CN117660469B

CN117660469B - Transcription factor for synthesizing cordycepin, engineering bacterium, construction method and application

Info

Publication number: CN117660469B
Application number: CN202410144112.8A
Authority: CN
Inventors: 廖晶晶; 吕海宁; 邢家乐; 柴新; 赵鑫; 张倩; 徐承超
Original assignee: Institute of Materia Medica of CAMS
Current assignee: Institute of Materia Medica of CAMS
Priority date: 2024-02-01
Filing date: 2024-02-01
Publication date: 2024-04-09
Anticipated expiration: 2044-02-01
Also published as: CN117660469A

Abstract

The invention relates to the technical field of microbial engineering, in particular to a transcription factor for synthesizing cordycepin, engineering bacteria, a construction method and application, wherein the transcription factor is ANIA03334, ANIA03334 participates in the synthesis of cordycepin by aspergillus nidulans, the nucleotide sequence of ANIA03334 is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2. The invention discovers that transcription factors capable of regulating and controlling the biosynthesis of cordycepin in aspergillus nidulans can be knocked out to obtain aspergillus nidulans engineering bacteria capable of producing cordycepin at high yield, and the aspergillus nidulans engineering bacteria are fermented for 5 days at the temperature of 28 ℃, so that the production period of cordycepin is greatly shortened.

Description

Transcription factor for synthesizing cordycepin, engineering bacterium, construction method and application

Technical Field

The invention relates to the technical field of microbial engineering, in particular to a transcription factor for synthesizing cordycepin, engineering bacteria, a construction method and application.

Background

Cordycepin (also known as cordycepin), i.e., 3' -deoxyadenosine. 1950. In the year, cunningham and the like separated cordycepin from fermentation broth of Cordyceps militaris (Cordyceps militaris) which is a fungus used as both medicine and food for the first time. The compound has various pharmacological activities such as antibiosis, antivirus, anti-inflammatory, antioxidation, pro-apoptosis, antithrombotic, anti-tumor and the like, has stronger inhibition effect on various tumor cells such as liver cancer, lung cancer, breast cancer, gastric cancer, colon cancer cells and the like, is a precious raw material in the industries of food, medicine and cosmetics, and has the price of pure products as high as 2200 dollars per gram in the international market. The cordycepin is mainly obtained by a chemical synthesis method and a biological method, the fungus fermentation yield of the cordycepin is limited, and the application of the cordycepin is limited due to the fact that the chemical synthesis period is long, the environment is easy to pollute, the synthesis process is complex, the product yield is low, and byproducts are many. There are two main ways of producing cordycepin by biological methods: firstly, directly extracting from natural or artificially cultivated cordyceps militaris fruiting bodies, and secondly, extracting from cordyceps militaris mycelia and fermentation broth through liquid fermentation. Both of these approaches have certain limitations, such as long culture period (about 60 days) of fruiting body, complex and unstable culture conditions, low yield, low efficiency, etc., and cannot meet the demands of industrial raw materials. Therefore, the search for a more efficient and environment-friendly cordycepin synthesis method is a hot spot problem to be solved at the moment.

Natural cordycepin is reported to exist in some filamentous fungi including Cordyceps militaris, cordyceps ninetii, cordyceps cicadae, aspergillus nidulans, rake finger, and the like. Among them, aspergillus nidulans is a model fungus which has been studied more recently, and has the advantages of simple cultivation operation, short growth period, relatively simple structure and genetic background, etc. In the prior art, a biological synthesis way of cordycepin is identified through genome data analysis of cordyceps militaris, and a complete gene cluster for cordycepin synthesis is found in aspergillus nidulans, and researchers try to modify the cordycepin gene cluster of aspergillus nidulans so as to improve the cordycepin content by 1.72-1.84 times, and the highest yield reaches 277mg/L, thereby providing possibility for improving the cordycepin content by utilizing genetic engineering or excavating cordycepin synthesis regulatory factors.

Disclosure of Invention

The first aspect of the invention provides a transcription factor for synthesizing cordycepin, the transcription factor is ANIA03334, the ANIA03334 participates in the synthesis of cordycepin by aspergillus nidulans, the nucleotide sequence of the ANIA03334 is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2.

SEQ ID NO.1：

ATGTCCCGCAACCTCGTCATTACCAGCATAGAAAGCCTCACGGGGTCCCAAATTGCCAAAACCATCCTCGCATCGCGCAGTTTCGCCAAAGGCATCAAAAAGATCACAGGCTTAACCCTTTACCCAGATTCAGATGCATGCGCGGAGCTTAAAGAAGAGCATGGCGTGCAAATTGTTGAACACAAACCCGGCAATCTAGATGCCATGGTTAGCACACTGCAAGAAACGGGCGCCGACACAATCTGCCTCCTGCCACCCGGCCACAAGGACGCATTTAACATCACAACTGAGCTTATAACCGCCACGAAGAAGGCCGGTATCCCTAACGTATGCTTTATTTCGTCCGCTGGGTGTGACCTTGCCGAGCGTGAAGCGCAGCCGCTGCTGAGGAGTGTGATTGATCTCGAAGCGATGGTTATGGAGGCAAAGGGCGATGCCAGCACGGAGACGGGACATAGTCCGGTTGTGATTCGTCGCGGCTTCTACGCAGAACACCTCCTCTTGTACTCGCGACAAGCGCAAGAAGAGGGCAAATTGCCGCTCCCTATCGGCACATCGCACAAATTCGCACCGATGGCGTTATCTGATGTTGTGGAAGTAGTTGCACACGTGCTAACAGGCCACGGCAAACACGGGTTTTCCGATAAACATCGCGGTCAGCTGATGGTTCTTACGGGGCCCCAGCTTACGGCTGGCGACGAGCTCGCAACAGCCGCAAGCCAGGCGCTCGGCAAGGAATTGAAATTCGAAGATATATCAGAGTCTGAAGCCAAGAAGGTCCTCAAGGACGATGCCGGTAGTTCCGAGGGAGAGATCGCGTATCTCCTTGAGTACTACGCACTTGTCCGCGAAGGCAAGACGAACTACATATCGACGACTGCATTCCACGATGTGACCGGAAAGCATCCCGTAGAGCCAACGGAGTTCTTTAAGCAGTATGCCGAGAACTTGCGTCCGAAAGCCAACAAGAAGAGGAAGACTCAGTGA。

SEQ ID NO.2：

MSRNLVITSIESLTGSQIAKTILASRSFAKGIKKITGLTLYPDSDACAELKEEHGVQIVEHKPGNLDAMVSTLQETGADTICLLPPGHKDAFNITTELITATKKAGIPNVCFISSAGCDLAEREAQPLLRSVIDLEAMVMEAKGDASTETGHSPVVIRRGFYAEHLLLYSRQAQEEGKLPLPIGTSHKFAPMALSDVVEVVAHVLTGHGKHGFSDKHRGQLMVLTGPQLTAGDELATAASQALGKELKFEDISESEAKKVLKDDAGSSEGEIAYLLEYYALVREGKTNYISTTAFHDVTGKHPVEPTEFFKQYAENLRPKANKKRKTQ*。

The second aspect of the invention provides an engineering bacterium for synthesizing cordycepin, wherein the engineering bacterium is an Aspergillus nidulans mutant strain with ANIA03334 gene knocked out.

The third aspect of the invention provides a construction method of engineering bacteria for synthesizing cordycepin, which comprises the following steps:

s1, constructing an ANIA03334 gene knockout box;

s2, transforming the constructed ANIA03334 gene knockout box into aspergillus nidulans protoplast to obtain the engineering bacteria for synthesizing cordycepin.

In some embodiments, the construction of the ANIA03334 gene knockout cassette specifically comprises: and (3) quickly fusing a plurality of fragment genes, and selecting the pyrG gene as a screening tag to replace a target gene ANIA03334, wherein the primer sequence for constructing a knockout box is shown as SEQ ID NO.3-10, the primer sequence for vector identification is shown as SEQ ID NO.11-16, and the primer sequence for quantitative analysis is shown as SEQ ID NO. 17-28.

In a fourth aspect, the present invention provides a method for synthesizing cordycepin, comprising: inoculating the engineering bacteria into a PDB liquid culture medium, fermenting and culturing, and separating and purifying a fermentation culture solution to obtain cordycepin.

In some embodiments, the fermentation temperature is 25-30 ℃ and the fermentation time is 3-10 days.

Further, the fermentation temperature is 28 ℃, and the fermentation time is 5 days.

The fifth aspect of the invention provides an application of engineering bacteria for synthesizing cordycepin in production of cordycepin and a preparation thereof.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention discovers that transcription factors capable of regulating and controlling the biosynthesis of cordycepin in aspergillus nidulans can be knocked out to obtain aspergillus nidulans engineering bacteria capable of producing cordycepin at high yield, and the aspergillus nidulans engineering bacteria are fermented for 5 days at the temperature of 28 ℃, so that the production period of cordycepin is greatly shortened.

2. The knocking-out of the transcription factor is helpful for the efficient production of cordycepin in Aspergillus nidulans, and the invention provides an important engineering strategy for improving the cordycepin yield.

3. The transcription factor capable of regulating and controlling the biosynthesis of the cordycepin of the aspergillus nidulans, which is obtained by the invention, provides a new choice for realizing the efficient biosynthesis of the cordycepin.

Drawings

FIG. 1 is a schematic diagram of the biosynthetic pathway of cordycepin.

FIG. 2 is a schematic representation of a gene cluster for cordycepin synthesis in Aspergillus nidulans.

FIG. 3A is a schematic diagram of a construction strategy of an Aspergillus nidulans gene knockout box, and FIG. 3B is a schematic diagram of an ANIA03334 knockout box used in the present invention.

FIG. 4 is a PCR-validated electrophoresis of knockout box positive transformants. Wherein 1 and 9 are positive transformants, M is 2000 bp maker,34-5'F1 and maker-R, maker-F and 34-3' -R2 are primers on two pairs of knockout boxes respectively, the primers are used for screening whether target genes are successfully replaced, 34-F and 34-R are full-length primers of transcription factor ANIA03334, and the electrophoresis analysis of the primers shows that the genes are knocked out.

Fig. 5 is a cordycepin standard graph.

FIG. 6A is an HPLC chart after culturing PDB with 260nm detection, and FIG. 6B is a chart of cordycepin content measurement results. According to the analysis of cordycepin content, the cordycepin content in the ANIA03334 knockout strain is higher than that of the control strain.

FIG. 7 is a relative quantitative analysis of cordycepin synthesis key enzyme genes.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

As shown in figure 1, the prior art has the limitations of long culture period of fruiting body, complex and unstable culture conditions, low yield, low efficiency and the like in the way of cordycepin biosynthesis.

As shown in FIG. 2, the genome of Aspergillus nidulans fungus is used to analyze cordycepin synthesis gene cluster, and uniprot analysis is used to screen out a nitrogen source substance synthesis inhibition transcription factor ANIA03334 for unknown genes on one gene cluster, wherein, cns1, cns2, cns3 and cns4 are gene clusters participating in cordycepin synthesis in Aspergillus nidulans.

Example 1

The embodiment provides a construction method of engineering bacteria for synthesizing cordycepin, which comprises the following steps:

1. solution preparation

LETS buffer (1L, constant volume with ultrapure water):

6.04 g aqueous lithium chloride (0.1M);

40 mL ethylenediamine tetraacetic acid (20 mM, pH 8.0);

10mL 1M Tris-HCl (10 mM, pH 8.0);

5 g SDS（0.5%）；

TE buffer (100 mL, volume with ultra pure water):

1mL of 1M Tris-hydrochloric acid (10 mM, pH 8.0);

0.2mL 0.5M ethylenediamine tetraacetic acid (1 mM);

PCI (phenol: chloroform: isoamyl alcohol = 25mL:24mL:1 mL);

0.1% tween 80 (V/V): 100. adding 100 mL ultrapure water into the [ mu ] L Tween 80, and sterilizing for 20 min at 121 ℃;

1M Tris-HCl (1L): 121.14 g Tris, adding 950 mL ultrapure water, adjusting pH to (7.0, 7.5 and 8.0) by hydrochloric acid, adding water to fix volume to 1L;

20×Nitrate Salts: 120 g sodium nitrate, 10.4 g potassium chloride, 10.4 g magnesium sulfate heptahydrate and 30.4 g monopotassium phosphate, adding water to a volume of 1L, and sterilizing at 121 ℃ for 20 min;

1000 XTrace Elements:1.1 Boric acid, zinc sulfate heptahydrate 2.2 g, manganese chloride tetrahydrate 0.50 g, ferric sulfate heptahydrate 0.16 g, tetrasodium ethylenediamine tetraacetate 5g, cobalt chloride pentahydrate 0.16 g, ammonium molybdate tetrahydrate 0.11 g, copper sulfate pentahydrate 0.16 g, water 80 mL are added, after full dissolution, potassium chloride is used for adjusting the pH to 6.5, the volume is fixed to 100 mL, and sterilization is carried out for 20 min at 121 ℃;

osmoticum medium:10 mM disodium hydrogen phosphate/sodium dihydrogen phosphate buffer (pH 5.8), 1.2. 1.2M magnesium sulfate, constant volume to 500mL, 0.22 μm filter membrane filtration sterilization, 4 ℃ preservation.

Traveling Buffer:109.3 g sorbitol, 100 mL 1M Tris-hydrochloric acid (pH 7.0) (0.1. 0.1M), adding water to a volume of 1L, sterilizing at 121deg.C for 20 min, and preserving at 4deg.C;

STC buffer:218.6 g sorbitol, 10mL 1M Tris-hydrochloric acid (pH 7.5), final concentration of 0.01M, 1.47 g calcium chloride dihydrate, adding water to a constant volume of 1L, sterilizing at 121deg.C for 20 min, and preserving at 4deg.C;

200 mL:43.72 g sorbitol, 2mL 1M Tris-hydrochloric acid (pH 7.5), 0.22. 0.22 g calcium chloride, adding water to a volume of 100 mL, sterilizing at 121deg.C for 20 min, and preserving at 4deg.C;

PEG solution:500mL beaker, add 10mL ultrapure water, add 0.5549 g calcium chloride (50 mM), add 60 g PEG 6000 after dissolution, microwave heat 40 s times, add pH=7.5, 1M Tris-HCl 5mL (0.05M), microwave heat to transparent, transfer to graduated cylinder, wash 3 times, volume to 100 mL, sterilize at 121 ℃ for 20 minutes.

Enzymolysis liquid: 30 mg Yatalase (TAKARA Bio inc.), 50 mg Lysing Enzyme (Sigma), dissolved in 10mL Osmotic medium, filter sterilized;

LMM liquid medium:

5 mL 20×Nitrate Salts；

100 µL 1000×Trace Elements；

1 g glucose;

0.5 g yeast extract;

the pH was adjusted to 6.5 (NaOH) to a constant volume of 100 mL and sterilized at 121℃for 20 min.

SMM solid medium:

5 mL 20×Nitrate Salts；

100 µL 1000×Trace Elements；

1 g glucose;

21.86 g sorbitol;

1.6 g, agar;

SMM top medium: except agar halving, the other components are the same as SMM solid medium;

GMM solid medium (100 mL, PH 6.5):

1 g glucose;

5 mL 20×Nitrate Salts；

100 µL 1000×Trace Elements；

1.6 g, agar;

if uridine and uracil (abbreviated UU, final concentration: 50 mg/100 mL) are to be added, it is necessary to add them before autoclaving.

PDB liquid medium: weighing 24 g potato dextrose broth powder (BD company, america) and adding 1L ultrapure water, sterilizing at 121deg.C for 20 min;

supplementary material: pyridoxine (1000×): 15mg pyridoxine, 15 mL ddH ₂ O, filtering and sterilizing, and preserving at 4 ℃;

2. construction of knock-out cassettes

A Double-Joint method is used for quickly fusing a plurality of fragment genes, PCR products with overlapping chains are obtained by amplification of primers with complementary ends, different DNA fragments are connected by extension of the overlapping chains of the PCR products, in-vitro connection of the DNA fragments can be realized without endonuclease digestion and ligase treatment, and a quick and effective way is provided for homologous recombination fragments. The pyrG gene was selected as a screening tag to replace the target gene ANIA03334, and the primers are shown in Table 1.

TABLE 1

Numbering device	Primer name	Primer sequences
			SEQ ID NO.3	34-5'F1	GCCCTACTGAAGCAGCTACTAT
SEQ ID NO.4	34 nest-F	GAGACCCTAGTATCTGGCTCTA
			SEQ ID NO.5	34-5'R1	TCGTCAGACACAGAATAACTCTCGGAGGATCGGCAGACTCCTGACTAT
SEQ ID NO.6	pyrG-F	GAGAGTTATTCTGTGTCTGACGA
			SEQ ID NO.7	pyrG-R	ATTCTGTCTGAGAGGAGGCAC
SEQ ID NO.8	34-3'-F2	AGTGCCTCCTCTCAGACAGAATAGTGGTTGTTGTGTTTCAAACAGTGA
			SEQ ID NO.9	34 nest-R	AGCGTAGGGTTATCTGAC
SEQ ID NO.10	34-3'-R2	ATGGGAGATCATTATATTAGTGGT
			SEQ ID NO.11	34-5'F1	GCCCTACTGAAGCAGCTACTAT
SEQ ID NO.12	maker-R	CTGTAGTCAGGTACAGCTAGAATGGG
			SEQ ID NO.13	maker-F	GCTTATATGGCCAGAGTATGCG
SEQ ID NO.14	34-3'-R2	ATGGGAGATCATTATATTAGTGGT
			SEQ ID NO.15	34-F	ATGTCCCGCAACCTCGT
SEQ ID NO.16	34-R	GCAGTTGATACAATGTCAATCTGCC
			SEQ ID NO.17	cns1-QF	TGCTGCCCATCATGTTCTGT
SEQ ID NO.18	cns1-QR	TCGGACGCTGGATAACATCG
			SEQ ID NO.19	cns2-QF	ACAAGTCGCTGCTCTTCTCC
SEQ ID NO.20	cns2-QR	TGGTTGATCCCATGTCTGGC
			SEQ ID NO.21	cns3-QF	GAGGTCGTCTATGCTCGTGG
SEQ ID NO.22	cns3-QR	CGTGTACGATTCGGGGAGAG
			SEQ ID NO.23	cns4-QF	CCCTTCAAAAGCGGGTCTCT
SEQ ID NO.24	cns4-QR	GTACATCGGCAGCGATCTGA
			SEQ ID NO.25	ANIA03334-QF	CGGTAGTTCCGAGGGAGAGA
SEQ ID NO.26	ANIA03334-QR	ATGCTTTCCGGTCACATCGT
			SEQ ID NO.27	actin-QF	TCAATCCCAAGTCCAACC
SEQ ID NO.28	actin-QR	TACGACCGGAAGCATACA

The construction method comprises the following steps:

（1）Round I

the plasmid vector pYH-WA-pyrG-KI is used as a template, and a high-fidelity DNA polymerase (TransStart FastPfu DNA Polymerase, transGen Biotech) is used for amplifying the pyrG gene fragment;

the genome DNA of Aspergillus nidulans RJMP1.49 strain is used as template to amplify the upstream and downstream homologous arm fragments (5F and 3F, the nucleotide sequences of which are shown as SEQ ID NO. 29-30) for constructing an ANIA03334 knockout box.

5F: SEQ ID NO.29：

TAGGGCCCTACTGAAGCAGCTACTATACTACATAATAAATATACTAAAAAAGATAGAGGCTTATATTAATAGGATTCTACTCTCAGTAAGTATGCTTTAGCAAATAATATTGGAGATTATAGAATCCTTGCCGTGACTGTACATCTTGTTTGATGCCTTTAACAAGTGTGTTGATCTTGAGTTTATAAAAGACTATTATTAGTTTTTTTTGGGAGACCCTAGTATCTGGCTCTAAGGTTTGACTTCTCCTTACAAGTTGTCCATATATCCAAGAAACTCCCTCAGTATTTCCTTGCTGCCTATAGATTCTAGTATGCGCATCTGAGATAGACCTGGAAGCTATATATCGCAAGGGATAAGCTAAGCTAGAAATAATAATATAGTTAACACAGATTATATAACTAAGATTGCTAATATACCGATTTATTGAGCTAATAGGATGTCAGTACCTATATATTATTCTACCTTTTCTTGCTTGCAGGCTAACAAGGCTAAAGTTTTTTCCTGATAGTTCTTTGTACTAAAGCAGTCTTGAGAGAGCCAACCACGGGGGATATGGAAGACTTGCTGTCTATCCTAGCTAAAGATTTACCAGCTATATTTTAGGCAACCATATCTTGTATCCGCCATCTTTTAGAAGGATGAAAAAGACTTGGGATGATAACATTGATGTCTCTAGCGTATGCAAAACAGCTTATTACTACGAACAGGCTAACAGATTTCCTGTCAGTCCATCTCGGTCAAACAGTAGTGCGCCCCAATCATCAACCAGCGCCTCGGATAGTACTGGAATGCTCTCTGGGACTGTGACAATGGACCCCGTTACAGATATAATGCGCCTATCTCACTGCGCTGTCAATGAATACCTAATCAATAAGATTCACTGTGAGACTCTATTAAATTACATATGTGCAGTTGATACAATGTCAATCTGCCTATCTTCCCCTTGATCGTACATGCAGGTTCAATAGCTCGGACCTCACCACACGTATACTTCTTCCATCATCCGTCGCATCACGTCTTTAACAAAATTCAAATCCAGACTTCATATACTCATTAATGCTCTTAGTGTACATATGTCTGGTTAACTGATAGTCAGGAGTCTGCCGATCCTCC。

3F:SEQ ID NO.30：

AGTGGTTGTTGTGTTTCAAACAGTGATGTTGTATAGGCACAATTAGCTATTCCTTTTTTTTTTTTTGAGCTGTGAGCAAGGAAAGTGGTTGGCTTTTATCCCAGGTTGTCGGTTGCTTGCGTTGCTTGCGTCATTGTGATCTCAGTCTGCGGTGATCGAATCATTATAATGCGTACCTAGTTAAACCAAGTTTTAAACCAAAATCAATCGAGATCGAACTCGATGCAAACTCAATTGGCATCCATGGCAGACTCAGCTGATCATTGGCGCCTAAGGTGTAACCCTCTCTGGACTCGTCCGCAGCTATTGTCCAGGCACCGATGTGAGACCCTACGAACAGAACTTCTCAATCTCTAGAAGTAGAATAATAGCTAATACGGCTTAATCAAACGCCCGCTTATATCAATGATAGGTTGCACACCATTTGCCCTTCGTCGAGCTTATTCCAGCCGGGCGCTCAGCTAACCAGGGAACCATACTCTAGGGTATTATCAACATAACAAGCTTAATGATGCCATGGTTCCAGTACCGCCTTGAAGTCATACAAAGCAATCTCTACCTGAATATATATAGGAGCCAAAGGACGGATGACTCTGCAGCACAAATATCTAAGAGGTTGTCGAGCTATGATATGTGCCGAGCAGAAAAGGAACACGCTCTCACTGTAGCCCTACTCATCACAGTGCTGAGCTAAACAGTCTTATTGAGAATCTTTTCAACTAAGATCTCTGATTCTTTATTTTTTTTTTATTTTTTTTTTATTTTACTATATTTGAAATATATTTAGCTTGATATACGTATATCAGGTGTGTCGCAGCACGCAGGGAAGCTTCGTCAGATAACCCTACGCTTTTGCCCTACTTCTCATTATGTATGGCCTATCAGCGGCAGAACGCATATTCATATTCAAGCAGGCCTCTCGACAACTTCCAAGCGGCTGTGGTAGACAATTACACGACCTCGTCGATTTCTTGCCTCTTAAGCTGACAAAGATGAAGGGGCAAGCGTCCAGTCTAGGGGCAAGAATGCGAGGCCTTCGTCAGACGTTACAGCTGGCAGACCAAGTAAATATATTAGACTCTGACCACTAATATAATGATCTCCCATAGAT。

The PCR product was subjected to DNA fragment purification, and the procedure was performed according to the instructions of the DNA fragment purification kit (EasyPure PCR Purification Kit, EP 101) of Beijing full gold Biotechnology Co., ltd.

(2) Round II (25. Mu.L System)

The purified PCR product is subjected to a connection reaction, and a specific reaction system is as follows:

FastPfu DNA Polymerase Buffer 5 μL

2.5 mM dNTP 2.5 μL

5F 300ng

3F 300ng

PyrG 600ng

FastPFU 0.5μL

PCR reaction temperature procedure:

95 ℃2 min

95 ℃30 s

58 ℃10 min

72 ℃5 min

72 ℃10 min

gel electrophoresis was performed on 5. Mu.L of the PCR product.

(2) Round III (50. Mu.L System)

Round II products 1 μL

Buffer 10 μL

2.5dNTP 4 μL

F-nest 1 μL

R-nest 1 μL

FastPFU 1 μL

ddH ₂ O 32 μL

And (3) taking 5 mu L of PCR products for gel electrophoresis detection, amplifying a large amount of fragments successfully connected by using nested primers, purifying by using a DNA fragment purification kit (EasyPure PCR Purification Kit, EP 101) of Beijing full-scale gold biotechnology Co, quantitatively analyzing the purified products by using Nanodrop, and accumulating samples above 5 ug for knockout experiments. The specific principle and design is shown in fig. 3A and 3B.

3. Protoplast preparation and knockout box transformation of aspergillus nidulans

(1) Dipping 5mL of 0.1% Tween 80 solution in the sterilized flat toothpick, scraping Aspergillus nidulans on a flat plate, and filtering the washed liquid by using 3 layers of magic filter cloth cotton to obtain spore suspension;

(2) Appropriate amounts of spore suspension were taken into 10mL LMM medium (supplemented with auxotroph pyredoxine + Uridine and Uracil);

(3) Shake culturing at 37deg.C and 220 rpm for 8 hr, and microscopic examination to obtain spore with tail 3-5 times of the diameter of the cells before germination;

(4) Transferring the germinated spore solution into a 50 mL centrifuge tube, centrifuging at 4deg.C and 8000 rpm for 15 min, and removing supernatant;

(5) Adding 30 mL sterilized deionized water, suspending upside down, centrifuging at 4deg.C and 8000 rpm for 15 min, and removing supernatant;

(6) Blowing the rest part uniformly, transferring into a 1.5 mL EP tube, centrifuging at normal temperature, and thoroughly removing the supernatant;

(7) Uniformly mixing germinated spores with 10mL enzymolysis liquid, and transferring into a new sterilized triangular flask;

(8) Shaking overnight at 25℃and 120 rpm until wall-free uniform spherical cells were formed;

(9) Slowly transferring the cracked protoplast mixed solution into a 50 mL transparent glass tube, slowly dripping 10mL Trapping Buffer, and dividing the clear two layers in the visible tube;

(10) Using a horizontal rotor, centrifuging at 4 ℃ and 5000 rpm for 15 min, gently sucking the middle white protoplast layer into a new 15 mL centrifuge tube with a pipette;

(11) Adding an equal volume of STC buffer for resuspension;

(12) Centrifuging at 4deg.C and 6000 rpm for 8 min, and removing supernatant;

(13) Blowing the rest part uniformly, transferring into a 1.5 mL EP tube, centrifuging at 12000 rpm at normal temperature for 30 s, observing the protoplast deposited in the EP tube, and if the color is non-white cell deposition, lightly sucking out the white protoplast into a new EP tube by using a gun head, and repeating the steps until the deposited cells in the tube are white;

(14) Adding 100 mu L of STC buffer, and microscopic examination, wherein the visual field is a uniform wall-free spheroplast;

(15) Adding 10 mu L of plasmid (3-10 mu g) into every 100 mu L of protoplast, lightly mixing, and standing on ice for at least 50 min;

(16) Adding 1.25 mL of 60% PEG Solution, slowly adding into the inner wall of a centrifuge tube, slowly reversing and uniformly mixing the liquid on the inner wall, horizontally placing at room temperature and standing for 20 min;

(17) Adding 5mL of STC buffer into the mixed solution, uniformly mixing, adding 1mL into each SMM screening culture medium (supplementing nutritional deficiency Pydoxin), and pouring 5mL melted SMM top culture medium;

(18) Inverted culturing at 37deg.C for 2-3 days.

4. Screening and identification of Aspergillus nidulans positive transformants

(1) Transferring 8-12 selected transformants to GMM (supplementary auxotroph Pyridoxine) plate with sterilizing gun head, and culturing at 37deg.C for 3 days;

(3) Scraping a small amount of spores by using a sterilizing gun head, inoculating the spores into 4mL of LMM (nutrient deficiency supplementing pyredoxine) culture medium, and standing and culturing the spores at 37 ℃ for 24 h;

(4) The genomic DNA of the transformants was extracted, PCR verified and electrophoretically analyzed with the identifying primers (Table 1), and positive transformants were selected for subsequent secondary metabolite analysis.

Conclusion of experiment: according to FIG. 4, 34-5'F1 and maker-R, and maker-F and 34-3' -R2 were primers on two pairs of knockout cassettes, respectively, showing that the knockout cassettes had been inserted into A.nidulans protoplasts according to the band size, while 34-F and 34-R were full-length primers for the transcription factor ANIA03334, the gene electrophoresis bands were not found in 1 and 9, indicating that the gene had been successfully knocked out, indicating that numbers 1 and 9 were positive transformants in A.nidulans positive transformants.

5. Extraction of Aspergillus nidulans genome

(1) Taking out spore +4mL LMM (supplementing auxotroph Pyridoxine) with bacteria at-20deg.C, and culturing at 37deg.C for 24 h;

(2) Picking thalli, sucking water by using paper towel, transferring the thalli into a 1.5 mL EP pipe, adding 400 mu L LETS buffer and sterilizing steel balls, and grinding the thalli by 70 Hz for 30 s;

(3) Adding 300 [ mu ] L of LETS buffer, and standing for 15 min;

(4) Adding 700 mu L PCI, reversing for 10-15 times, standing for 5 min, and centrifuging at 12000 rpm for 10 min at 4 ℃;

(5) Taking 400 mu L of supernatant, adding 800 mu L of 95% ethanol, mixing the mixture upside down, and centrifuging the mixture at a temperature of 4 ℃ and at a speed of 12000 rpm for 10 min;

(6) Discarding the supernatant, adding 200 mu L of 75% ethanol, and washing the precipitate upside down;

(7) Centrifuging at 13000 rpm for 2 min at room temperature, discarding supernatant, sucking residual liquid as much as possible, standing at room temperature for 1 h, volatilizing residual liquid;

(8) 50 mu L of TE Buffer and RNase (final concentration is 10 mg/mL) are added, and the mixture is incubated for 30 min at 37 ℃;

(9) Treating at 65deg.C for 5 min to inactivate RNase, extracting gDNA, and preserving at-20deg.C.

6. Culture of Aspergillus nidulans knockout positive transformant, strain fermentation and product extraction

(1) Strain fermentation

Aspergillus nidulans control strain RJMP1.49 and mutant strain 34 glycerinum were streaked on GMM solid plates for activation, cultured at 37℃for 3 d, inoculated with 5mL of 0.1% Tween 80 in a liquid PDB medium, and placed at 28℃for 5 d with shaking at 200 rpm for 3 replicates per strain.

(2) Product extraction

Filtering the supernatant of the fermentation product, directly transferring to a rotary evaporator for concentration to obtain a fermentation crude extract, and dissolving the crude extract with methanol.

7. HPLC analysis

The fermentation products were analyzed using Vanquish Core HPLC system (Vanquish diode array detector) (Thermo Fisher Scientific, USA), comparing the accumulation of cordycepin in mutant versus wild strains, reverse phase analytical column (Assentis, C18, 5 μm, 2.1X1. 150 mm) (Sigma-Aldrich Co., USA), column temperature: 35. 10 mu L of sample is injected at the temperature of 0.8/mL/min, the mobile phase A is water, the mobile phase C is methanol, and the gradient elution conditions are as follows: 0-50 min 5% C,50-55 min 5% C,55-65 min 100% C, and the detection wavelength is set to 210 nm.

HPLC results show that after shaking culture in PDB liquid medium for 5 days, cordycepin (COR) yield is increased by about 2 times, and the maximum cordycepin yield is 1.034 mg/mL.

Conclusion of experiment: the cordycepin content was calculated from the HPLC analysis results of FIGS. 5 and 6, and the cordycepin content in the mutant strain was about 1.010036231 mg/mL, wherein the highest content could reach 1.034 mg/mL, and the cordycepin content in the control strain was about 0.504384701 mg/mL.

8. qRT-PCR

(1) RNA extraction

Aspergillus nidulans control strain RJMP1.49 and mutant strain 34 glycerol bacteria were streaked on GMM solid plates (plus a layer of sterilized cellophane) for 3 d, spore collection was ground with liquid nitrogen, and RNA extraction was performed according to Eastep Super total RNA extraction kit (Shanghai Probemat Biotechnology Co.) instructions.

(2) Reverse transcription reaction

Reverse transcription was performed using PrimeScript ™ RT Master Mix (Perfect Real Time) (Takara Bio Inc, beijin) kit instructions, the specific system is as follows:

5X PrimeScript RT Master Mix（Perfect Real Time） 2 μL

Total RNA 1μg

RNase Free dH ₂ O up to 10 μL

after mixing, reverse transcription reaction was carried out at 37℃for 15 min and 85℃for 5. 5 s.

（3）qRT-PCR

Gene quantification was performed using PrimeScript ™ RT Master Mix (Perfect Real Time) (Beijing Bao Ri doctor materials technology) kit instructions, with the apparatus Quantum studio 5 Real-Tiem PCR Instrument (96-well 0.2 mLBlock) (Thermo Fisher Scientific, USA), the quantitative primers of which are shown in Table 1, the specific system is as follows:

TB Green Premix Ex Taq II(Tli RNaseH Plus)（2X） 10 μL

PCR Forward Primer（10 μM） 0.8 μL

PCR Reverse Primer（10 μM） 0.8 μL

ROX Reference Dye or Dye（50X）0.4 μL

RT reaction (10-fold dilution of cDNA solution 1. Mu.l)

Sterilized water 7. Mu.L

PCR procedure:

Stage 1：95℃ 30 s

Stage 2：95℃ 5 s

60℃ 30 s

40 cycles

Dissociation Stage：95℃ 15 s

60 ℃ 30 s 95℃ 15 s

as shown in FIG. 7, the genes encoding the key enzymes for cordycepin synthesis in Aspergillus nidulans are the genes encoding the cns1, the cns2, the cns3 and the cns4, the expression level influences the synthesis of cordycepin. After the transcription factor ANIA0334 found in the invention is knocked out, the expression levels of the cns1, the cns2, the cns3 and the cns4 are obviously up-regulated, which proves that the transcription factor can regulate and control gene cluster expression of cordycepin synthesis, thereby influencing cordycepin synthesis.

While the foregoing is directed to the preferred embodiments of the present invention, it will be appreciated by those skilled in the art that various modifications and adaptations can be made without departing from the principles of the present invention, and such modifications and adaptations are intended to be comprehended within the scope of the present invention.

Claims

1. A construction method of engineering bacteria for synthesizing cordycepin is characterized in that: the engineering bacteria are Aspergillus nidulans mutant strains with ANIA03334 gene knocked out;

the nucleotide sequence of ANIA03334 is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2;

the construction method comprises the following steps:

s1, constructing an ANIA03334 gene knockout box;

2. The construction method according to claim 1, wherein: the construction of the ANIA03334 gene knockout box specifically comprises the following steps: and (3) quickly fusing a plurality of fragment genes, and selecting the pyrG gene as a screening tag to replace a target gene ANIA03334, wherein the primer sequence for constructing a knockout box is shown as SEQ ID NO.3-10, the primer sequence for vector identification is shown as SEQ ID NO.11-16, and the primer sequence for quantitative analysis is shown as SEQ ID NO. 17-28.

3. A method for synthesizing cordycepin is characterized in that: comprising the following steps: inoculating the engineering bacteria in the PDB liquid culture medium, fermenting and culturing, and separating and purifying the obtained fermentation culture solution to obtain cordycepin.

4. A method according to claim 3, characterized in that: the fermentation temperature is 25-30 ℃, and the fermentation time is 3-10 days.

5. An application of the engineering bacteria for synthesizing cordycepin of claim 1 in the production of cordycepin and its preparation.