium comprises 2-20 g/L yeast powder, such as 2-15 g/L, 2-10 g/L, 2-5 g/L, 5-20 g/L, 5-15 g/L, 5-10 g/L, 10-20 g/L, 10-15 g/L or 15-20 g/L. According to certain embodiments of the invention, the seed medium comprises yeast powder 2 g/l, 3 g/l, 4 g/l, 5 g/l, 6 g/l, 7 g/l, 8 g/l, 9 g/l, 10 g/l, 11 g/l, 12 g/l, 13 g/l, 14 g/l, 15 g/l, 16 g/l, 17 g/l, 18 g/l, 19 g/l or 20 g/l.

According to some embodiments of the invention, the seed medium comprises 2 to 20 g/L ammonium sulfate, such as 2 to 15 g/L, 2 to 10 g/L, 2 to 5 g/L, 5 to 20 g/L, 5 to 15 g/L, 5 to 10 g/L, 10 to 20 g/L, 10 to 15 g/L or 15 to 20 g/L. According to certain embodiments of the invention, the seed medium comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 grams/liter of ammonium sulfate.

According to some embodiments of the invention, the seed medium comprises 1 to 20 g/L sodium citrate, such as 1 to 15 g/L, 1 to 10 g/L, 1 to 5 g/L, 5 to 20 g/L, 5 to 15 g/L, 5 to 10 g/L, 10 to 20 g/L, 10 to 15 g/L or 15 to 20 g/L. According to certain embodiments of the invention, the seed medium comprises sodium citrate 1 g/l, 2 g/l, 3 g/l, 4 g/l, 5 g/l, 6 g/l, 7 g/l, 8 g/l, 9 g/l, 10 g/l, 11 g/l, 12 g/l, 13 g/l, 14 g/l, 15 g/l, 16 g/l, 17 g/l, 18 g/l, 19 g/l or 20 g/l.

According to some embodiments of the invention, the seed medium comprises dipotassium hydrogen phosphate 0.1-2 g/L, such as 0.1-1.5 g/L, 0.1-1 g/L, 0.1-0.5 g/L, 0.5-2 g/L, 0.5-1.5 g/L, 0.5-1 g/L, 1-2 g/L, 1-1.5 g/L, or 1.5-2 g/L. According to certain embodiments of the invention, the seed medium comprises dipotassium hydrogen phosphate 0.1 g/l, 0.2 g/l, 0.3 g/l, 0.4 g/l, 0.5 g/l, 0.6 g/l, 0.7 g/l, 0.8 g/l, 0.9 g/l, 1 g/l, 1.1 g/l, 1.2 g/l, 1.3 g/l, 1.4 g/l, 1.5 g/l, 1.6 g/l, 1.7 g/l, 1.8 g/l, 1.9 g/l or 2 g/l.

According to some embodiments of the present invention, the seed medium comprises monopotassium phosphate 0.5-5 g/L, such as 0.5-4 g/L, 0.5-3 g/L, 0.5-2 g/L, 0.5-1 g/L, 1-5 g/L, 1-4 g/L, 1-3 g/L, 1-2 g/L, 2-5 g/L, 2-4 g/L, 2-3 g/L, 3-5 g/L, 3-4 g/L, or 4-5 g/L. According to certain embodiments of the invention, the seed medium comprises monopotassium phosphate 0.5 g/l, 1 g/l, 1.5 g/l, 2 g/l, 2.5 g/l, 3 g/l, 3.5 g/l, 4 g/l, 4.5 g/l or 5 g/l.

According to some embodiments of the invention, the seed medium comprises zinc sulfate heptahydrate 0.01 to 0.1 g/l, such as 0.01 to 0.08 g/l, 0.01 to 0.05 g/l, 0.05 to 0.1 g/l, 0.05 to 0.08 g/l, or 0.08 to 0.1 g/l. According to certain embodiments of the invention, the seed medium comprises zinc sulfate heptahydrate 0.01 g/l, 0.02 g/l, 0.03 g/l, 0.04 g/l, 0.05 g/l, 0.06 g/l, 0.07 g/l, 0.08 g/l, 0.09 g/l, or 0.1 g/l.

According to some embodiments of the invention, the seed medium comprises magnesium sulfate heptahydrate in an amount of 0.1 to 2 g/L, such as 0.1 to 1.5 g/L, 0.1 to 1 g/L, 0.1 to 0.5 g/L, 0.5 to 2 g/L, 0.5 to 1.5 g/L, 0.5 to 1 g/L, 1 to 2 g/L, 1 to 1.5 g/L, or 1.5 to 2 g/L. According to certain embodiments of the invention, the seed medium comprises magnesium sulfate heptahydrate 0.1 g/l, 0.2 g/l, 0.3 g/l, 0.4 g/l, 0.5 g/l, 0.6 g/l, 0.7 g/l, 0.8 g/l, 0.9 g/l, 1 g/l, 1.1 g/l, 1.2 g/l, 1.3 g/l, 1.4 g/l, 1.5 g/l, 1.6 g/l, 1.7 g/l, 1.8 g/l, 1.9 g/l or 2 g/l.

According to some embodiments of the invention, the seed medium comprises ferrous sulfate heptahydrate 0.01 to 0.1 g/L, such as 0.01 to 0.08 g/L, 0.01 to 0.05 g/L, 0.05 to 0.1 g/L, 0.05 to 0.08 g/L, or 0.08 to 0.1 g/L. According to certain embodiments of the invention, the seed medium comprises 0.01 g/l, 0.02 g/l, 0.03 g/l, 0.04 g/l, 0.05 g/l, 0.06 g/l, 0.07 g/l, 0.08 g/l, 0.09 g/l, or 0.1 g/l ferrous sulfate heptahydrate.

According to some embodiments of the invention, the seed medium is pH 5.5-7.0, such as pH 5.5-6.5, pH 5.5-6.0, pH 6.0-7.0, pH 6.0-6.5 or pH 6.5-7.0. According to certain embodiments of the invention, the seed medium is pH5.5, pH 5.6, pH 5.7, pH 5.8, pH 5.9, pH6.0, pH 6.1, pH 6.2, pH6.3, pH 6.4, pH 6.5, pH 6.6, pH 6.7, pH 6.8, pH 6.9 or pH 7.0. According to certain embodiments of the invention, the seed medium is pH 6.0.

According to some embodiments of the invention, the seed medium formulation comprises glucose 50 g/l, yeast powder 5 g/l, ammonium sulfate 10 g/l, sodium citrate 5 g/l, dipotassium hydrogen phosphate 0.8 g/l, potassium dihydrogen phosphate 1.36 g/l, zinc sulfate heptahydrate 0.04 g/l, magnesium sulfate heptahydrate 0.5 g/l, ferrous sulfate heptahydrate 0.03 g/l, pH 6.0.

According to some embodiments of the invention, the seed medium is formulated with glucose 50 g/l, yeast powder 5 g/l, ammonium sulfate 10 g/l, sodium citrate 5 g/l, dipotassium hydrogen phosphate 0.8 g/l, potassium dihydrogen phosphate 1.36 g/l, zinc sulfate heptahydrate 0.04 g/l, magnesium sulfate heptahydrate 0.5 g/l, ferrous sulfate heptahydrate 0.03 g/l, pH 6.0.

(3) Fermentation culture

(3.1) Shake flask fermentation

According to some embodiments of the present invention, the shake flask fermentation is performed by inoculating the cultured seed culture solution into a conical flask containing a fermentation medium, culturing at 25-35 ℃ for 48-84 hours, and determining the yield of-P L in the fermentation broth.

According to some embodiments of the invention, the inoculation is at an amount of 5% to 20% (by volume).

According to certain embodiments of the invention, the inoculum size is 5% to 20% (by volume), such as 5% to 15% (by volume), 5% to 10% (by volume), 10% to 15% (by volume), 10% to 20% (by volume), or 15% to 20% (by volume). According to some embodiments of the invention, the inoculum is 5% (vol), 6% (vol), 7% (vol), 8% (vol), 9% (vol), 10% (vol), 11% (vol), 12% (vol), 13% (vol), 14% (vol), 15% (vol), 16% (vol), 17% (vol), 18% (vol), 19% (vol) or 20% (vol).

According to some embodiments of the invention, the temperature is 25 to 35 ℃, such as 25 to 32 ℃, 25 to 30 ℃, 25 to 28 ℃, 28 to 35 ℃, 28 to 32 ℃, 28 to 30 ℃, 30 to 35 ℃, 30 to 32 ℃ or 32 to 35 ℃. According to certain embodiments of the invention, the temperature is 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃, 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃ or 35 ℃.

According to some embodiments of the invention, the cultivation is shaking cultivation with a shaker at 200-300 rpm, such as 200-250 rpm or 250-300 rpm. For example, 200 to 280 rpm, 200 to 260 rpm, 200 to 240 rpm, 200 to 220 rpm, 220 to 300 rpm, 220 to 280 rpm, 220 to 260 rpm, 220 to 240 rpm, 240 to 300 rpm, 240 to 280 rpm, 240 to 260 rpm, 260 to 300 rpm, 260 to 280 rpm or 280 to 300 rpm. According to some embodiments of the invention, the culturing is shaking culturing at 200 rpm, 210 rpm, 220 rpm, 230 rpm, 240 rpm, 250 rpm, 260 rpm, 270 rpm, 280 rpm, 290 rpm or 300 rpm of the shaker. According to some embodiments of the invention, the culturing is shaking culturing at 220 rpm of the shaker.

According to some embodiments of the invention, the culturing is for 48 to 84 hours, such as 48 to 72 hours, 48 to 60 hours, 60 to 84 hours, 60 to 72 hours or 72 to 84 hours. According to certain embodiments of the invention, the culturing is for 48 hours, 52 hours, 56 hours, 60 hours, 64 hours, 68 hours, 72 hours, 76 hours, 80 hours, or 84 hours.

According to some embodiments of the present invention, the shake flask fermentation is performed by inoculating the cultured seed culture solution into a conical flask containing a fermentation medium, culturing at 30 ℃ for 72 hours, and determining the yield of-P L in the fermentation broth.

According to some embodiments of the invention, the inoculation is a 10% (volume by volume) inoculation.

According to some embodiments of the invention, the culturing is shaking culturing at 220 rpm of the shaker.

(3.2) fermentation in a fermenter

According to some embodiments of the invention, the fermentation in the fermentation tank is to inoculate the cultured seed culture solution to the fermentation tank filled with the fermentation culture medium for culture, the culture temperature is 25-35 ℃, dissolved oxygen is controlled to be 10% -100%, the aeration ratio is 1-5 vvm, when the pH value of the fermentation solution is reduced to 3.8-4.2, the pH value of the fermentation solution is maintained to be unchanged by using alkali, the concentration of a carbon source in the fermentation solution is monitored in the culture process, a fed-batch culture medium is fed when the concentration of the carbon source is 5-15 g/l, the feeding speed is adjusted by monitoring the concentration of the carbon source in the fermentation solution in a feedback manner, the yield of-P L in the fermentation solution is measured at intervals, and the total time of the fermentation culture is 36-144 hours.

According to certain embodiments of the invention, the inoculum size of the inoculation is 5% to 20% (by volume), such as 5% to 15% (by volume), 5% to 10% (by volume), 10% to 15% (by volume), 10% to 20% (by volume) or 15% to 20% (by volume). According to some embodiments of the invention, the inoculum is 5% (vol), 6% (vol), 7% (vol), 8% (vol), 9% (vol), 10% (vol), 11% (vol), 12% (vol), 13% (vol), 14% (vol), 15% (vol), 16% (vol), 17% (vol), 18% (vol), 19% (vol) or 20% (vol).

According to some embodiments of the invention, the method of controlling dissolved oxygen is by adjusting the fermenter agitator speed. According to some embodiments of the present invention, the dissolved oxygen is controlled by adjusting the stirring speed of the fermentation tank to 200-1200 rpm.

According to some embodiments of the present invention, the stirring speed of the fermentation tank is 200-1200 rpm, such as 200-1000 rpm, 200-800 rpm, 200-500 rpm, 500-1200 rpm, 500-1000 rpm, 500-800 rpm, 800-1200 rpm, 800-1000 rpm, or 1000-1200 rpm. According to some embodiments of the invention, the fermenter stirring speed is 200 rpm, 300 rpm, 400 rpm, 500 rpm, 600 rpm, 700 rpm, 800 rpm, 900 rpm, 1000 rpm, 1100 rpm or 1200 rpm.

According to certain embodiments of the invention, the dissolved oxygen is dissolved oxygen 10% to 100%, such as 10% to 80%, 10% to 50%, 10% to 30%, 30% to 100%, 30% to 80%, 30% to 50%, 50% to 100%, 50% to 80%, or 80% to 100%. According to certain embodiments of the invention, the dissolved oxygen is dissolved oxygen 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%.

According to some embodiments of the invention, the aeration ratio is between 1 and 5vvm, such as between 1 and 3vvm or between 3 and 5 vvm. According to some embodiments of the invention, the aeration ratio is an aeration ratio of 1vvm, 2vvm, 3vvm, 4vvm or 5 vvm.

According to certain embodiments of the invention, the pH of the fermentation broth is not controlled until the pH of the fermentation broth is reduced to 3.8 to 4.2.

According to some embodiments of the invention, the pH of the fermentation broth is naturally lowered to 3.8-4.2 when the pH is lowered to 3.8-4.2.

According to some embodiments of the invention, the pH is reduced to 3.8 to 4.2, such as 3.8 to 4.0 or 4.0 to 4.2. According to certain embodiments of the invention, the pH is reduced to 3.8, 3.9, 4.0, 4.1 or 4.2.

According to certain embodiments of the invention, the base is ammonia or sodium hydroxide.

According to some embodiments of the present invention, the carbon source concentration is 5 to 15 g/L, such as 5 to 12 g/L, 5 to 10 g/L, 5 to 8 g/L, 8 to 15 g/L, 8 to 12 g/L, 8 to 10 g/L, 10 to 15 g/L, 10 to 12 g/L, or 12 to 15 g/L. According to certain embodiments of the invention, the carbon source is fed-batch medium at a concentration of 5-15 g/l, for example at a concentration of 5 g/l, 6 g/l, 7 g/l, 8 g/l, 9 g/l, 10 g/l, 11 g/l, 12 g/l, 13 g/l, 14 g/l or 15 g/l.

According to some embodiments of the invention, the yield of-P L in the fermentation broth is measured at intervals of 4 to 12 hours, such as 4 to 10 hours, 4 to 8 hours, 4 to 6 hours, 6 to 12 hours, 6 to 10 hours, 6 to 8 hours, 8 to 12 hours, 8 to 10 hours, or 10 to 12 hours.

According to some embodiments of the invention, the total time of the fermentation culture is 36 to 144 hours, such as 36 to 120 hours, 36 to 96 hours, 36 to 72 hours, 36 to 48 hours, 48 to 144 hours, 48 to 120 hours, 48 to 96 hours, 48 to 72 hours, 72 to 144 hours, 72 to 120 hours, 72 to 96 hours, 96 to 144 hours, 96 to 120 hours or 120 to 144 hours. According to certain embodiments of the invention, the total time of the fermentation culture is 36 hours, 38 hours, 60 hours, 72 hours, 84 hours, 96 hours, 108 hours, 120 hours, 132 hours, or 144 hours.

According to some embodiments of the present invention, the fermentation in the fermentation tank is performed by inoculating the cultured seed culture solution into the fermentation tank filled with the fermentation culture medium, controlling the fermentation temperature in the fermentation tank to be 30 ℃, controlling the dissolved oxygen to be 30%, controlling the air introduction amount to be 3vvm, feeding ammonia water when the pH value of the fermentation solution is reduced to 4.0, controlling the pH value to be 4.0, feeding the supplementary culture medium into the fermentation solution when the glucose concentration in the fermentation solution is lower than 10 g/L, measuring the yield of-P L in the fermentation solution at intervals, and measuring the total fermentation time to be 96 hours.

According to some embodiments of the invention, the inoculation amount is 10% (volume ratio).

According to some embodiments of the invention, the production of-P L in the fermentation broth is measured at intervals of 6 hours.

Fermentation medium

According to some embodiments of the invention, the fermentation medium is formulated as: 40-100 g/L of carbon source, 2-20 g/L of nitrogen source, 1-20 g/L of citrate, 0.2-2 g/L of dipotassium hydrogen phosphate, 0.5-5 g/L of potassium dihydrogen phosphate, 0.01-0.1 g/L of zinc sulfate heptahydrate, 0.1-2 g/L of magnesium sulfate heptahydrate, 0.01-0.1 g/L of ferrous sulfate heptahydrate, and pH 5.5-7.0.

According to some embodiments of the invention, the fermentation medium comprises 40 to 100 g/L of the carbon source, such as 40 to 80 g/L, 40 to 60 g/L, 60 to 100 g/L, 60 to 80 g/L, or 80 to 100 g/L. According to certain embodiments of the invention, the fermentation medium comprises a carbon source of 40 g/l, 45 g/l, 50 g/l, 55 g/l, 60 g/l, 65 g/l, 70 g/l, 75 g/l, 80 g/l, 85 g/l, 90 g/l, 95 g/l or 100 g/l.

According to some embodiments of the invention, the fermentation medium comprises 2 to 20 g/L of the nitrogen source, such as 2 to 15 g/L, 2 to 10 g/L, 2 to 5 g/L, 5 to 20 g/L, 5 to 15 g/L, 5 to 10 g/L, 10 to 20 g/L, 10 to 15 g/L or 15 to 20 g/L. According to certain embodiments of the invention, the fermentation medium comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 g/l of an organic nitrogen source.

According to some embodiments of the invention, the fermentation medium comprises dipotassium hydrogen phosphate 0.2-2 g/L, such as 0.2-1.5 g/L, 0.2-1 g/L, 0.2-0.5 g/L, 0.5-2 g/L, 0.5-1.5 g/L, 0.5-1 g/L, 1-2 g/L, 1-1.5 g/L, or 1.5-2 g/L. According to certain embodiments of the invention, the fermentation medium comprises dipotassium hydrogen phosphate 0.2 g/l, 0.3 g/l, 0.4 g/l, 0.5 g/l, 0.6 g/l, 0.7 g/l, 0.8 g/l, 0.9 g/l, 1 g/l, 1.1 g/l, 1.2 g/l, 1.3 g/l, 1.4 g/l, 1.5 g/l, 1.6 g/l, 1.7 g/l, 1.8 g/l, 1.9 g/l or 2 g/l.

According to some embodiments of the invention, the fermentation medium comprises 0.5-5 g/L, such as 0.5-3 g/L, 0.5-1 g/L, 1-5 g/L, 1-3 g/L, or 3-5 g/L, monopotassium phosphate. According to certain embodiments of the invention, the fermentation medium comprises monopotassium phosphate 0.5 g/l, 1 g/l, 1.5 g/l, 2 g/l, 2.5 g/l, 3 g/l, 3.5 g/l, 4 g/l, 4.5 g/l or 5 g/l.

According to some embodiments of the invention, the fermentation medium comprises zinc sulfate heptahydrate 0.01 to 0.1 g/L, such as 0.01 to 0.08 g/L, 0.01 to 0.05 g/L, 0.05 to 0.1 g/L, 0.05 to 0.08 g/L, or 0.08 to 0.1 g/L. According to certain embodiments of the invention, the fermentation medium comprises zinc sulfate heptahydrate 0.01 g/l, 0.02 g/l, 0.03 g/l, 0.04 g/l, 0.05 g/l, 0.06 g/l, 0.07 g/l, 0.08 g/l, 0.09 g/l, or 0.1 g/l.

According to some embodiments of the invention, the fermentation medium comprises magnesium sulfate heptahydrate in an amount of 0.1 to 2 g/L, such as 0.1 to 1.5 g/L, 0.1 to 1 g/L, 0.1 to 0.5 g/L, 0.5 to 2 g/L, 0.5 to 1.5 g/L, 0.5 to 1 g/L, 1 to 2 g/L, 1 to 1.5 g/L, or 1.5 to 2 g/L. According to certain embodiments of the invention, the fermentation medium comprises magnesium sulfate heptahydrate 0.1 g/l, 0.2 g/l, 0.3 g/l, 0.4 g/l, 0.5 g/l, 0.6 g/l, 0.7 g/l, 0.8 g/l, 0.9 g/l, 1 g/l, 1.1 g/l, 1.2 g/l, 1.3 g/l, 1.4 g/l, 1.5 g/l, 1.6 g/l, 1.7 g/l, 1.8 g/l, 1.9 g/l or 2 g/l.

According to certain embodiments of the invention, the fermentation medium comprises 0.01 to 0.1 g/L, such as 0.01 to 0.08 g/L, 0.01 to 0.05 g/L, 0.05 to 0.1 g/L, 0.05 to 0.08 g/L, or 0.08 to 0.1 g/L, of ferrous sulfate heptahydrate. According to certain embodiments of the invention, the fermentation medium comprises 0.01 g/l, 0.02 g/l, 0.03 g/l, 0.04 g/l, 0.05 g/l, 0.06 g/l, 0.07 g/l, 0.08 g/l, 0.09 g/l, or 0.1 g/l of ferrous sulfate heptahydrate.

According to certain embodiments of the invention, the fermentation medium formulation comprises glucose 25 g/l, glycerol 25 g/l, soy peptide 5 g/l, ammonium sulfate 10 g/l, sodium citrate 5 g/l, dipotassium phosphate 0.8 g/l, potassium dihydrogen phosphate 1.36 g/l, zinc sulfate heptahydrate 0.04 g/l, magnesium sulfate heptahydrate 0.5 g/l, ferrous sulfate heptahydrate 0.03 g/l, ph 6.0.

According to some embodiments of the invention, the fermentation medium is formulated with glucose 25 g/l, glycerol 25 g/l, soy peptide 5 g/l, ammonium sulfate 10 g/l, sodium citrate 5 g/l, dipotassium phosphate 0.8 g/l, potassium dihydrogen phosphate 1.36 g/l, zinc sulfate heptahydrate 0.04 g/l, magnesium sulfate heptahydrate 0.5 g/l, ferrous sulfate heptahydrate 0.03 g/l, ph 6.0.

According to certain embodiments of the invention, the carbon source in the fermentation medium is one or more combinations of glucose, glycerol, xylose, fructose, mannitol. According to certain embodiments of the invention, the carbon sources may be combined in any ratio in the fermentation medium.

According to certain embodiments of the invention, the nitrogen source in the fermentation medium is an organic nitrogen source, an inorganic nitrogen source, or a combination of both. According to certain embodiments of the present invention, the organic nitrogen source or the inorganic nitrogen source may be combined in any ratio in the fermentation medium.

According to some embodiments of the invention, the organic nitrogen source in the fermentation medium is one or more of yeast powder, soy peptone, corn steep liquor, peanut meal, and peptone. According to certain embodiments of the invention, the organic nitrogen source may be combined in any proportion in the fermentation medium.

According to some embodiments of the invention, the inorganic nitrogen source is in particular one or more combinations of ammonium sulfate, ammonium chloride, urea, ammonium nitrate in the fermentation medium. According to certain embodiments of the invention, the nitrogen sources may be combined in any proportion in the fermentation medium.

According to some embodiments of the invention, the nitrogen source in the fermentation medium is one or more of ammonium sulfate, ammonium chloride, urea, ammonium nitrate, yeast powder, soy peptone, corn steep liquor, peanut meal, peptone, and combinations thereof. According to certain embodiments of the invention, the nitrogen sources may be combined in any proportion in the fermentation medium.

According to certain embodiments of the invention, the citrate salt in the fermentation medium is one or more combinations of sodium citrate, ammonium citrate, potassium citrate, zinc citrate, calcium citrate, magnesium citrate, sodium dihydrogen citrate, potassium dihydrogen citrate, sodium potassium citrate, ferric citrate, diammonium hydrogen citrate. According to certain embodiments of the invention, the citrate may be combined in any ratio in the fermentation medium.

Supplementary culture medium

The feed medium comprises 0-600 g/L of carbon source, 20-200 g/L of nitrogen source and 10-100 g/L of citrate.

According to some embodiments of the present invention, the feed medium comprises 0 to 600 g/L of the carbon source, such as 0 to 500 g/L, 0 to 400 g/L, 0 to 300 g/L, 0 to 200 g/L, 0 to 100 g/L, 100 to 600 g/L, 100 to 500 g/L, 100 to 400 g/L, 100 to 300 g/L, 100 to 200 g/L, 200 to 600 g/L, 200 to 500 g/L, 200 to 400 g/L, 200 to 300 g/L, 300 to 600 g/L, 300 to 500 g/L, 300 to 400 g/L, 400 to 600 g/L, 400 to 500 g/L, or 500 to 600 g/L. According to certain embodiments of the invention, the feed medium comprises a carbon source of 10 g/l, 50 g/l, 100 g/l, 150 g/l, 200 g/l, 250 g/l, 300 g/l, 350 g/l, 400 g/l, 450 g/l, 500 g/l, 550 g/l or 600 g/l.

According to some embodiments of the invention, the feed medium comprises 20 to 200 g/l, such as 20 to 150 g/l, 20 to 100 g/l, 20 to 50 g/l, 50 to 200 g/l, 50 to 150 g/l, 50 to 100 g/l, 100 to 200 g/l, 100 to 150 g/l or 150 to 200 g/l, of the nitrogen source. According to certain embodiments of the invention, the feed medium comprises a nitrogen source of 20 g/l, 30 g/l, 40 g/l, 50 g/l, 60 g/l, 70 g/l, 80 g/l, 90 g/l, 100 g/l, 110 g/l, 120 g/l, 130 g/l, 140 g/l, 150 g/l, 160 g/l, 170 g/l, 180 g/l, 190 g/l or 200 g/l.

According to some embodiments of the invention, the feed medium comprises glucose 0-600 g/L, glycerol 0-600 g/L, ammonium sulfate 20-200 g/L, and sodium citrate 10-100 g/L.

According to some embodiments of the invention, the feed medium has the composition glucose 250 g/l, glycerol 250 g/l, ammonium sulphate 100 g/l, sodium citrate 50 g/l.

According to certain embodiments of the invention, the carbon source in the feed medium is one or more combinations of glucose, glycerol, xylose, fructose, mannitol. According to certain embodiments of the invention, the carbon sources may be combined in any ratio in the feed medium.

According to some embodiments of the invention, the nitrogen source in the feed medium is an organic nitrogen source, an inorganic nitrogen source, or a combination of both. According to certain embodiments of the present invention, the organic nitrogen source or the inorganic nitrogen source may be combined in any ratio in the fermentation medium. According to some embodiments of the invention, the organic nitrogen source in the feed medium is one or more combinations of yeast powder, soy peptone, corn steep liquor, peanut meal, peptone. According to certain embodiments of the invention, the organic nitrogen sources may be combined in any ratio in the feed medium.

According to some embodiments of the invention, the inorganic nitrogen source is in particular one or more combinations of ammonium sulfate, ammonium chloride, urea, ammonium nitrate in the feed medium. According to certain embodiments of the invention, the inorganic nitrogen sources may be combined in any ratio in the feed medium.

According to some embodiments of the invention, the nitrogen source in the feed medium is one or more combinations of ammonium sulfate, ammonium chloride, urea, ammonium nitrate, yeast powder, soy peptone, corn steep liquor, peanut meal, peptone. According to certain embodiments of the invention, the nitrogen sources may be combined in any ratio in the feed medium.

According to certain embodiments of the invention, the citrate salt in the feed medium is one or more combinations of sodium citrate, ammonium citrate, potassium citrate, zinc citrate, calcium citrate, magnesium citrate, sodium dihydrogen citrate, potassium dihydrogen citrate, sodium potassium citrate, ferric citrate, diammonium hydrogen citrate. According to certain embodiments of the invention, the citrate may be combined in any ratio in the feed medium.

According to certain embodiments of the invention, the carbon source in the feed medium is the same as the carbon source in the fermentation medium. According to some embodiments of the invention, the nitrogen source in the feed medium is the same as the nitrogen source in the fermentation medium. According to some embodiments of the invention, the citrate in the feed medium is the same as the citrate in the fermentation medium.

Determination of-P L

According to certain embodiments of the invention, the concentration of-P L in the fermentation broth is determined during fermentation.

According to certain embodiments of the invention, the concentration of-P L in the fermentation broth is determined using the Dragendorff's method, the Itzhaki methyl orange colorimetry, or liquid chromatography.

According to certain embodiments of the present invention, the concentration of-P L in the fermentation broth is determined using the Dragendorff's method according to certain embodiments of the present invention, the concentration of-P L in the fermentation broth is determined using the Itzhaki methyl orange colorimetry.

According to certain embodiments of the invention, the Dragendorff's method comprises the steps of accurately aspirating 500 microliters of a-P L sample into a 2 milliliter centrifuge tube, adding 500 microliters of DR reagent, shaking to form a precipitate, centrifuging at 7000 rpm for 10 minutes, discarding the supernatant, washing the precipitate with 1 milliliter of absolute ethanol, centrifuging at 7000 rpm for 10 minutes, discarding the supernatant, adding 1 milliliter of 1% Na₂S solution, generating black precipitate, centrifuging at 12000 r/min for 10 min, discarding the supernatant, adding 1 ml of concentrated nitric acid into the precipitate, after 20 min, after the precipitate is dissolved, diluting to 5 ml with deionized water, taking out 100. mu.l, adding 500. mu.l of 3% thiourea solution, adding thiourea into 20% nitric acid solution as blank, and measuring the absorbance value at 435 nm. The preparation method of the DR reagent comprises the following steps: 0.8 g of bismuth nitrate pentahydrate is weighed and dissolved in 50 ml of 20 percent iceAcetic acid was then mixed with 20 ml of 40% aqueous potassium iodide solution.p L standard solutions were prepared with deionized water to give concentration gradients of 0, 0.2, 0.4, 0.6, 1.2 and 1.5 g/l.the standard curve equation was y 9.0826x-0.3491, where y is the concentration of-P L (g/l) and x is the absorbance at 435 nm.

According to some embodiments of the invention, the Itzhaki methyl orange colorimetric method comprises the steps of diluting the fermentation supernatant with 0.1 mmol/l phosphate buffer solution, mixing 2 ml of the diluted solution with 2 ml of 1 mmol/l methyl orange solution, shaking in a shaker at 30 ℃ for 30 minutes, centrifuging at 5000 rpm for 15 minutes, precipitating, diluting 0.5 ml of the supernatant to 10 ml, measuring the absorbance at 465nm, and calculating the-P L content, -P L standard solution according to a standard curve equation where y is 0.1956-0.3125x, where y is the-P L concentration (g/l) and x is the absorbance at 465nm, using 0.1 mmol/l phosphate buffer solution to prepare a concentration gradient of 0, 0.02, 0.04, 0.06, 0.08 and 0.1 g/l.

According to some embodiments of the invention, the liquid chromatography comprises the steps of treating the fermentation supernatant and measuring it with a Thermo Ultimate 3000 liquid chromatograph equipped with a C18 reverse phase column Tskgel ODS-120T (4.6mm × 250mm, Tosho Inc., Japan), the mobile phase being 0.1% phosphoric acid, the flow rate being 0.4 ml/min, the column temperature being 30 ℃ and the detection wavelength being 215nm, and calculating the concentration of-P L in the fermentation sample from the ratio of the-P L peak area in the standard and the fermentation sample.

Determination of the concentration of carbon sources

According to certain embodiments of the invention, the concentration of the carbon source in the fermentation broth is determined during fermentation.

According to certain embodiments of the invention, the concentration of the carbon source in the fermentation broth is determined using liquid chromatography.

According to some embodiments of the invention, the determination of the concentration of the carbon source in the fermentation broth by liquid chromatography comprises the steps of treating the fermentation supernatant and determining it by using a Thermo Ultimate 3000 liquid chromatograph equipped with an ion exchange column Aminex HPX-87H (7.8mm × 300mm, Bio-rad, USA), with a mobile phase of 5 mmol/l sulfuric acid, a flow rate of 0.6 ml/min, a column temperature of 60 ℃, a differential refractometer as the detector used, and calculating the concentration of the carbon source in the fermentation sample from the ratio of the peak areas of the carbon source in the standard and the fermentation sample.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

When "about" is used in this application to modify a numerical value, it is meant that the numerical value may fluctuate within a range of ± 10%, ± 9%, ± 8%, ± 7%, ± 6%, ± 5%, ± 4%, ± 3%, ± 2% or ± 1%.

The use of the terms "a" and "an" and "the" and similar referents in the context of describing the application (including the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" as used herein are to be construed as open-ended terms (i.e., "including, but not limited to") unless otherwise indicated herein or otherwise clearly contradicted by context. All methods described herein can be performed in any suitable order, as understood by those skilled in the art, unless otherwise indicated herein or otherwise clearly contradicted by context.

All patents, patent applications, and references cited in this application are incorporated by reference into this application in their entirety to the same extent as if each individual reference were individually incorporated by reference. In the event of a conflict between the present application and the references provided herein, the present application shall control.

Drawings

FIG. 1 is a schematic representation of the recombinant vector pSET152-pro-pls for overexpression of the-P L synthetase gene integrated into the genome of S.parvulus Q-P L;

FIG. 2 shows the differential expression multiple of-P L synthetase gene of Streptomyces albus genetically engineered bacterium Q-P L2 and wild bacterium Q-P L in different fermentation periods;

FIG. 3 is a graph comparing the improvement of sodium citrate in the production capacity of P L by genetically engineered bacteria Q-P L2 of Streptomyces albus and wild bacteria Q-P L;

FIG. 4 is the effect of sodium citrate concentration on the production capacity of P L by Streptomyces albus genetically engineered bacterium Q-P L2;

FIG. 5 is a diagram comparing the shake flask fermentation production of P L by the genetically engineered Streptomyces albus strain Q-P L2 with the wild strain Q-P L;

FIG. 6 is the concentration variation curve of fermentation tank production-P L of Streptomyces albus genetically engineered bacterium Q-P L2.

Detailed Description

The following examples are given for the detailed implementation and specific operation of the present invention, but the scope of the present invention is not limited to the following examples.

Example 1

Bacterial strains and plasmids used and involved in the experiments of the invention

1. Streptomyces albus (Streptomyces albulus) Q-P L (wild strain selected from soil sample collected from Binzhou medical college in Lymountain area, Tai city, Shandong province)

2. Escherichia coli (Escherichia coli) ET12567/pUZ8002 (Joint transfer donor bacteria, Paget ET al, J Bacteriol, 1999,181:204-

3. Escherichia coli (Escherichia coli) Top10 (purchased from Invitrogen, cat # C404006)

4. pSET152 (Streptomyces genomic integration plasmid, apramycin resistance, Flett et al, FEMSMiicrobiol L ett, 1997, 155:223-

5. pSET152-pro-pls (apramycin resistance, plasmid for overexpression of P L synthetase constructed according to the invention)

6. Streptomyces albus Q-P L2 (obtained by integrating plasmid pSET152-pro-pls into Streptomyces albus Q-P L genome and capable of over-expressing-P L synthetase), and high-yield-P L gene engineering strain constructed by the invention)

Example 2

Gene engineering strain streptomyces albidoides (Stre)ptomyces albulus) Q-P L2 construction

1. Cloning and vector construction of streptomyces albidoflavus strong promoter, ribosome binding site and-P L synthetase gene

Annealing with primers pro1, pro2 and pro3 resulted in strong promoter kasOp and ribosome binding site DNA fragments, the sequences of the primers are as follows:

pro1:gccaagcttgggctgcaggtcgactctagatgttcacattcgaacggtctctgctttg

pro2:tgttcacattcgaacggtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggccaggagaata

pro3:atggacactccttacttagatctagtattctcctggccacgactttacaacaccgcacagcatgtt

the genome of Streptomyces albus (Streptomyces albulus) Q-P L is used as a template, primers pls-F and pls-R are used for amplifying a-P L synthetase gene, the PCR reaction conditions are that the temperature is 94 ℃ for 30s, the temperature is 55 ℃ for 30s, the temperature is 72 ℃ for 2min, and 30 cycles are repeated, the primer sequence is as follows:

pls-F:tactagatctaagtaaggagtgtccatatgtcgtcgccccttctcgaatcgtccttc

pls-R:caggaaacagctatgacatgattacgaattctcacgcggccgcacctccctccgcgcg

the obtained strong promoter kasOp, the ribosome binding site DNA fragment and the-P L synthetase gene fragment are mixed to be used as a template, and overlapping PCR reaction is carried out by using primers pro1 and pls-R to obtain a complete expression element containing the strong promoter, the ribosome binding site and the-P L synthetase gene, wherein the PCR reaction condition is that the temperature is 94 ℃ for 30s, the temperature is 55 ℃ for 30s, the temperature is 72 ℃ for 2min, 30 cycles are repeated, the DNA fragment of the expression element is transformed into Escherichia coli (Escherichia coli) Top10 after carrying out Gibson ligation reaction with a vector pSET152 which is subjected to double digestion by XbaI and EcoRI, correctly-ligated transformants are screened and sequenced and verified to obtain a recombinant overexpression plasmid, wherein the plasmid is named pSET152-pro-pls, and the plasmid map of the recombinant overexpression plasmid is shown in figure 1.

2. Transformation of streptomyces albus by recombinant plasmid

The recombinant plasmid pSET152-pro-pls is firstly transferred into Escherichia coli (Escherichia coli) ET12567/pUZ8002, and then the pSET152-pro-pls is introduced into Streptomyces albulus Q-P L by utilizing a conjugative transfer method.

The specific steps of conjugation transfer are that a single colony of donor bacterium Escherichia coli (Escherichia coli) ET12567/pUZ8002 is picked up in L B medium containing 50 microgram/ml kanamycin, 50 microgram/ml chloramphenicol and 50 microgram/ml apramycin, the thallus is collected at 37 ℃ when OD600 is 0.6, the thallus is washed 3 times with fresh L B medium, finally 200 microliter L B is used after resuspension, white streptomycete spores are suspended in 400 microliter 2 × YT medium (tryptone 16 g/l, yeast powder 10 g/l, sodium chloride 5 g/l), water bath is carried out at 50 ℃ for 10 minutes, the white streptomycete spores are mixed with the prepared donor bacterium after cooling to room temperature, shaking (100 rpm) is carried out for 1 hour at 30 ℃, centrifugation is carried out, partial supernatant is removed, the supernatant is coated on MS solid medium (mannitol 20 g/l, soybean powder 20 g/l, agar powder 20 g/l) after cooling to room temperature, the bacterial strain is cultured with streptomycin 2 ml _ 2 micro streptomycin/ml _ streptomycin containing 10 ml _ 2 g/ml heat shock gene, and the bacterial strain is obtained after 14 hours, and the bacterial strain is cultured for 2 ml _ 2 days.

3. Verification of the expression level of the P L synthetase Gene

A real-time fluorescent quantitative PCR method is adopted to verify the difference of the expression levels of synthetase genes-P L in a genetically engineered strain streptomyces albidoflauvs Q-P L2 and a wild strain streptomyces albidoflauvs Q-P L, and the method comprises the following specific steps of taking out two strains from a refrigerator at the temperature of-80 ℃, respectively inoculating the two strains to an MS solid culture medium for activation, collecting spores after 5-6 days, respectively inoculating 200 microliters of the two strains to a conical flask filled with 50 milliliters of seed culture medium, respectively taking 1 milliliter of bacteria when the strains are cultured for 12 hours, 24 hours, 36 hours, 48 hours and 60 hours, and centrifugally collecting the bacteria at low temperature for RNA extraction.

The components of the seed culture medium are 50 g/L of glucose, 5 g/L of yeast powder, 10 g/L of ammonium sulfate, 5 g/L of sodium citrate, 0.8 g/L of dipotassium hydrogen phosphate, 1.36 g/L of potassium dihydrogen phosphate, 0.04 g/L of zinc sulfate heptahydrate, 0.5 g/L of magnesium sulfate heptahydrate, 0.03 g/L of ferrous sulfate heptahydrate and pH 6.0.

Total RNA of two strains was extracted using a bacterial total RNA extraction kit (Tiangen, cat # DP430) and reverse-transcribed using EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix (all-open gold, cat # AE311-02)To the cDNA, real-time fluorescent quantitative PCR reaction was carried out using QuantiNova SYBR Green PCR kit (Qiagen, cat # 208054) under the following conditions: 5s at 95 ℃, 10s at 60 ℃ and 40 cycles. RNA polymerase sigma factor gene (hrdB) is used as an internal reference gene according to the proportion of 2^-ΔΔCtThe fold difference in the expression level of the-P L synthetase gene in the two strains was calculated relatively quantitatively.

Wherein, the primer sequences of the genes for amplifying the-P L synthetase are as follows:

RT-LS1：GCGAGATGTGGAACACCTACGG

RT-LS2：GCGAGCTGCCAGCCCTTCA

the primer sequences for amplifying the reference gene hrdB are as follows:

RT-HrdB1：CTGACCAGATTCCGCCAACCC

RT-HrdB2：GCCTCTGCGGCACTGACCAT

the real-time fluorescent quantitative PCR results are shown in figure 2, wherein the expression levels of-P L synthetase gene in the genetic engineering strain Streptomyces albus Q-P L2 at 12, 24, 36, 48 and 60 hours are about 1320.5, 28.0, 14.6, 17.9 and 4.6 times of that in the wild strain Streptomyces albus Q-P L at the same time point.

Therefore, the gene engineering strain of the streptomyces albidoflauvs Q-P L2 adopts a constitutive promoter, so that the gene engineering strain expresses the-P L synthetase gene at high level from the beginning, and therefore, the gene engineering strain of the streptomyces albidoflauvs Q-P L2 can express the-P L synthetase gene at high efficiency in a short time.

Example 3

Influence of sodium citrate on capability of producing-P L by fermenting streptomyces albidoflauvs genetic engineering strain Q-P L2 and wild strain Q-P L Sound box

The method comprises the steps of streaking streptomyces albidoidis Q-P L2 and Q-P L onto an MS solid culture medium, culturing for 5-6 days at 30 ℃, collecting spores from a plate after black spores grow on the surface of the culture medium, inoculating the spores into a conical flask filled with 50 ml of seed culture medium, performing shaking culture on a shaking table at 30 ℃ and 220 rpm for 48 hours to obtain a seed solution, inoculating the cultured seed culture solution into the conical flask filled with a fermentation culture medium according to the inoculation amount of 10 percent (volume ratio), and measuring the yield of-P L obtained by fermentation of the two culture media after performing shaking culture on the conical flask at 30 ℃ and 220 rpm for 72 hours, wherein the results are shown in figure 3.

The components of the fermentation medium are 50 g/L glucose, 5 g/L yeast powder, 10 g/L ammonium sulfate, 0 g/L or 2 g/L sodium citrate, 0.8 g/L dipotassium hydrogen phosphate, 1.36 g/L potassium dihydrogen phosphate, 0.04 g/L zinc sulfate heptahydrate, 0.5 g/L magnesium sulfate heptahydrate, 0.03 g/L ferrous sulfate heptahydrate and pH 6.7.

The results in FIG. 3 show that the addition of sodium citrate increases the yield of P L produced by the genetically engineered strain Q-P L2 from 0.85 g/L to 1.81 g/L with a growth rate of 113.5%, while the yield of P L produced by the wild strain Q-P L increases from 0.45 g/L to 0.58 g/L with a growth rate of only 28.8%.

Therefore, the improvement of the capacity of the sodium citrate for producing the-P L by fermenting the streptomyces albidoflauvs genetic engineering strain Q-P L2 is obviously higher than that of the wild strain Q-P L, and the sodium citrate can form a synergistic effect with the overexpression of a-P L synthetase gene.

Example 4

Influence of sodium citrate concentration on capability of Streptomyces albus genetically engineered bacterium Q-P L2 to produce-P L

Streptomyces albus Q-P L2 was cultured as described in example 3, except that the fermentation medium contained sodium citrate at various concentrations, and the other components were the same, the sodium citrate concentrations used in the examples were 0 g/L, 2.5 g/L, 5 g/L, 10 g/L, and 15 g/L, respectively, and the yield of-P L was measured after 72 hours of fermentation, and the results are shown in FIG. 4.

The results in FIG. 4 show that the yield of P L increases gradually with increasing sodium citrate concentration below 5 g/l, but that the yield of P L decreases again when the sodium citrate concentration exceeds 5 g/l, so that the optimum amount of sodium citrate is 5 g/l.

Example 5

Comparison of capabilities of Streptomyces albus genetic engineering strain Q-P L2 and wild strain Q-P L for producing-P L by shake flask fermentation

Streptomyces lividans Q-P L2 and Q-P L were cultured as described in example 3, respectively, except that the fermentation medium contained 2 g/L ammonium citrate and the other components were the same, shaking and culturing at 30 ℃ for 84 hours at 220 rpm, and the yield of-P L in the fermentation broth was measured every 12 hours, as shown in FIG. 5.

The results in FIG. 5 show that the ability of the genetically engineered strain Q-P L2 to produce-P L by fermentation is obviously stronger than that of the wild strain Q-P L, the yield of the genetically engineered strain Q-P L reaches 2.04 g/L and the yield of the genetically engineered strain Q-P L2 reaches only 0.57 g/L after fermentation for 72 hours, and the ability of the genetically engineered strain Q-P L to produce-P L by fermentation is 3.58 times that of the wild strain Q-P L.

Example 6

Streptomyces albus gene engineering strain Q-P L2 fermentation tank production-P L

The method comprises the steps of streaking streptomyces albidoflavus Q-P L2 to an MS solid culture medium, culturing for 5-6 days at 30 ℃, collecting spores from a flat plate after black spores grow on the surface of the culture medium, inoculating the spores to a conical flask filled with 50 ml of seed culture medium, carrying out shaking culture on a shaking table at 30 ℃ at 220 rpm for 48 hours to obtain seed liquid, and inoculating the cultured seed culture liquid to a fermentation tank filled with a fermentation culture medium according to the inoculation amount of 10% (volume ratio).

The fermentation medium comprises 25 g/L of glucose, 25 g/L of glycerol, 5 g/L of soybean peptide, 10 g/L of ammonium sulfate, 5 g/L of sodium citrate, 0.8 g/L of dipotassium phosphate, 1.36 g/L of potassium dihydrogen phosphate, 0.04 g/L of zinc sulfate heptahydrate, 0.5 g/L of magnesium sulfate heptahydrate, 0.03 g/L of ferrous sulfate heptahydrate and pH 6.0.

Controlling the fermentation temperature of a fermentation tank to be 30 ℃, controlling the air introduction amount to be 3vvm, controlling the dissolved oxygen to be more than 30% by adjusting the stirring speed to be 200-1200 rpm, not controlling the pH in the early stage of fermentation, feeding ammonia water when the pH value of a fermentation solution is reduced to 4.0 to control the pH to be 4.0, feeding a feed culture medium into the fermentation solution when the concentration of glucose in the fermentation solution is lower than 10 g/L, wherein the feed culture medium comprises 250 g/L of glucose, 250 g/L of glycerol, 100 g/L of ammonium sulfate and 50 g/L of sodium citrate, measuring the yield of-P L in the fermentation solution every several hours, and the fermentation result is shown in figure 6.

The results of FIG. 6 show that the Streptomyces albus genetically engineered bacterium Q-P L2 can produce 42.9 g/L-P L in 88 hours, the production rate reaches 11.7 g/L/day, and the production rate is obviously higher than that of 3-5 g/L/day in the prior art.

The invention discloses a genetically engineered Streptomyces albus (Streptomyces albulus) Q-P L2 strain, wherein the fermentation production capacity of the strain to produce-P L is 2-5 times of that of a wild strain of the Streptomyces albus, and by applying the Streptomyces albus and a special fermentation method thereof, the yield of-P L in 88 hours reaches 42.9 g/l, and the production rate reaches 11.7 g/l/day.

The embodiments of the present application are exemplarily described above with reference to the drawings. Those skilled in the art can easily conceive of the disclosure of the present specification that various embodiments can be appropriately modified and recombined according to actual needs without departing from the spirit of the present application. The protection scope of this application is subject to the claims of this application.

Sequence listing

<110> Binzhou medical college

<120> Streptomyces albus genetic engineering bacterium and application thereof in polylysine production

<160>2

<210>1

<211>96

<212>DNA

<213> Streptomyces albus (Streptomyces albulus)

<221> promoter kasOp and ribosome binding site sequence

<400>1

tgttcacattcgaacggtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggccaggagaataCTAGAtctaagtaagg agtgtccat

<210>2

<211>3960

<212>DNA

<213> Streptomyces albus (Streptomyces albulus)

<221> pls Gene

<400>2

Atgtcgtcgccccttctcgaatcgtccttcgagccgtccgagccagcgccccaacaggccctgtaccgcaccgccggcaacccgg ccccgcggaccctgctcgacgtgctcgatgccaccgccgccgcacatccccaggcgatcgccctggacacgggctccgaggcgct cacctaccgcgacctgtgtatcgagatcgaacgccgcgcacggcagctcagggaccgcggcatcggtcccggcgaccgggtcgga gtccgcgtcccctccgggaccgccgagctgtacctgtccatcctcgccgtcctgcgcagcggagcggcctacgtgccggtcgacg ccgacgaccccgacgagcgggccgccaccgtcttccgcgaggccgccgtctgcgccgtcctcggccccgacggcccgctgcccgg cccggcccggcccctcggcgacccgcgttccgcgggcccccaggacgacgcctggatcatcttcacctcgggttcgaccggcgcg cccaagggcgtggcggtcagccaccgctccgccgccgccttcgtcgacgccgaggccgacctgttctgccaggaccagccgttgggccccggcgaccgggtgctggccgggctgtccgtcgccttcgacgcctcctgcgaggagatgtggctcgcctggcggtacggcgc ctgcctggtgcccgcaccccgcgcgctggtccgggccggccacgaactcggcccctggctcgtcgagcgcggcatcaccgtcgtc tccaccgtgcccaccctcgccgcgctctggccggacgaggcgatgcgccgggtccgcctgctgatcgtcggcggcgaatcctgcc cggccgggctcgtcgaccgcttcgccggacccggccgcgagatgtggaacacctacggcccgaccgagaccaccgtcgtcgcctg cgccgcccgcctgctgccgggcgagccggtccgcatcggcctgcccctgaagggctggcagctcgccgtcgtcgaccgcaccggg cagccggtgcccttcggcgccgagggcgaactgctgatcagcggcgtcggcacggcccgctacctcgaccccgccaaggacgccg aacggttccggcccgacgacgccctgggggccgcccgcgtctaccgcaccggcgacctggtccgggccgaacccgagggcctgct cttcgtcggccgcgccgacgaccagatcaaactcggcggccgccgcatcgagctgggcgagatcgacgccgccctggccgccctg cccggcgtccgcggggccgccgcggccgtccagacgacgccggccggcacccaggtgctggtcggctacgtcgttcccgagcagc gcaccgccgacggttccagcttccagcaggacaaggcccgcgcactgctccaggaacgcctgcccgcgcagttggtcccggtcct cgcggaggtcgagtccctgcccacccggacctccggcaaggtcgaccgcaaggcgctgccctggccgctgccgtccgccccggtc gactccgccaccggcgatccggccacggcgctggacggcaccgccgcccggctcgccgggatctgggaggaactcctcggcgtcc ggcccggcccggacagcgacttcgtctccctcggcggcaccagcctggtcgccgcccgcatggcgtcccagctccgcatccacca ccccggcgtctcggtcgccgacctctaccgccacccggtgctgcgcgacatggccgagcacctcgactcgctgggcggcccggtg gacgaggtccgcccggtccgccccgtcccgcgccgcaccggattcgtccaactcctcgtccagaccggcctgtacggcatcgccg gcctgcgcggactggtcgggctcgcgctcgcggacaacgtcctcggcctgctcgccccgcaggtctgggccccgcacaccgcgtg gtggctgatcatcgtcggctgggtggtgctctacagcgccccgatgcgttgcgccctcggcgcactggccgcccgcgcgctcgcc ggcaccatcaagcccggcgcctacccgcgcggcggcgccacccacctgcgcctgtggaccgccgaacgcgtcgtcgccgccttcg gcgtcccctccctgctcggcaccccctgggcgcggctctacgcccggagcctgggctgcgccacagggcggaacgtggcgctgca caccatgccgccggtcaccggcctcgccgaactcggcgacggctgcagcgtcgaacccgaggccgacatctccggctggtggctc gacggcgacaccctgcacatcggcgcggtccggatcggcgccggcgcccgggtcgcccaccgcagcatgctgatgcccggcgccg tcgtcggccagggcgccgaactcgcctccggcgcctgcctggacggagagatccccgacggcgcctcgtggtccggctccccggc ccgcccggccggcgccgccgagcggatggccggcgccgcctggcccgcccccgcctggcagcgctcgcgccgctggagcgccgcctacggactgaccctgctgggcctgccgctgctggccctgctgtccaccgcgcccgccctggtcggcgcgtacttcctgctccgcg acagcggcaccctcgccacagccgggcttcgcctgctgctggccgtcccggtcttcacgctcctgaccactggctgctccctcct cgtcaccgccgccgtggtgcgcctcctcggccgcggcatcacgccgggactgcaccccgcgagcggtggcgtcgcctggcgcgcc tggctggtcacccgcctcctggacggcgcccgcggcagcctcttcccgctctacgccagcctcggcaccccgcactggctgcggc tgctcggcgccaaggtcggccggcacgcggagatctccaccgtgctgccgctgccctccctgctgcacgtcgaggacggcgcgtt cctcgccgacgacaccctggtggcgcccttcgaactccgcggcggctggctgcggttggggaccgtccggatcggtcgccgggcc ttcgtcggcaactccggcatcgtcgaccccggccacgacgtgcccgatcacagcctggtcggcgtgctctccaacgcccccgccg acggcgagcccggctcgtcctggctgggccggcccgccatgccgctgccccgggtggcgacccaggccgacccggcgcgcacctt cgcaccgccgcgcaggctggtccgggcccgcgccgccgtcgagctgtgccgggtgctgccgctgatgtgcggcctggcgctcgcc gagggcgtgttcctcaccgagcaggacgccttcgcccagggcggcctcggtctcgccgcactggtcggcgccccgctgctgctgg cctcgggcctcgtggcgctgctcgtcaccaccctcgcgaagtggctgctggtcggccgcttcacggtgagcgagcaccccctgtg gtcgtcgttcgtgtggcgcaacgagctctacgacaccttcgtcgaatcgctcgccgtgccgtcgatggccggcgcgttcaccggc accccggtcctgaactggtggctgcgcaccctcggcgccaagatcgggcgcggggtctggttggagagctactggctgccggaga ccgacctgatcaccgtcgccgacggcgtcagcgtcaaccgcggctgcgtcctgcagacccacctcttccacgaccggatcatgcg gctggacaccgtccgcctcgccgaaggctcctcgctcggcccgcacggcatcgtgctccccggcaccgaggtcggggcgcgcgcc tcgatcgcgccgtcgtccctggtcatgcgcggcgagagcgtcccggcccacacccggtgggccggcaacccgatcgccggcgaac gccccgcccgccccgtcccggcacgcgcggagggaggtgcggccgcgtga。

<110> Binzhou medical college

<160>2

<210>1

<211>96

<212>DNA

<213>Streptomyces albus (Streptomyces albulus）

<221>PromoterskasOp and ribosome binding site sequence

<400>1

tgttcacattcgaacggtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggccaggagaataCTAGAtctaagtaaggagtgtccat

<210>2

<211>3960

<212>DNA

<213>Streptomyces albus (Streptomyces albulus）

<221> pls Gene

<400>2

Atgtcgtcgccccttctcgaatcgtccttcgagccgtccgagccagcgccccaacaggccctgtaccgcaccgccggcaacccggccccgcggaccctgctcgacgtgctcgatgccaccgccgccgcacatccccaggcgatcgccctggacacgggctccgaggcgctcacctaccgcgacctgtgtatcgagatcgaacgccgcgcacggcagctcagggaccgcggcatcggtcccggcgaccgggtcggagtccgcgtcccctccgggaccgccgagctgtacctgtccatcctcgccgtcctgcgcagcggagcggcctacgtgccggtcgacgccgacgaccccgacgagcgggccgccaccgtcttccgcgaggccgccgtctgcgccgtcctcggccccgacggcccgctgcccggcccggcccggcccctcggcgacccgcgttccgcgggcccccaggacgacgcctggatcatcttcacctcgggttcgaccggcgcgcccaagggcgtggcggtcagccaccgctccgccgccgccttcgtcgacgccgaggccgacctgttctgccaggaccagccgttgggccccggcgaccgggtgctggccgggctgtccgtcgccttcgacgcctcctgcgaggagatgtggctcgcctggcggtacggcgcctgcctggtgcccgcaccccgcgcgctggtccgggccggccacgaactcggcccctggctcgtcgagcgcggcatcaccgtcgtctccaccgtgcccaccctcgccgcgctctggccggacgaggcgatgcgccgggtccgcctgctgatcgtcggcggcgaatcctgcccggccgggctcgtcgaccgcttcgccggacccggccgcgagatgtggaacacctacggcccgaccgagaccaccgtcgtcgcctgcgccgcccgcctgctgccgggcgagccggtccgcatcggcctgcccctgaagggctggcagctcgccgtcgtcgaccgcaccgggcagccggtgcccttcggcgccgagggcgaactgctgatcagcggcgtcggcacggcccgctacctcgaccccgccaaggacgccgaacggttccggcccgacgacgccctgggggccgcccgcgtctaccgcaccggcgacctggtccgggccgaacccgagggcctgctcttcgtcggccgcgccgacgaccagatcaaactcggcggccgccgcatcgagctgggcgagatcgacgccgccctggccgccctgcccggcgtccgcggggccgccgcggccgtccagacgacgccggccggcacccaggtgctggtcggctacgtcgttcccgagcagcgcaccgccgacggttccagcttccagcaggacaaggcccgcgcactgctccaggaacgcctgcccgcgcagttggtcccggtcctcgcggaggtcgagtccctgcccacccggacctccggcaaggtcgaccgcaaggcgctgccctggccgctgccgtccgccccggtcgactccgccaccggcgatccggccacggcgctggacggcaccgccgcccggctcgccgggatctgggaggaactcctcggcgtccggcccggcccggacagcgacttcgtctccctcggcggcaccagcctggtcgccgcccgcatggcgtcccagctccgcatccaccaccccggcgtctcggtcgccgacctctaccgccacccggtgctgcgcgacatggccgagcacctcgactcgctgggcggcccggtggacgaggtccgcccggtccgccccgtcccgcgccgcaccggattcgtccaactcctcgtccagaccggcctgtacggcatcgccggcctgcgcggactggtcgggctcgcgctcgcggacaacgtcctcggcctgctcgccccgcaggtctgggccccgcacaccgcgtggtggctgatcatcgtcggctgggtggtgctctacagcgccccgatgcgttgcgccctcggcgcactggccgcccgcgcgctcgccggcaccatcaagcccggcgcctacccgcgcggcggcgccacccacctgcgcctgtggaccgccgaacgcgtcgtcgccgccttcggcgtcccctccctgctcggcaccccctgggcgcggctctacgcccggagcctgggctgcgccacagggcggaacgtggcgctgcacaccatgccgccggtcaccggcctcgccgaactcggcgacggctgcagcgtcgaacccgaggccgacatctccggctggtggctcgacggcgacaccctgcacatcggcgcggtccggatcggcgccggcgcccgggtcgcccaccgcagcatgctgatgcccggcgccgtcgtcggccagggcgccgaactcgcctccggcgcctgcctggacggagagatccccgacggcgcctcgtggtccggctccccggcccgcccggccggcgccgccgagcggatggccggcgccgcctggcccgcccccgcctggcagcgctcgcgccgctggagcgccgcctacggactgaccctgctgggcctgccgctgctggccctgctgtccaccgcgcccgccctggtcggcgcgtacttcctgctccgcgacagcggcaccctcgccacagccgggcttcgcctgctgctggccgtcccggtcttcacgctcctgaccactggctgctccctcctcgtcaccgccgccgtggtgcgcctcctcggccgcggcatcacgccgggactgcaccccgcgagcggtggcgtcgcctggcgcgcctggctggtcacccgcctcctggacggcgcccgcggcagcctcttcccgctctacgccagcctcggcaccccgcactggctgcggctgctcggcgccaaggtcggccggcacgcggagatctccaccgtgctgccgctgccctccctgctgcacgtcgaggacggcgcgttcctcgccgacgacaccctggtggcgcccttcgaactccgcggcggctggctgcggttggggaccgtccggatcggtcgccgggccttcgtcggcaactccggcatcgtcgaccccggccacgacgtgcccgatcacagcctggtcggcgtgctctccaacgcccccgccgacggcgagcccggctcgtcctggctgggccggcccgccatgccgctgccccgggtggcgacccaggccgacccggcgcgcaccttcgcaccgccgcgcaggctggtccgggcccgcgccgccgtcgagctgtgccgggtgctgccgctgatgtgcggcctggcgctcgccgagggcgtgttcctcaccgagcaggacgccttcgcccagggcggcctcggtctcgccgcactggtcggcgccccgctgctgctggcctcgggcctcgtggcgctgctcgtcaccaccctcgcgaagtggctgctggtcggccgcttcacggtgagcgagcaccccctgtggtcgtcgttcgtgtggcgcaacgagctctacgacaccttcgtcgaatcgctcgccgtgccgtcgatggccggcgcgttcaccggcaccccggtcctgaactggtggctgcgcaccctcggcgccaagatcgggcgcggggtctggttggagagctactggctgccggagaccgacctgatcaccgtcgccgacggcgtcagcgtcaaccgcggctgcgtcctgcagacccacctcttccacgaccggatcatgcggctggacaccgtccgcctcgccgaaggctcctcgctcggcccgcacggcatcgtgctccccggcaccgaggtcggggcgcgcgcctcgatcgcgccgtcgtccctggtcatgcgcggcgagagcgtcccggcccacacccggtgggccggcaacccgatcgccggcgaacgccccgcccgccccgtcccggcacgcgcggagggaggtgcggccgcgtga

Claims

1. A streptomyces albus genetic engineering bacterium Q-P L2, wherein the streptomyces albus genetic engineering bacterium Q-P L2 comprises one or more polylysine synthetase genes introduced by genetic engineering and expression elements thereof.

2. The Streptomyces albus genetically engineered bacterium Q-P L2 according to claim 1, wherein the expression elements are a promoter and a ribosome binding site, preferably the nucleotide sequence of the polylysine synthase gene comprises the sequence of SEQ ID No.2 or a homologous sequence thereof.

3. The Streptomyces albus genetically engineered bacterium Q-P L2 of claim 1, wherein the Streptomyces albus genetically engineered bacterium Q-P L2 has a fermentation production capacity of polylysine 2-25 times that of a wild strain of Streptomyces albus.

4. A method for producing polylysine by using streptomyces albidoflauvs genetic engineering bacteria Q-P L2.

5. The method of claim 4, wherein the method uses a medium containing citrate to ferment the genetically engineered strain of S.albidoflauvs Q-P L2 to produce polylysine.

6. The method according to claim 5, wherein the medium is a fermentation medium, preferably the fermentation medium comprises 1-20 g/l citrate.

7. The method of claim 5, wherein the method comprises:

plate culture, namely inoculating streptomyces albidoflavus Q-P L2 to an MS solid culture medium containing 60-120 micrograms/ml apramycin, and culturing for 4-7 days at 25-35 ℃ until black spores are grown on the surface of the culture medium for later use;

fermentation culture: inoculating the cultured seed culture solution to a fermentation tank filled with a fermentation culture medium for culture, wherein the culture temperature is 25-35 ℃, dissolved oxygen is controlled to be 10% -100%, the aeration ratio is 1-5 vvm, when the pH value of the fermentation solution is reduced to 3.8-4.2, the pH value of the fermentation solution is kept unchanged by using alkali, the concentration of a carbon source in the fermentation solution is monitored in the culture process, a fed-batch culture medium is fed in a flowing manner when the concentration of the carbon source is 5-15 g/L, the flow-feeding speed is adjusted by monitoring the concentration of the carbon source in the fermentation solution, the yield of polylysine in the fermentation solution is measured at intervals, and the total time of the fermentation culture is 36-144 hours.

8. The method according to claim 7, wherein the fermentation medium comprises a carbon source in an amount of 40 to 100 g/L, a nitrogen source in an amount of 2 to 20 g/L, citrate in an amount of 1 to 20 g/L, dipotassium hydrogen phosphate in an amount of 0.2 to 2 g/L, potassium dihydrogen phosphate in an amount of 0.5 to 5 g/L, zinc sulfate heptahydrate in an amount of 0.01 to 0.1 g/L, magnesium sulfate heptahydrate in an amount of 0.1 to 2 g/L, ferrous sulfate heptahydrate in an amount of 0.01 to 0.1 g/L, and pH5.5 to 7.0; the components of the feed medium comprise 0-600 g/L of carbon source, 20-200 g/L of nitrogen source and 10-100 g/L of citrate.

9. The method of claim 8, wherein the carbon source, nitrogen source, and citrate in the feed medium are the same as the carbon source, nitrogen source, and citrate in the fermentation medium.

10. The method of claim 8 or 9, wherein the carbon source is one or more combinations of glucose, glycerol, xylose, fructose, mannitol; preferably, the nitrogen source is one or a combination of more of ammonium sulfate, ammonium chloride, urea, ammonium nitrate, yeast powder, soybean peptone, corn steep liquor, peanut cake powder and peptone; preferably, the citrate is one or more of sodium citrate, ammonium citrate, potassium citrate, zinc citrate, calcium citrate, magnesium citrate, sodium dihydrogen citrate, potassium dihydrogen citrate, sodium potassium citrate, ferric citrate and diammonium hydrogen citrate.