CN110042061B

CN110042061B - High yield gibberellin GA3Gibberella fujikuroi mutant strain and application thereof

Info

Publication number: CN110042061B
Application number: CN201910304928.1A
Authority: CN
Inventors: 柳志强; 张博; 蒋欢; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2019-04-16
Filing date: 2019-04-16
Publication date: 2020-08-21
Anticipated expiration: 2039-04-16
Also published as: CN110042061A

Abstract

The invention discloses a high-yield gibberellin GA₃The mutant strain of Alternaria canescens, namely the rice bakanae disease GA-251 and the application thereof; the rice bakanae disease GA-251(Fusarium fujikuroi GA-251) is preserved in China center for type culture Collection, and the address: wuhan university, Wuhan, China, zip code 430072, preservation number: CCTCC NO: m2019201, date of deposit 2019, 3 months and 25 days. The strain is obtained by radiating and compounding lithium chloride and cobalt 60 to mutate protoplast, and the strain produces gibberellin GA₃The improvement is 20%. The method has the advantages of high titer, easy extraction of the final product and the like, and overcomes the defects of low fermentation titer and high cost of the prior art.

Description

High yield gibberellin GA3Gibberella fujikuroi mutant strain and application thereof

(I) technical field

The invention relates to a high-yield gibberellin GA₃The mutant strain of Gibberella fujikuroi, namely the rice bakanae disease GA-251 and the application thereof.

(II) background of the invention

Gibberellins (GAs) are plant hormones and are widely used in agriculture, forestry, horticulture, food brewing and other fields. The preparation method mainly comprises a plant extraction method, a chemical method and a microbial fermentation method, but the microbial fermentation method has the advantages of low production cost, small environmental pollution and the like, and has wide industrial application prospect. It was first discovered by the japanese plant pathologist Kenkichi Sawada in the study of rice bakanae disease, later on confirmed by his colleague eiichi kurosawa, who published a paper in 1926 showing that the symptoms of this disease can be replicated by the use of sterile fungal cultures and that he found that these secretions can also stimulate the growth of several seedlings other than rice. This milestone-meaningful publication was followed by a number of reports on the nature of the secreted substance, and in 1935 the chemist teijiiroyabuta, professor of agrochemicals at the university of tokyo, obtained purified samples with high biological activity, called gibberellins. Gibberellin can promote seed germination and plant growth to increase the yield of vegetables and fruits; can be used as a plant growth regulator to promote the growth and development of crops; has estrogen-like activity, and can promote scalp blood circulation in hair products.

Gibberellin GA₃Is a diterpenoid acid with a molecular formula C₁₉H₂₂O₆Molecular weight 346.37, melting point 233-.

GAs biosynthesis starts from GGDP via isopentenyl diphosphate (IPP), and yields kaurene after two cyclization steps from GGDP via copalyl pyrophosphate (CPP). The formation of GA by oxidation of kaurenol and kaurenal on C-19 to produce kaurenoic acid followed by oxidative contraction₁₂-an aldehyde. GA₁₂Hydroxylation of aldehydes to GA₁₄Aldehydes, then oxidized at C-7 to form GA₁₄， GA₁₄Conversion to GA by oxidation₄，GA₄Generation of GA by satiety removal₇Then converted to GA by hydroxylation₃。

In 1970, high-yield varieties of 4303 are screened in China, but the high-yield varieties have no spore production capability and are multi-core hypha, so that continuous breeding is very difficult. The current production titer is in a state of lingering, and some production strains are degenerated. The Chinese invention patent (publication No. CN104892554A) describes about gibberellin GA₃The preparation method of the gibberellin-producing strain has no report on the gibberellin-producing strain with high yield and application thereof, and the yield of the traditional strain is always 1.8-2 g, so that the yield is to be further improved.

Disclosure of the invention

The invention aims to provide a high-yield gibberellin GA₃The strain can be applied to industrial production, has higher yield capacity under the condition of the same culture cost, can provide profits for industrial production, has less impurities at the later stage of fermentation, and can reduce extraction and separation work.

The technical scheme adopted by the invention is as follows:

high-yield gibberellin GA₃The mutant of Chimonanthus canescens (Chimonanthus canescens) ─ gThe rice bakanae disease GA-251(Fusarium fujikuroi GA-251) is preserved in China center for type culture Collection, address: wuhan university, Wuhan, China, zip code 430072, preservation number: CCTCC NO: m2019201, date of deposit 2019, 3 months and 25 days.

The process for obtaining the strain of the invention is as follows:

1. the specific method refers to the research of high-efficiency transformation method of exogenous gene of Gibberella protoplast such as Gibberella cinnabarina (proceedings of Zhejiang university, 2013, 41(5), 482-

2. By cobalt 60-gamma radiation (Co)⁶⁰Gamma-ray), lithium chloride single-factor mutagenesis and compound mutagenesis to obtain the gibberella barnacne GA-251.

The 18s rDNA sequence of the rice bakanae disease GA-251 is shown in SEQ ID NO. 1.

The invention also relates to application of the bakanae disease of rice GA-251 in preparation of gibberellin by microbial fermentation.

Specifically, the bakanae disease of rice GA-251 is used for preparing gibberellin GA by microbial fermentation₃。

Specifically, the application is as follows: inoculating the bakanae disease oryzae GA-25 to a fermentation culture medium, and performing fermentation culture at 20-30 ℃ and 200-300 rpm for 12-48 h to obtain GA containing gibberellin₃The fermentation liquor of (1) is separated and purified to obtain gibberellin GA₃。

The fermentation medium comprises the following components: 60-90 g/L of corn starch, 70-100 g/L of rice flour, 3-7 g/L of soybean flour, 3-7 g/L of peanut powder and K₂SO₄0.3～0.7g/L，KH₂PO₄0.3-0.7 g/L, water as solvent, natural pH, and sterilizing at 121 ℃ for 30 min.

Preferably, the rice bakanae disease GA-25 is firstly inoculated to a slant culture medium, the activated strain is inoculated to a seed culture medium, a seed solution is obtained by seed culture, and then the seed solution is inoculated to a fermentation culture medium, wherein the slant culture medium comprises the following components: 150-200 g/L of potato, 10-30 g/L of cane sugar, 0.1-0.3 g/L of magnesium sulfate, 0.1-0.3 g/L of calcium carbonate and 20g/L of agar, wherein the pH is natural, and the potato is sterilized for 30min at 115 ℃; the seed culture medium comprises the following components: 10-30 g/L of corn starch, 10-30 g/L of cane sugar, 10-30 g/L of peanut powder, 10-30 g/L of soybean meal, 0.5-1.5 g/L of monopotassium phosphate and 0.5-1.5 g/L of magnesium sulfate, wherein the pH is natural, and the sterilization is carried out for 30min at 121 ℃.

The invention has the following beneficial effects:

1. the invention provides a gibberella bardawil mutant strain for high yield of gibberellin, wherein conidia are not generated in the growth process of the strain;

2. the invention provides gibberellin GA₃The fermentation method of (1), which employs GA that produces gibberellin₃(ii) a The strain is inoculated into a liquid seed culture medium, and is transferred into a fermentation culture medium after cells grow mature, so that the fermentation level is greatly improved, the yield of gibberellin reaches 21 times of that of wild bacteria, and the strain is the international leader. Gibberellin is secreted extracellularly and can be directly obtained from fermentation liquor in a gathering way, which is beneficial to solid-liquid separation and increases the extraction yield. Meanwhile, the utilization rate of equipment and raw materials is improved, the production cost is greatly reduced, and the economic benefit and the social benefit are obvious;

3. the invention can be implemented on the existing pharmaceutical production equipment without additional investment.

(IV) description of the drawings

FIG. 1 is the electrophoresis picture of the PCR amplified argrose of the 18S rDNA sequence of the strain.

FIG. 2 shows the mycelium morphology under electron microscope observation.

FIG. 3 shows the change in GA3 content in the fermentation broth.

FIG. 4 is a graph showing pH change in fermentation broth.

FIG. 5 shows the change in dry weight of GA-251 fermentation.

FIG. 6 shows a GA3 High Performance Liquid Chromatography (HPLC) standard curve.

FIG. 7 shows the effect of different fermentation temperatures on the production of the strain GA-251GA3

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: preparation of wild Alternaria lutea protoplast

(1) Preparing a bevel: inoculating the wild Alternaria barnacle strains into a slant culture medium, culturing for 3-7 days at 28 ℃, and transferring to a seed solution after aerial hyphae grow over the slant.

(2) Preparing a seed solution:

and (2) selecting a small piece of the bacteria in the step (1), inoculating the small piece of bacteria into a seed culture medium, and culturing at 28 ℃ and 250rpm for 48 hours to obtain a seed solution. The seed culture medium is prepared by the following method: 20g/L of corn starch, 20g/L of cane sugar, 20g/L of peanut powder, 20g/L of soybean powder, 1.0g/L of monopotassium phosphate and 1.0g/L of magnesium sulfate, wherein the solvent is tap water, the pH is natural, and the sterilization is carried out for 30min at 121 ℃.

(3) Fermentation culture

And (3) shaking a flask with the specification of 250mL, filling 40mL of fermentation medium, inoculating a seed solution with the volume concentration of 1-4% during fermentation, and carrying out fermentation culture at 28 ℃ and 250rpm for 168 h. The fermentation medium comprises the following components: 80g/L of corn starch, 80g/L of rice flour, 5g/L of soybean flour, 5g/L of peanut powder and K₂SO₄0.5g/L，KH₂PO₄0.5g/L, the solvent is tap water, the pH is natural, and sterilization is carried out for 30min at 121 ℃.

(4) Protoplast preparation

A small piece of the strain was inoculated from the slant into YEPD liquid medium (yeast extract 0.3%, peptone 1%, glucose 2%, solvent water) and cultured at 28 ℃ and 180rpm for 48 hours. 2ml of the suspension was added to a sterile Eppendorf tube and washed once with sterile water and once with 1M MgSO 4. A small amount of hyphae was dipped in 1.5mL of filter-sterilized cell-wall breaking buffer (1M MgSO4, total enzyme concentration 15mg/mL, wherein Dryslase: Yatalase ═ 3:7) with a sterilized tip, blown up uniformly, and placed in a 30 ℃ water bath shaker for reaction for 45 minutes (the protoplast production rate was 95% or more). Centrifuging at 5000rpm for 10min, transferring 0.75mL of supernatant to another centrifuge tube, adding equal amount of sterile water, mixing well, centrifuging at 6000rpm for 5min, and discarding supernatant. The cell pellet was suspended with 1mL of 1M sorbitol and protoplasts were successfully prepared. After microscopic examination, the protoplast can be recovered by diluting the protoplast with proper times and plating the protoplast on MYG culture medium (0.5% maltose, 1% glucose, 0.5% yeast powder, 5M sucrose, 2% agar and water as solvent). The control was suspended in sterile water, diluted and plated. Counting by a blood counting plate to measure the protoplast contained in a unit volumeAnd (4) counting. And diluting the protoplast solution to 10⁶～10⁷one/mL.

Example 2: high yield GA₃Screening of mutant strains

(1) Inoculating wild type Gibberella fujikuroi to a slant culture medium, culturing for 3-7 days at 28 ℃, inoculating a small bacterium block to a YEPD liquid culture medium (yeast extract is 0.3%, peptone is 1%, glucose is 2%, and solvent is water) from the slant, washing once by using sterile water and saline buffer solution, taking a small amount of hypha, adding a wall breaking buffer solution, placing in a 30 ℃ water bath shaking table for reaction for 45 minutes, centrifuging at 3000rpm for 10 minutes, discarding supernatant, washing once by using sterile water, and adding the buffer solution for suspension.

(2)Co⁶⁰The mutagenesis method comprises the following steps: coating the activated strain in the step (1) on a MYG solid culture medium (maltose 0.5%, yeast powder 0.5%, glucose 1%, sucrose 5M and agar 2%), culturing at 28 ℃ for 3-7 days until a bacterial colony grows out, preparing protoplast through the step (1), and controlling the bacterial count to be about 10⁷Co at different doses (0Gy, 200Gy, 400Gy, 600Gy, 800Gy, and 1000Gy) per mL⁶⁰The protoplasts were subjected to mutagenesis. Will pass through Co⁶⁰Mutagenized protoplasts were diluted to 10 with physiological saline^-5Coating on MYG plate culture medium, culturing at 30 deg.C for 5 days, primarily screening large bacteria colony and dense aerial silk strain, selecting single bacterial colony, fermenting, collecting fermentation liquid, and detecting yield by HPLC method until high yield GA is obtained₃And (c) a mutant strain. The number of mutations, mutation rate and lethality rate are shown in Table 1.

Table 1: co⁶⁰Mutagenesis method mutagenesis process

(3)LiCl-Co⁶⁰The mutagenesis method comprises the following steps: placing 5mL of the protoplast suspension prepared in the step (1) into a sterile ep tube, and treating by using LiCl after the step (2) in a way that: stirring 1mg/mL lithium chloride (LiCl) with 1M sorbitol buffer solution for 0.5h per 1mL thallus suspension, centrifuging at 6000rpm for 5min, collecting thallus, cleaning with sterile water for 3 times, suspending, spreading in MYG solid culture medium, culturing at 28 deg.C, and performing primary cultureScreening large bacterial colony and dense aerial hypha bacterial strain, selecting single bacterial colony, fermenting, collecting fermentation liquid, detecting yield by HPLC method, and obtaining high-yield GA₃And (c) a mutant strain. The number of mutations, mutation rate and lethality rate are shown in Table 2.

Table 2: ultraviolet-nitrosoguanidine compound mutagenesis process

For the high-producing strain obtained by each round of mutagenesis, composite mutagenesis was performed again as the original strain in the same manner as described above. Final screening to obtain GA₃The mutant strain GA-251 with the yield of 2-4 g/L is named as Gibberella fugaufujikuroi (Fusarium fujikuroi) GA-251, is preserved in China center for type culture collection, and has the preservation date of 2019, No. 3 and No. 25, and the preservation number is CCTCCNO: m2019201, the preservation address is Wuhan, Wuhan university, China, zip code 430072.

The present invention includes, but is not limited to, the above three mutagenesis methods.

The preparation of MYG solid medium comprises the following steps: maltose 0.5%, yeast powder 0.5%, glucose 1%, sucrose 5M, agar 2%, and tap water as solvent, with natural pH, and sterilizing at 121 deg.C for 20 min.

Preparation of YEPD culture medium: yeast extract 0.3%, peptone 1%, glucose 2%, and solvent tap water, with natural pH, sterilizing at 121 deg.C for 20 min.

Example 3: 18S rDNA molecular identification

(1) DNA extraction: taking hyphae for centrifugation, taking a small amount of hyphae, putting the hyphae into a 1.5mL EP tube, adding 978 mu L of sodiumphosphate buffer, and suspending thalli; transferring the bacterial suspension into a lysine Matrix E Tube, adding 112 mu L MTBuffer, and uniformly mixing; using MP

The homogeneous disruptor disrupts the cells at a speed of 6.0 for 40 seconds; centrifuging at 12000rpm for 10min to remove sample debris; transferring the supernatant to a new EP tube, adding 250 μ L PPS reagent, holding the centrifuge tube, shaking for 10 times to mix, 12000Centrifuging at rpm for 5 min; transferring the supernatant to a 10mL clean centrifuge tube, adding 1mL Binding Matrix subspension, turning the centrifuge tube upside down for 2min, standing for 3min to attach DNA to the Binding Matrix, and waiting for the precipitation of a silicon dioxide Matrix; carefully removing 500. mu.L of supernatant (to avoid sucking out the precipitate), mixing the rest supernatant with the precipitate, sucking about 600. mu.L of the mixed solution, transferring into SPIN Filter, centrifuging at 12000rpm for 1min, discarding the filtrate, transferring the rest liquid to SPIN Filter, centrifuging, and discarding the filtrate; adding 500 μ LSEWS-M solution, centrifuging at 12000rpm for 1min, discarding the filtrate, centrifuging the SPIN Filter for 2min, transferring the SPIN Filter to a new catch tube, and drying at room temperature for 5 min; adding 50 μ L DES solution, standing at room temperature for 1min, and centrifuging at 12000rpm for 1min, wherein the filtrate in catch tube is the genome of the extracted strain.

(2) PCR amplification and sequence analysis of fungal 18S rDNA: fungus ribosome ITS rDNA universal primer

The primers used were as follows:

ITS1	5’-TCCGTAGGTGAACCTGCGG-3’
		ITS4	5’-TCCTCCGCTTATTGATATGC-3’

wherein the cloning of the PCR system: add 10 XTaq Buffer (Mg +) 5. mu.L, add 10mM dNTPs 1. mu.L, Taq DNApolymerese 0.5. mu.L, ITS1 and ITS4 primers 0.5. mu.L each, template 1.5. mu.L, make up deionized water to 50. mu.L.

Wherein the cloning PCR procedure: denaturation at 95 ℃ for 45s, annealing at 55-60 ℃ for 30s, and extension at 72 ℃ for 45 min for 35 cycles. And finally extension at 72 ℃ for 30 s.

(3) 5 mu L of PCR amplification product is taken for agarose gel electrophoresis experiment and observed and analyzed by a gel imager. If the band is clear and error-free (about 500 bp), the PCR product is recovered by gel. And 5 mu L of the recovered products are respectively taken for agarose gel electrophoresis verification, and if the bands are clear and have correct sizes, the recovered samples can be used for sequencing. Sequencing is completed by Hangzhou Optingke Cathi Biotechnology Limited, and sequencing primers are the same as PCR primers. Sequence alignment was performed using the NCBI blast (http:// blast. NCBI. nlm. nih. gov /) database.

Sequencing was performed by Hangzhou Zhikexi Biotechnology Limited, as follows (SEQ ID NO. 1):

ggtccggccgggcctttccctctgtggaaccccatgcccttcactgggtgtggcggggaa60

acaggacttttactgtgaaaaaattagagtgctccaggcaggcctatgctcgaatacatt 120

agcatggaataatagaataggacgtgtggttctattttgttggtttctaggaccgccgta 180

atgattaatagggacagtcgggggcatcagtattcaattgtcagaggtgaaattcttgga 240

tttattgaagactaactactgcgaaagcatttgccaaggatgttttcattaatcaggaac 300

gaaagttaggggatcgaagacgatcagataccgtcgtagtcttaaccataaactatgccg 360

actagggatcggacggtgttattttttgacccgttcggcaccttacgagaaatcaaagtg 420

cttgggctccagggggagtatggtcgcaaggctgaaacttaaagaaattgacggaagggc 480

accaccaggggtggagcctgcggcttaatt510

similarity analysis of the obtained sequence and data stored in genBank shows that the microorganism identified in the experiment has the highest homology (homology, 99%/510 bp, based on 18S rDNA) with Fusarium fujikuroi, and the identity of the identified bacteria belongs to the control bacteria basically based on the 18S rDNA sequence homology higher than 99% according to the identification principle of microbial molecular genetics.

Example 4: physiological and biochemical identification

The metabolism of the strains on 95 carbon sources was investigated using a Biolog automated microbial identification system: inoculating the strain to PDA plate culture medium, culturing at 28 deg.C for 5 days, washing thallus on the plate with sterile cotton swab, mixing with inoculating solution (FF-IF), making into bacterial suspension, and adjusting to 75% T/FF (reference value: 75% +/-3%) with turbidimeter. The bacterial suspensions were added to each well of a Biolog FF microwell assay plate using an 8-well electric applicator, 100 μ l per well. The microwell assay plates were placed in a 28 ℃ incubator and read on a Biolog reader after 24h, 48h, 72h, 96h, 168h, and 240h incubation, respectively. The data of each time point read by the Biolog reading instrument are comprehensively considered, and the result of 24h identification is given.

Physiological and biochemical identification is carried out on wild strains according to the method, a Biolog automatic microorganism identification system is utilized to investigate the metabolism condition of the strains on 95 carbon sources, each time point data read by a Biolog reading instrument is comprehensively considered, and 24h identification results are given, and are shown in table 3.

Table 3: capability of strain GA-251 to utilize 95 carbon sources on Biolog FF plate

Notes:+,positive；-,negative；B,borderline

Example 5: electron microscope observation of high-yield GA3 strain

(1) And (3) strain culture: selecting slant strain preservation liquid by using an inoculating loop, marking out a PDA flat plate, culturing for 5d at 28 ℃, selecting a well grown strain block, inoculating into a seed culture medium, culturing for 2d at 250rpm and 28 ℃, and waiting for treatment.

(2) And (3) thallus treatment: (a) 1mL of the hypha seed solution was dispensed into 2.5% glutaraldehyde and left overnight in a refrigerator at 4 ℃. (b) The overnight cells were centrifuged at 4000-. (c) Adding phosphate buffer solution, sucking out buffer solution every 15min, and repeating the steps for three times at random. (d) Adding osmate, and standing for 1.5 h. (e) And c, repeating the step b. (f) Adding 30%, 50%, 70%, 80%, 90%, 95% ethanol, and sucking out ethanol every 15 min. (g) Adding absolute ethyl alcohol, storing, and observing by SEM.

GA-251 strain cultured on potato Plates (PDA) at 28 deg.C for 5 days was treated as described above, and analyzed by SEM scanning electron microscopy, the results of which are shown in FIG. 2. Scanning electron microscope with SU-8010SEM is adopted, magnification in the figure is 1000 times, and morphological characteristics of the strain observed under the scanning electron microscope are smooth and dense hyphae and criss-cross.

Example 6: mutant strain GA-251 for producing GA3 by fermentation

(1) Preparing a bevel: the gibberellin-producing mutant strains of gibberellin-producing fungi of the present invention prepared in example 1 were inoculated into a slant culture medium and cultured at 28 ℃ for 3-7 days until aerial hyphae were grown over the slant and were transferred to the seed solution.

(2) Preparing a seed solution:

and (2) selecting a small piece of the bacteria in the step (1), inoculating the small piece of bacteria into a seed culture medium, and culturing at 28 ℃ and 250rpm for 48 hours to obtain a seed solution.

The seed culture medium is prepared by the following method: 20g/L of corn starch, 20g/L of cane sugar, 20g/L of peanut powder, 20g/L of soybean powder, 1.0g/L of monopotassium phosphate and 1.0g/L of magnesium sulfate, wherein the solvent is water, the pH is natural, and the sterilization is carried out for 30min at 121 ℃.

(3) Fermentation culture

And (3) shaking a flask with the specification of 250mL, filling 40mL of fermentation medium, inoculating a seed solution with the volume concentration of 1-4% during fermentation, and carrying out fermentation culture at 28 ℃ and 250rpm for 168 h. During the fermentation process, GA in the fermentation liquor₃The content changes are shown in figure 3, and the pH changes in the fermentation liquor are shown in figure 4; the mutant bacteria dry weight change is shown in FIG. 5.

The fermentation medium comprises the following components: 80g/L of corn starch, 80g/L of rice flour, 6g/L of soybean meal, 5g/L of peanut powder and K₂SO₄0.5g/L，KH₂PO₄0.5g/L, the solvent is tap water, the pH is natural, and sterilization is carried out for 30min at 121 ℃.

The mutant strain is produced by shake flask fermentation, and is detected according to the method of example 7, and GA in the obtained fermentation liquid₃The content was 2100 mg/L.

Example 7: GA₃HPLC detection method of

The fermentation broth prepared in example 6 was centrifuged at 12000rpm for 5min, and the supernatant was filtered through a 0.45 μm organic membrane and then detected by High Performance Liquid Chromatography (HPLC).

Detection ofThe method comprises subjecting the chromatographic column to C18 column (150 × 4.6.6 mm) at 32 deg.C, flow rate of 0.6 mL/min, sample size of 20 μ L, chromatographic retention time of 30min, and detection wavelength of 210 nm.GA₃The peak-off time of (1) was 14 min.

The preparation method of the mobile phase comprises the following steps: 0.5mL of phosphoric acid was diluted with water to 1L, and 600mL of the solution was mixed with 400mL of methanol;

GA₃the yield calculation method comprises the following steps: GA purchase from BBI Life Sciences₃The standard (c) was prepared by using methanol to prepare GA at different concentrations (0mg/L, 200mg/L, 400mg/L, 800mg/L, 1000mg/L)₃Standard solutions, respectively detecting peak area of the above standard solutions by HPLC, and determining peak area and GA₃The concentration of the standard solution was calculated as Y-28123X-50.41 and R2-0.999 (wherein Y is GA)₃X is the peak area). The GA of unknown concentration₃The sample can obtain a peak area through HPLC detection, the peak area is substituted into the formula of the standard curve to obtain the concentration, and the result of the standard curve is shown in FIG. 6.

Example 8: fermentation temperature optimization of shake flask fermentation system

The same procedures as in example 6 were carried out except that the fermentation temperature in example 5 was changed to 25 ℃, 28 ℃, 30 ℃, 32 ℃ and 37 ℃ respectively, and GA in the fermentation broth was detected by the detection method in example 7₃The results are shown in FIG. 7.

The fermentation temperature was optimized at 28 ℃ and reached a maximum yield of about 2.1g/L over 168 hours. When the temperature exceeds 30 ℃, GA₃The yield is lower than the yield at the optimum temperature.

Sequence listing

<110> Zhejiang industrial university

Gibberella fujikuroi mutant strain of high-yield gibberellin GA3 and application thereof

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>510

<212>DNA

<213>Fusarium fujikuroi

<400>1

ggtccggccg ggcctttccc tctgtggaac cccatgccct tcactgggtg tggcggggaa 60

acaggacttt tactgtgaaa aaattagagt gctccaggca ggcctatgct cgaatacatt 120

agcatggaat aatagaatag gacgtgtggt tctattttgt tggtttctag gaccgccgta 180

atgattaata gggacagtcg ggggcatcag tattcaattg tcagaggtga aattcttgga 240

tttattgaag actaactact gcgaaagcat ttgccaagga tgttttcatt aatcaggaac 300

gaaagttagg ggatcgaaga cgatcagata ccgtcgtagt cttaaccata aactatgccg 360

actagggatc ggacggtgtt attttttgac ccgttcggca ccttacgaga aatcaaagtg 420

cttgggctcc agggggagta tggtcgcaag gctgaaactt aaagaaattg acggaagggc 480

accaccaggg gtggagcctg cggcttaatt 510

Claims

1. High-yield gibberellin GA₃The mutant strain of Gibberella fujikuroi, namely GA-251(Fusarium fujikuroi GA-251), is preserved in China center for type culture Collection, with the address: wuhan university, Wuhan, China, zip code 430072, preservation number: CCTCC NO: m2019201, date of deposit 2019, 3 months and 25 days.

2. The dirofusoryzae GA-251 of claim 1, wherein the 18s rDNA sequence of dirofusoryzae GA-251 is shown in SEQ ID No. 1.

3. Production of gibberellin GA by microbial fermentation of bakanae disease GA-251 as claimed in claim 1₃The use of (1).

4. The use according to claim 3, characterized in that the use is: inoculating the bakanae disease oryzae GA-25 to a fermentation culture medium, and performing fermentation culture at 28 ℃ and 250rpm for 168h to obtain GA containing gibberellin₃The fermentation liquid of (2) is added,the fermentation liquor is separated and purified to obtain gibberellin GA₃。

5. The use according to claim 4, characterized in that the fermentation medium consists of: 60-90 g/L of corn starch, 70-100 g/L of rice flour, 3-7 g/L of soybean flour, 3-7 g/L of peanut powder and K₂SO₄0.3～0.7g/L，KH₂PO₄0.3-0.7 g/L, water as solvent, natural pH, and sterilizing at 121 ℃ for 30 min.

6. The use of claim 4, wherein the Xanthomonas oryzae GA-25 is inoculated to a slant culture medium, the activated strain is inoculated to a seed culture medium, a seed solution is obtained by seed culture, and then the activated strain is inoculated to a fermentation culture medium, wherein the slant culture medium comprises the following components: 150-200 g/L of potato, 10-30 g/L of cane sugar, 0.1-0.3 g/L of magnesium sulfate, 0.1-0.3 g/L of calcium carbonate and 20g/L of agar, wherein the pH is natural, and the potato is sterilized for 30min at 115 ℃; the seed culture medium comprises the following components: 10-30 g/L of corn starch, 10-30 g/L of cane sugar, 10-30 g/L of peanut powder, 10-30 g/L of soybean meal, 0.5-1.5 g/L of monopotassium phosphate and 0.5-1.5 g/L of magnesium sulfate, wherein the pH is natural, and the sterilization is carried out for 30min at 121 ℃.