CN110066741B

CN110066741B - Mutant strain construction method for directionally improving metabolic yield of filamentous fungi through morphological optimization

Info

Publication number: CN110066741B
Application number: CN201910425610.9A
Authority: CN
Inventors: 郑之明; 刘会; 孙小雯; 赵根海; 王鹏; 王丽; 王晗; 倪文枫
Original assignee: Hefei Institutes of Physical Science of CAS
Current assignee: Hefei Institutes of Physical Science of CAS
Priority date: 2019-05-21
Filing date: 2019-05-21
Publication date: 2023-02-24
Anticipated expiration: 2039-05-21
Also published as: CN110066741A

Abstract

A method for constructing a mutant strain with directionally improved metabolic yield of filamentous fungi through morphological optimization, comprising: culturing a filamentous fungus in a liquid medium; extracting a whole genome; designing a primer to amplify a target morphological gene segment from the whole genome of the filamentous fungi; connecting the target gene segment with a vector to construct a vector for regulating and controlling the expression of the morphological gene; transforming filamentous fungi by using the vector, and screening transformants by using the resistance gene on the vector; inoculating the mutant strain into a seed bottle, culturing for a certain time, filtering and collecting hyphae, and observing the shape of the hyphae under a microscope after dyeing; after the seeds are transferred into a fermentation medium, sampling at certain time intervals, filtering and collecting hyphae, and observing the shape by a microscope after dyeing; measuring the product titer, and screening high-yield strains. The modified mycelium has multiple branches and is wound and aggregated into balls, the mycelium outside the balls has shorter branches, the mycelium balls are compact and uniform in size, and the viscosity of the fermentation liquor is lower.

Description

Mutant strain construction method for directionally improving metabolic yield of filamentous fungi through morphological optimization

Technical Field

The invention relates to a method for constructing a mutant strain for directionally improving the metabolic yield of filamentous fungi through morphological optimization, belonging to the technical field of biology.

Background

The utilization of fungi by humans has a long history, but until the first world war, filamentous fungi fermentation has gradually developed in the industrial field with the rise of liquid fermentation technology. Filamentous fungi are now widely used in the fermentation industry for the production of antibiotics (penicillin, cephamycin, etc.), organic acids (citric acid, gluconic acid, fumaric acid, etc.) and enzyme preparations (amylase, pectinase, cellulase, etc.), which are in great demand in the fields of medicine, food and other industries.

During fermentation, filamentous fungi are complex in morphological changes and exhibit distinct morphological characteristics at different stages of growth. In the early growth phase, the vegetative structure is usually a tubular filament, germinated from spores, called hyphae; as the cells grow, hyphae begin to bifurcate and eventually form several hyphae called mycelium. In liquid fermentation, mycelium morphology is associated with a number of factors, in addition to the genotype associated with controlling the morphology of the species, which depend on the nature of the inoculum and the fermentation environment in which it is placed, including medium composition, temperature, pH and mechanical shear, among others. Hyphae either grow in discrete states in the medium, called discrete hyphae, or are intertwined to form aggregates, typically called clusters of loose hyphae and densely structured aggregates called mycelial pellets.

The modification of the mycelium morphology is very important for the fermentation process, it will directly affect the consumption of nutrients and the rate of oxygen uptake, and the mycelium morphology will significantly affect the rheological properties of the fermentation broth, and thus the bioreactor performance. Research shows that when hyphae grow in a spherical shape, the culture solution has low viscosity and good rheological property, momentum, heat and mass transfer in deep culture is easy, the fermentation liquor is generally in a Newton-type characteristic, when the hyphae grow gradually, the hyphae ball forms a nutrition gradient from outside to inside, the diffusion of nutrient components to the center of the ball is limited, and the production of metabolites of internal mycelium is reduced; when hyphae grow in a filamentous shape, the fermentation liquor has high consistency and shows non-Newtonian rheological characteristics, and the viscous non-Newtonian fluids have poor rheological properties, so that momentum, heat and mass transfer are difficult, insufficient mixing is easy to occur, poor heat transfer and mass transfer are caused between gas and liquid, and cell metabolism and product synthesis are influenced finally. For some products, in order to obtain the highest yields, it is necessary that the mycelium takes on a specific morphology, such as fermentation, also using Aspergillus niger, for which filamentous growth is more suitable; whereas for the production of citric acid, globular growth is more suitable. However, the morphological optimization of the filamentous fungi cannot be realized fundamentally only by process control, and the molecular biological modification of related genes is the fundamental measure for realizing the morphological control of the fermentation of the filamentous fungi.

Disclosure of Invention

The invention aims to provide a method for constructing a mutant strain for directionally improving the metabolic yield of filamentous fungi through morphological optimization.

In order to achieve the above objects and other related objects, the present invention provides the following technical solutions: a method for constructing a mutant strain for directionally improving the metabolic yield of filamentous fungi by morphological optimization, which comprises the following steps:

step 1: extracting whole genome DNA of the filamentous fungi;

and 2, step: the construction of the racA gene knock-down bacterium comprises the following steps:

the first step is as follows: taking the whole genome DNA extracted in the step 1 as a template, amplifying primers racAF and racAR, performing single enzyme digestion on the purified and interference vector pJL43-RNAi by using restriction enzyme NcoI respectively, and performing gel recovery and purification on enzyme digestion fragments;

RacAF：CCATGCCATGGGCGGTAGGAAAGTATGTTG

RacAR：CCATGCCATGGGAATACACTCTTCAGGTTGC

the second step is that: after the enzyme-cleaved and purified rac A gene segment obtained in the first step is connected with the pJL43-RNAi segment, the gene segment is transformed into escherichia coli DH5 alpha competent cells, and positive clones which are correctly connected are screened through an ampicillin resistance LB plate; selecting positive clones, inoculating the positive clones to an LB liquid culture medium containing benzyl ammonia, culturing for 12-16h, and extracting a recombinant vector pracA-RNAi from a bacterial liquid;

the third step: transferring the recombinant vector pracA-RNAi into Aspergillus niger by an electro-transformation method of germinated spores, culturing on a CM plate containing 30 mug/mL phleomycin for 4-5 days, and screening to obtain a knocked-down strain;

and step 3: inoculating the knock-down strain constructed in the step 2 into a fermentation culture medium, and culturing;

and 4, step 4: and filtering and collecting thalli after the culture is finished, adding normal saline for washing and diluting to remove impurities in the fermentation liquor, and observing and shooting the hypha form.

The preferable technical scheme is as follows: the method for extracting the whole genome DNA of the filamentous fungi comprises the following steps:

s1, inoculating Aspergillus niger spores into a CM (CM) culture medium, and performing shake culture;

s2, sucking the cultured aspergillus niger strains by using filter paper, adding liquid nitrogen, grinding the liquid nitrogen into fine powder, extracting genomic DNA by using a fungal genomic DNA extraction kit, and collecting DNA solution.

The preferable technical scheme is as follows: in the first step, the PCR reaction system:

and (3) PCR reaction conditions:

the preferable technical scheme is as follows: in the first step, an enzyme digestion reaction system:

the enzyme digestion reaction conditions are as follows: after the enzyme digestion at 37 ℃ for 1h, the reaction is carried out at 65 ℃ for 20min and then the enzyme digestion reaction is terminated.

Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:

1. the hyphae of the racA gene knock-down bacteria obtained by the invention are all multi-branched and are wound and aggregated into balls, the hyphae outside the balls are short in branching, the bacterial balls are compact and uniform in size, and the viscosity of fermentation liquor is low. When the diameter of the mycelium pellet is less than 0.1mm and short hypha branches still exist on the surface of the mycelium pellet, the yield of the citric acid is higher.

2. The invention obtains morphological mutant strains by regulating the expression level of morphological genes of filamentous fungi by a molecular biology means; the mutant strain hypha obtained by the invention has obvious changes in morphology, including swelling, thickness, branching increase and the like; the mutant strain is easy to nodulate after entering the fermentation period, the transfer of dissolved oxygen and nutrient substances is facilitated, the yield is obviously improved, the occurrence of nodulation is also beneficial to the extraction and purification of subsequent target metabolites, and the method has very important significance in morphological metabolic engineering research and industrial production.

Drawings

FIG. 1 shows the hyphal morphology of the original (non-transformed) bacterium.

FIG. 2 shows the hyphal morphology of knock-out bacteria of the comparative example.

FIG. 3 shows the hyphal morphology of the first knockdown bacterium of the present invention.

FIG. 4 shows the hyphal morphology of the second knockdown bacterium of the present invention.

FIG. 5 shows the hyphal morphology of a third knockdown bacterium of the present invention.

FIG. 6 is a comparison of the pellet density of the original bacteria, knockdown bacteria, and three knockdown bacteria.

FIG. 7 is a comparison of apparent viscosities of primordial, knockdown bacteria, and three knockdown bacteria.

FIG. 8 is a comparison of citric acid concentrations of fermentation products of the original bacteria, knockdown bacteria, and three knockdown bacteria.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be readily apparent to those skilled in the art from the disclosure of the present invention.

Please refer to fig. 1-2. It should be understood that the structures, ratios, sizes, and the like shown in the drawings and described in the specification are only used for matching with the disclosure of the specification, so as to be understood and read by those skilled in the art, and are not used to limit the conditions under which the present invention can be implemented, so that the present invention has no technical significance, and any structural modification, ratio relationship change, or size adjustment should still fall within the scope of the present invention without affecting the efficacy and the achievable purpose of the present invention. In addition, the terms "upper", "lower", "left", "right", "middle" and "one" used in the present specification are for clarity of description, and are not intended to limit the scope of the present invention, and the relative relationship between the terms and the terms is not to be construed as a scope of the present invention.

Comparative example:

(1) Inoculating Aspergillus niger spores in 50mL of CM medium (g/L): tryptone 5 (5 g tryptone per liter CM medium), yeast extract 5, glucose 10, sodium nitrate 6, potassium dihydrogen phosphate 1.5, potassium chloride 0.52, magnesium sulfate 0.52, trace element mixture 2mL, pH 6.5, 36.5 ℃,250rpm shake culture 48h. The trace element mixed solution comprises the following components in percentage by weight (g/L): 5 parts of zinc sulfate heptahydrate, 1 part of ferrous ammonium sulfate hexahydrate, 0.25 part of copper sulfate pentahydrate, 0.06 part of manganese chloride tetrahydrate, 0.05 part of boric acid and 0.05 part of sodium molybdate dihydrate.

(2) Collecting thallus, sucking with filter paper, adding liquid nitrogen, grinding into fine powder, and extracting genome DNA with Ezup column type fungus genome DNA extraction kit. The method comprises the following specific steps:

a) Adding 50-100mg of mycelium powder into a 1.5mL centrifuge tube. Add 200 u LBuffer digest and 2 u L beta mercaptoethanol, then add 20 u L Proteinase K solution, shake and mix. Carrying out water bath at 56 ℃ for 1h until the cells are completely lysed;

b) Adding 20 mu L of RNase A (10 mg/ml), and standing at room temperature for 2-5 min;

c) Adding 100 μ L Buffer PF, mixing thoroughly, and standing at-20 deg.C for 5min;

d) Centrifuging at 10,000 rpm for 5min at room temperature, and transferring the supernatant into a new 1.5mL centrifuge tube;

e) Adding 200 mu L of Buffer BD, fully reversing and uniformly mixing;

f) Putting the adsorption column into a collecting pipe, adding the solution and the semitransparent fibrous suspended matters into the adsorption column by using a liquid transfer device, standing for 2min, centrifuging at 10,000 rpm at room temperature for 1min, and pouring out waste liquid in the collecting pipe;

g) Putting the adsorption column back to the collecting tube, adding 500 mu LPW Solution, centrifuging at 10,000 rpm for 30s, and pouring off the waste liquid in the collecting tube;

h) The adsorption column was returned to the collection tube, 500. Mu.L of Wash Solution was added, and the collection tube was centrifuged at 10,000 rpm for 30 seconds to discard the waste Solution.

i) The column was replaced in the collection tube and centrifuged at 12,000rpm for 2min at room temperature to remove the remaining Wash Solution.

The adsorption column was removed and placed in a new 1.5mL centrifuge tube, 50. Mu.LTE Buffer was added and left to stand for 3min,12,000rpm was centrifuged at room temperature for 2min, and the DNA solution was collected. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.

Step 1: taking an Aspergillus niger genome as a template, and designing a primer to amplify upstream and downstream sequences of a racA gene, wherein the primer sequence is as follows:

upstream homologous sequence racAup primer racAup f: AGCAGCAGCAGCAACACTAA

racAupR：gttcaggctttttcatATTGAGGCGAGGGATGG

And (3) PCR reaction system:

and (3) PCR reaction conditions:

a downstream homologous sequence racandown primer racandown F: ggcaaaggaatgaatagggccaaaccgaaca

racAdownR：CAACTACGACCGCATGAAGA

And (3) PCR reaction system:

and (3) PCR reaction conditions:

step 2: the pSilent-1 plasmid is used as a template, a primer is designed to amplify the hygromycin coding gene hyg, and the sequence of the primer is as follows: and (2) hygF: tccctcgcctcaatatgaaaaaagcctgaactca

hygR：cttcggtttggccCTATTCCTTTGCCCTCG

And (3) PCR reaction system:

and (3) PCR reaction conditions:

and step 3: and (3) purifying the upstream and downstream homologous sequences of the racA gene, the racaDown and the hygromycin gene hyg amplified in the steps (1) and (2), and then, taking racaUpF and racaDown as primers, and linearly knocking out the expression cassette racaUp-hyg-racaDown through overlap PCR amplification.

And (3) recovering a PCR product: shanghai worker SanPrep column type PCR product purification kit

a) The PCR reaction solution was transferred to a clean 1.5mL centrifuge tube, and 5-fold volume of Buffer B3 was added and mixed well.

b) The mixture was transferred to an adsorption column and centrifuged at 8000g for 30s. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe.

c) mu.L of Wash Solution was added to the column and centrifuged at 9000g for 30s. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe.

d) Repeating step c once.

e) The empty adsorption column and collection tube were placed in a centrifuge and centrifuged at 9,000g for 1min.

f) Adding 15-40 μ L of Elution Buffer in the center of the adsorption membrane, standing at room temperature for 1-2min, and centrifuging at 9000g for 1min. The resulting DNA solution was stored at-20 ℃ or used for subsequent experiments.

overlap PCR reaction system and conditions:

after completion, 2. Mu.L each of primers, racAUPF and racAdownR, was added to the above system to carry out the following reaction:

and (3) obtaining a linear knockout expression cassette racAup-hyg-racadewn through amplification, and purifying by glue recovery.

A glue recovery system: raw-work SanPrep column type DNA glue recovery kit

a) The target DNA fragment was separated from other fragments as much as possible by agarose gel electrophoresis, and the agarose gel block containing the target DNA fragment was cut with a clean scalpel blade, placed in a 1.5mL centrifuge tube, and weighed.

b) Buffer B2 was added in a proportion of 300 to 600. Mu.L per 100mg of agarose (if the mass is less than 100mg, it is made up to 100mg with water) depending on the weight and concentration of the gel mass.

c) Placing the centrifuge tube in a water bath at 50 ℃ for 5-10 min, and mixing the mixture at intervals until the gel blocks are completely dissolved.

d) The whole dissolved solution was transferred to an adsorption column and centrifuged at 8,000g for 30s. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe. (750. Mu.L of sol solution was used each time if the total volume was more than 750. Mu.L; multiple column applications.)

e) Adding 300 μ L Buffer B2,9,000g into the adsorption column, centrifuging for 30s, pouring off the liquid in the collection tube,

f) The adsorption column was placed in the same collection tube.

g) Add 500. Mu.L of Wash Solution,9,000g to the adsorption column and centrifuge for 30s. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe.

h) Repeat step g once.

i) The empty adsorption column and collection tube were placed in a centrifuge and centrifuged at 9,000g for 1min.

j) Adding 15-40 μ L of precipitation Buffer in the center of the adsorption membrane, standing at room temperature for 1-2min, and centrifuging at 9,000g for 1min. The resulting DNA solution was stored at-20 ℃ or used for subsequent experiments.

And 4, step 4: transferring the linear knockout expression cassette racAup-hyg-racaudown into aspergillus niger by a germinal spore electrotransformation method, wherein the specific method comprises the following steps:

a) Press 10 ⁷ one/mL inoculum size inoculated Aspergillus niger spores were cultured in 100mL CM medium at 36.5 ℃ for 4h at 250 rpm.

b) The germinated spores were collected by centrifugation at 8000g for 10min at 4 ℃, washed once with 100mL of ice-cold sterile water, and resuspended in 10mL of YED medium (yeast extract 10g/L, glucose 20g/L,20mM HEPES, pH 8.0) and cultured at 30 ℃ for 60min at 100 rpm.

c) The spores were collected by centrifugation at 8000g and 4 ℃ for 10min, washed once with 10mL of ice-chilled electrotransfer buffer (10 mM Tris-HCl (pH 7.5), 270mM sucrose, 1mM lithium acetate), and then suspended in 500. Mu.L of ice-chilled electrotransfer buffer and kept on ice for further use.

d) Taking 50 mu L of spore suspension, adding 1 mu g of DNA, then adding sterile water until the final volume is 60 mu L, gently blowing and sucking, and mixing uniformly, and simultaneously taking a system without DNA as a negative control;

e) The mixture was placed on ice for 10min and transferred to a 0.2cm electrical rotor with an electrical conversion parameter of 1.5kv and discharge for 4-5ms. Immediately adding 1mL of ice-precooled YED culture medium after electric conversion, transferring the YED culture medium into a 50mL centrifuge tube, placing the YED culture medium on ice for 20min, and then culturing the YED culture medium for 90min at the temperature of 30 ℃ and the rpm of 100;

and (3) coating a proper amount of the transformed spore suspension on a hygromycin resistance screening plate (CM culture medium +250 mu g/mL hygromycin), culturing for 4-5 days at 30 ℃, and screening to obtain the knockdown bacterium delta RacA.

By 5X 10 ⁴ The cells/mL of the inoculum size are inoculated with the knock-out bacteria delta RacA spores in a fermentation medium, and the cells are cultured for 3d at 36.5 ℃ and 250 rpm. The main component of the culture medium is corn flour liquefied clear liquid, and the preparation process comprises the following steps: 100g of corn flour which is crushed and sieved by a 60-mesh sieve is dissolved in 300mL of water, after being uniformly stirred, the corn flour is heated to 60 ℃, high-temperature-resistant alpha-amylase is added, the temperature is increased to 90 ℃, the mixture is kept for stirring and liquefying for 4 hours, glucose is added to ensure that the total sugar concentration reaches about 17 percent, and MgSO (MgSO) is added into 1L of the liquefied clear liquid of the filtered corn flour ₄ ·7H ₂ O 0.15g，K ₂ HPO ₄ 3.6g，(NH ₄ ) ₂ SO ₄ 2g, subpackaging, and autoclaving at 115 ℃ for 20min.

(2) After fermentation, filtering and collecting thalli, and adding normal saline to wash and dilute to remove impurities in the fermentation liquor. 100 mu L of the solution is dropped on a clean glass slide, a drop of laccolic acid cotton blue staining solution is dropped on the glass slide after flame fixing for staining for 5min, a cover glass is covered after distilled water washing, and hypha forms are observed and photographed at 100 x, 200 x and 400 x respectively by using an Olympus TH4-200 microscopic imaging system.

(3) Taking 1mL of fermentation liquor filtered by a 200-mesh screen, adding the fermentation liquor into a triangular flask filled with 50mL of distilled water, dripping 1 to 2 drops of phenolphthalein indicator, titrating the solution to pink by using C (NaOH) =0.1429M NaOH, taking the fadeless state within 30s as a titration end point, recording the volume of the consumed NaOH standard solution, and calculating the content of citric acid according to the following formula, wherein the content is expressed by mass ratio:

X(％)＝V(NaOH)×C(NaOH)/0.1429

wherein V (NaOH) represents the volume of NaOH standard solution consumed in titration, and the unit is L;

c (NaOH) represents the exact concentration of the NaOH standard solution, in mol/L.

The content of the citric acid of the knockdown bacterium delta RacA is 152.9g/L, which is 10.7 percent higher than that of the original (138.1 g/L).

Example 1: mutant strain construction method for directionally improving metabolic yield of filamentous fungi through morphological optimization

A mutant strain construction method for directionally improving the metabolic yield of filamentous fungi through morphological optimization regulates the RacA expression level in a Rho GTPases protein family, optimizes the submerged fermentation form of the filamentous fungi, and further improves the yield of metabolites. The method comprises the following specific steps:

(1) Inoculating Aspergillus niger spores in 50mL of CM medium (g/L): tryptone 5 (5 g tryptone per liter CM medium), yeast extract 5, glucose 10, sodium nitrate 6, potassium dihydrogen phosphate 1.5, potassium chloride 0.52, magnesium sulfate 0.52, trace element mixed solution 2mL, pH 6.5, 36.5 ℃,250rpm shake culture 48h. The trace element mixed liquid comprises the following components in percentage by weight (g/L): 5 parts of zinc sulfate heptahydrate, 1 part of ferrous ammonium sulfate hexahydrate, 0.25 part of copper sulfate pentahydrate, 0.06 part of manganese chloride tetrahydrate, 0.05 part of boric acid and 0.05 part of sodium molybdate dihydrate.

(2) Collecting the thallus, sucking the thallus by filter paper, adding liquid nitrogen, grinding the thallus into fine powder, and extracting the genome DNA by using an Ezup column type fungus genome DNA extraction kit of Shanghai worker. The method comprises the following specific steps:

j) Adding 50-100mg of mycelium powder into a 1.5mL centrifuge tube. Add 200 u LBuffer digest and 2 u L beta-mercaptoethanol, then add 20 u L Proteinase K solution, shake and mix. Carrying out water bath at 56 ℃ for 1h until the cells are completely lysed;

k) Adding 20 mu L of RNase A (10 mg/ml), and standing at room temperature for 2-5 min;

l) adding 100 μ L Buffer PF, fully reversing and mixing uniformly, and standing in a refrigerator at-20 ℃ for 5min;

m) centrifuging at 10,000 rpm for 5min at room temperature, and transferring the supernatant to a new 1.5mL centrifuge tube;

n) adding 200 mu L of Buffer BD, fully reversing and uniformly mixing;

o) putting the adsorption column into a collecting pipe, adding the solution and the semitransparent fibrous suspended matters into the adsorption column by using a liquid transfer device, standing for 2min, centrifuging at room temperature of 10,000 rpm for 1min, and pouring out waste liquid in the collecting pipe;

p) putting the adsorption column back to the collecting pipe, adding 500 mu LPW Solution, centrifuging at 10,000 rpm for 30s, and pouring out waste liquid in the collecting pipe;

q) the adsorption column was returned to the collection tube, 500. Mu.L of Wash Solution was added, and the tube was centrifuged at 10,000 rpm for 30s to remove waste liquid.

r) the adsorption column was replaced into the collection tube and centrifuged at 12,000rpm for 2min at room temperature to remove the remaining Wash Solution.

The adsorption column was removed, placed in a new 1.5mL centrifuge tube, 50. Mu.LTE Buffer was added and left to stand for 3min, centrifuged at 12,000rpm for 2min at room temperature, and the DNA solution was collected. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.

(4) The construction of the racA gene knock-down bacterium comprises the following steps:

step 1: taking an Aspergillus niger genome as a template, designing primers to amplify a racA gene segment with NcoI enzyme cutting sites on two sides, performing single enzyme cutting on the purified racA gene segment and an interference vector pJL43-RNAi by using a restriction enzyme NcoI respectively, and recovering and purifying enzyme cutting segments by glue.

The primer sequences are as follows:

RacAF：CCATGCCATGGGCGGTAGGAAAGTATGTTG；

RacAR：CCATGCCATGGGAATACACTCTTCAGGTTGC；

and (3) PCR reaction system:

10×Buffer with Mg ²⁺ ：200mM Tris-HCl(pH 8.8),100mM

(NH ₄ ) ₂ SO ₄ ,20mM MgSO ₄ ,100mM KCl,1％(v/v)Triton X-100,1

mg/mL BSA。

and (3) PCR reaction conditions:

an enzyme digestion reaction system:

the 10 XFastdigest Buffer, a Buffer with restriction enzymes, was purchased from Thermo Fisher Scientific.

The enzyme digestion reaction conditions are as follows: after digestion at 37 ℃ for 1h, the digestion reaction was terminated at 65 ℃ for 20min.

And 2, step: after the enzyme-cleaved and purified racA gene fragment obtained in step 1 and pJL43-RNAi fragment were ligated, they were transformed into E.coli DH 5. Alpha. Competent cells, and positive clones with correct ligation were selected by ampicillin-resistant LB plates. And (3) selecting positive clones, inoculating the positive clones into an LB liquid culture medium containing benzyl ammonia, culturing at 37 ℃ and 180rpm for 12-16h, and extracting the recombinant vector pracA-RNAi from a bacterial liquid. LB liquid medium: 10g/L tryptone, 5g/L yeast extract, 10g/L NaCl, pH 7.0.

A connection system:

incubation was carried out at 22 ℃ for 1h,65 ℃ and heat inactivation for 10min.

The transformation method comprises the following steps: adding 1 μ L of the ligation solution into 100 μ L of Escherichia coli DH5 α competent cells, gently mixing, standing on ice for 30min, then thermally shocking at 42 deg.C for 90s, immediately cooling on ice for 15-20min. Add 800. Mu.L of nonresistant LB medium preheated to 37 ℃ to a centrifuge tube and incubate it at 37 ℃ for 1h with shaking at 200 rpm. 100 μ L of competent cells were plated on an ampicillin-resistant plate containing 100 μ g/mL, and inverted and cultured in an incubator at 37 ℃ for 12 to 16 hours.

And step 3: transferring the recombinant vector pracA-RNAi into Aspergillus niger by an electro-transformation method of germinated spores, culturing on a CM plate containing 30 mug/mL phleomycin at 30 ℃ for 4-5 days, and screening to obtain a series of knockdown strains.

(1) By 5X 10 ⁴ The spores of the mutant strain of the filamentous fungus constructed by the method are respectively inoculated in the fermentation medium at the inoculation amount of one strain/mL, and the fermentation medium is cultured for 3 days at the temperature of 36.5 ℃ and the rpm of 250. The main component of the culture medium is corn flour liquefied clear liquid, and the preparation process comprises the following steps: 100g, crushing corn flour which is sieved by a 60-mesh sieve, dissolving the corn flour in 300mL of water, uniformly stirring, heating to 60 ℃, adding high-temperature-resistant alpha-amylase, heating to 90 ℃, preserving heat, stirring and liquefying for 4 hours, adding glucose to enable the total sugar concentration to reach about 17%, and adding MgSO (MgSO) into 1L of the filtered liquefied clear liquid of the corn flour ₄ ·7H ₂ O 0.15g，K ₂ HPO ₄ 3.6g，(NH ₄ ) ₂ SO ₄ 2g, subpackaging, and autoclaving at 115 ℃ for 20min.

(3) Taking 1mL of fermentation liquor filtered by a 200-mesh screen, adding the fermentation liquor into a triangular flask filled with 50mL of distilled water, dripping 1 to 2 drops of phenolphthalein indicator, titrating the solution to pink by using c (NaOH) =0.1429M NaOH, and taking the fadeless state within 30s as a titration end point, recording the volume of the consumed NaOH standard solution, and calculating the content of citric acid according to the following formula, wherein the content is expressed by mass ratio fraction:

X(％)＝V(NaOH)×C(NaOH)/0.1429

c (NaOH) represents the exact concentration of NaOH standard solution in mol/L.

The citric acid yields of the three knockdown bacteria are respectively 175.0g/L, 165.8g/L and 170.7g/L, which are improved by 26.7%, 20.1% and 23.6% compared with the original (138.1 g/L).

The hypha morphology of the original bacteria is shown in FIG. 1, the hypha morphology of the knockdown bacteria of the comparative examples is shown in FIG. 2, and the hypha morphology of a series of knockdown bacteria obtained in this example is shown in FIGS. 3-5. The pellet density pairs for the original, knockdown and three knockdown bacteria are shown in fig. 6. Knockdown bacteria (comparative example) and knockdown bacteria (three knockdown bacteria in the present embodiment) both can increase the level of citric acid fermentation, but the knockdown bacteria are less mild than the knockdown bacteria, and spore formation is severely reduced, even substantially no spores are formed. In addition, the bacterium balls obtained by knocking out bacteria are too compact and smooth, the diameter of the bacterium balls is too large, the transfer of oxygen in the bacterium balls is limited, autolysis is easy to occur, and the fermentation level is improved to a degree inferior to that of knocking-down bacteria.

The modified mycelium has multiple branches and is wound and aggregated into balls, the mycelium outside the balls has shorter branches, the mycelium balls are compact and have uniform size, and the viscosity of the fermentation liquid is lower. When the diameter of the mycelium pellet is less than 0.1mm and short hypha branches still exist on the surface of the mycelium pellet, the yield of the citric acid is high.

Apparent viscosity pairs for the original bacteria, knockdown bacteria, and three knockdown bacteria are shown in fig. 7; the citric acid concentration profiles of fermentation products of the original bacteria, knockdown bacteria, and three knockdown bacteria are shown in fig. 8.

The foregoing is illustrative of the preferred embodiment of the present invention and is not to be construed as limiting thereof in any way, and any modifications or variations thereof that fall within the spirit of the invention are intended to be included within the scope thereof.

Claims

1. A method for constructing a mutant strain for directionally improving the metabolic yield of filamentous fungi by morphological optimization is characterized in that: comprises the following steps:

step 1: extracting whole genome DNA of the filamentous fungi;

step 2: the construction of the racA gene knock-down bacterium comprises the following steps:

RacAF：CCATGCCATGGGCGGTAGGAAAGTATGTTG

RacAR：CCATGCCATGGGAATACACTCTTCAGGTTGC

the second step: connecting the enzyme-digested and purified racA gene segment and pJL43-RNAi segment obtained in the first step, transforming the fragments into escherichia coli DH5 alpha competent cells, and screening correctly-connected positive clones by an ampicillin-resistant LB plate; selecting positive clones, inoculating the positive clones to an LB liquid culture medium containing benzyl ammonia, culturing for 12-16h, and extracting a recombinant vector pracA-RNAi from a bacterial liquid;

and 3, step 3: inoculating the knock-down strain constructed in the step 2 into a fermentation culture medium, and culturing;

and 4, step 4: filtering and collecting thalli after the culture is finished, adding normal saline for washing and diluting to remove impurities in fermentation liquor, and then observing and shooting the hypha form;

the method for extracting the whole genome DNA of the filamentous fungi comprises the following steps:

s2, sucking the cultured aspergillus niger bodies with filter paper, adding liquid nitrogen, grinding the liquid nitrogen into fine powder, extracting genome DNA with a fungus genome DNA extraction kit, and collecting DNA solution;

in the first step, the PCR reaction system:

in the first step of the process,

and (3) PCR reaction conditions:

in the first step, an enzyme digestion reaction system:

the enzyme digestion reaction conditions are as follows: after the enzyme digestion at 37 ℃ for 1h, the reaction is terminated after 20min at 65 ℃.