CN116064361A

CN116064361A - Escherichia coli engineering bacteria for producing N-acetylneuraminic acid and application thereof

Info

Publication number: CN116064361A
Application number: CN202211469338.2A
Authority: CN
Inventors: 刘振云; 应露; 倪磊; 程丰伟
Original assignee: Suzhou Yixi Biotechnology Co ltd
Current assignee: Suzhou Yixi Biotechnology Co ltd
Priority date: 2022-11-22
Filing date: 2022-11-22
Publication date: 2023-05-05

Abstract

The invention relates to the technical field of genetic engineering, in particular to an escherichia coli engineering bacterium for producing N-acetylneuraminic acid, and a construction method and application thereof. The invention further optimizes the metabolic path from glucose to N-acetylmannosamine based on the existing engineering bacteria, knocks out the glmM gene to reduce the generation of irrelevant metabolites, and the finally used genetic engineering bacteria has greatly improved Neu5Ac production capacity of escherichia coli in fermentation experiments, thereby having fermentation industrial application prospect.

Description

Escherichia coli engineering bacteria for producing N-acetylneuraminic acid and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an escherichia coli engineering bacterium for producing N-acetylneuraminic acid, and a construction method and application thereof.

Background

Sialic acids are a class of 9-carbon monosaccharide derivatives, widely distributed in the natural organism, involved in various biological pathways, such as: growth and development, reproductive process, immune recognition, etc. N-acetylneuraminic acid (Neu 5 Ac) is one of the most important sialic acids, and plays an important role in the brain development and immunity enhancement of infants. The traditional Neu5Ac obtaining mode comprises natural substance extraction, enzymatic synthesis, microbial fermentation and the like. The microbial fermentation method is widely used for obtaining high yield by fermenting microorganisms with inexpensive substances through certain genetic modification, wherein escherichia coli has clear genetic information, convenient gene editing, low culture cost and the like.

Disclosure of Invention

Problems to be solved by the invention

The current microbial fermentation method for producing Neu5Ac usually takes escherichia coli as chassis bacteria, and is realized by knocking out a NeuAc transporter (nanT), a NeuAc aldolase gene (nanA), an N-acetylmannosamine kinase gene (nanK), an N-acetylmannosamine-6-phosphate 2-epimerase (nanE), a glucosamine-6-phosphate deaminase gene (nagB), an N-acetylglucosamine-6-phosphate acetylase gene (nagA), over-expressing an exogenous acetylneuraminic acid synthase gene (neuB), an exogenous N-acetylglucosamine isomerase gene (neuC), or over-expressing an exogenous N-acetylglucosamine-2-isomerase (AGE), exogenous nanA with high-efficiency catalytic activity and the like, and synthesizing N-acetylglucosamine (GlcNAc), pyruvic acid and the like as substrates or synthesizing glucose, glycerol and the like from the head as carbon sources. The method of fermenting and synthesizing by using the substrate has a certain breakthrough in yield, but has the problems of expensive raw materials, harsh reaction conditions and the like. The fermentation method synthesized from the head has the problems of low metabolic flow of target products and the like, so that the yield of the target products is inferior to that of a substrate fermentation method, but the raw materials are cheap, the fermentation is easier to operate, and the method has more application prospects in industrial production, so that the search of a more suitable synthesis way is very important.

Solution for solving the problem

In one aspect, the invention provides a recombinant E.coli, wherein the recombinant E.coli is silenced or knocked out of the glmM gene encoding phosphoglucosamine mutase on the genome.

Preferably, the recombinant E.coli is also silenced or knocked out of the genomic encoding the NeuAc aldolase gene nanA and/or the NeuAc transporter gene nanT and/or the N-acetylmannosamine-6-phosphate 2-epimerase gene nanE and/or the N-acetylmannosamine kinase gene nanK;

preferably, the recombinant E.coli is also silent or knocked out of a gene cluster nanATER comprising four genes together encoding nanA, nanT, nanE and nanK.

Preferably, the recombinant escherichia coli further silences or knocks out the gene nagE encoding the N-acetylglucosamine-specific EIICBA component gene nagB and/or the glucosamine-6-phosphate deaminase gene nagA on the genome;

preferably, the recombinant E.coli is also silent or knocked out of a gene cluster nagEBA comprising three genes encoding nagE, nagB and nagA joined together on the genome.

Preferably, the recombinant E.coli has introduced the NeuAc aldolase gene nanA, preferably, the nanA gene is derived from MG1655, klebsiella quasipneumoniae, staphylococcus hominis subsp.hominis C80 or a microorganism expressing the same functional enzyme;

preferably, the nucleotide sequence of the coding nanA gene is shown in a sequence table SEQ ID NO. 1.

Preferably, the recombinant escherichia coli is introduced with an N-acetylglucosamine-2-isomerase gene AGE, wherein the AGE gene is derived from Anabaena sp.CH1, synechocystis sp.PCC 6803 or a microorganism capable of expressing the same functional enzyme;

preferably, the nucleotide sequence of the AGE encoding gene is shown in a sequence table SEQ ID NO. 2.

Preferably, the recombinant E.coli has introduced a glucosamine-6-phosphate acetyltransferase gene GNA1, said GNA1 gene being derived from Saccharomyces cerevisiae S288C, pichia pastoris CBS 7435 or a microorganism capable of expressing the same functional enzyme;

preferably, the nucleotide sequence of the GNA1 gene is shown in a sequence table SEQ ID NO. 3;

preferably, the nucleotide sequence of the GNA1 gene is shown in a sequence table SEQ ID NO. 4.

Preferably, the E.coli is selected from E.coli BL21 (DE 3), E.coli K12 MG1655 and E.coli JM109; coli BL21 (DE 3) is preferred.

In one aspect, the present invention provides a process for producing N-acetylneuraminic acid, characterized in that the recombinant E.coli of any one of claims 1 to 7 is used as a fermentation strain and is cultivated at 30 to 37℃for at least 24 hours.

Preferably, the method utilizes glucose or glycerol as a carbon source for fermentation.

In one aspect, the invention provides the use of the recombinant E.coli described above in the fields of medicine, food and chemical industry;

preferably, the recombinant E.coli is used for producing a product containing N-acetylneuraminic acid.

ADVANTAGEOUS EFFECTS OF INVENTION

The invention further optimizes the metabolic path from glucose to N-acetylmannosamine based on the existing engineering bacteria, knocks out the glmM gene to reduce the generation of irrelevant metabolites, and the finally used genetic engineering bacteria has greatly improved Neu5Ac production capacity of escherichia coli in fermentation experiments, thereby having fermentation industrial application prospect.

Drawings

FIG. 1 is a simplified diagram of N-acetylneuraminic acid synthesis.

FIG. 2 is a liquid phase diagram of a product N-acetylneuraminic acid standard and a product sample.

Detailed Description

In order to make the technical scheme and the beneficial effects of the invention more obvious and understandable, the following detailed description is given by way of example. Wherein the drawings are not necessarily to scale, and wherein local features may be exaggerated or reduced to more clearly show details of the local features; unless defined otherwise, technical and scientific terms used herein have the same meaning as technical and scientific terms in the technical field to which this application belongs.

In some embodiments, the recombinant escherichia coli is further silenced or knocked out of the genomic coding NeuAc aldolase gene nanA.

And/or, in some embodiments, the recombinant e.coli is also silenced or knocked out of the genome encoding the NeuAc transporter gene nanT.

And/or, in some embodiments, the recombinant E.coli is also silenced or knocked out of the gene nanE encoding N-acetylmannosamine-6-phosphate 2-epimerase on the genome.

And/or, in some embodiments, the recombinant escherichia coli is further silenced or knocked out of the gene nanK encoding the N-acetylmannosamine kinase on the genome;

in some embodiments, the recombinant E.coli further silences or knocks out a gene cluster nanATEK comprising four genes together encoding nanA, nanT, nanE and nanK.

In some embodiments, the recombinant E.coli further silences or knocks out the nagE gene encoding the N-acetylglucosamine-specific EIICBA component on the genome.

And/or, in some embodiments, the recombinant escherichia coli is further silenced or knocked out of the gene nagB encoding glucosamine-6-phosphate deaminase on the genome.

And/or, in some embodiments, the recombinant E.coli is further silenced or knocked out of the gene nagA encoding N-acetylglucosamine-6-phosphate acetylase on the genome.

In some embodiments, the recombinant E.coli further silences or knocks out a gene cluster nagEBA comprising three genes encoding nagE, nagB and nagA joined together on the genome.

In some embodiments, the recombinant escherichia coli is introduced with the NeuAc aldolase gene nanA.

In some embodiments, the nanA gene is derived from MG1655, klebsiella quasipneumoniae, staphylococcus hominis subsp.hominis C80 or a microorganism capable of expressing the same functional enzyme.

In some embodiments, the nucleotide sequence encoding the nanA gene is set forth in sequence listing SEQ ID No. 1.

SEQ ID NO.1

ATGGAAGAACAGCTGAAAGGTCTGTACGCTGCTCTGCTGGTTCCGTTCGACGAAAACGGTCAGGTTAAAGAAGAAGGTCTGAAACAGATCGCTAAAAACGCTATCGAAGTGGAACAGCTGGACGGTCTGTACGTTAACGGTTCTTCTGGTGAAAACTTCCTGATCTCTAAAGAACAGAAAAAACAGATCTTCAAAGTTGTTAAAGAAGCTGTTGGTAACGACGTTAAACTGATCGCTCAGGTTGGTTCTCTGGACCTGAACGAAGCTATCGAACTGGGTAAATACGCTACCAACCTGGGTTATGACGCTCTGTCTGCTGTTACCCCGTTCTACTACCCGTTCTCTTTCGAAGAAATCAAACAGTACTACTTCGACATCATCGAAGCCACCCAGAACAAAATGATCATCTACGCTATCCCGGACCTGACCGGTGTTAACATCTCTATCAACCAGTTCGAGGAACTGTTCGACAACGAAAAAATCGTTGGTGTTAAATACACCGCTCCGAACTTCTTCCTGCTGGAACGTATCCGTAAAGCTTTCCCGGACAAACTGATCCTGTCTGGTTTCGACGAAATGCTGGTTCAGGCTGTTATCTCCGGTGTTGACGGTGCTATCGGTTCTACCTACAACGTTAACGGTCGTCGTGCCCGTCAGATCTACGACCTGGCTCGTGAAGGTAAAGTTGAAGAAGCTTACAAAATTCAGCACGACACCAACAACATCATCGAAACCGTTCTGTCTATGGGTATCTACCCGACCCTGAAAGAAATCCTGAAAACCCGCGGTATCGACGGTGGTGTTCCGAAACGTCCGTTCTCTCCGTTCAACGAAGCTAACCGTAAAGAAC

In some embodiments, the recombinant E.coli has introduced the N-acetylglucosamine-2-isomerase gene AGE.

In some embodiments, the AGE gene is derived from Anabaena sp.ch1, synechocystis sp.pcc 6803, or a microorganism capable of expressing the same functional enzyme.

In some embodiments, the nucleotide sequence of the AGE-encoding gene is shown in sequence Listing as SEQ ID No. 2.

SEQ ID NO.2

ATGATCGCTCACCGTCGTCAGGAACTGGCTCAGCAGTACTACCAGGCTCTGCACCAGGACGTTCTGCCGTTCTGGGAAAAATACTCTCTGGACCGTCAGGGTGGTGGTTACTTCACCTGCCTGGACCGTAAAGGTCAGGTTTTCGACACCGACAAATTCATCTGGCTGCAGAACCGTCAGGTTTGGCAGTTCGCTGTTTTCTACAACCGTCTGGAACCGAAACCGCAGTGGCTGGAAATCGCTCGTCACGGTGCTGACTTCCTGGCGCGTCACGGTCGTGACCAGGACGGTAACTGGTACTTCGCTCTGGACCAGGAAGGTAAACCGCTGCGTCAGCCGTACAACGTTTTCTCTGACTGCTTCGCTGCTATGGCTTTCTCTCAGTACGCTCTGGCTTCTGGTGCTCAGGAAGCTAAAGCTATCGCGCTGCAGGCTTACAACAACGTTCTGCGTCGTCAGCACAACCCGAAAGGTCAGTACGAAAAATCTTACCCGGGTACCCGTCCGCTGAAATCTCTGGCTGTTCCGATGATCCTGGCTAACCTGACCCTGGAAATGGAATGGCTGCTGCCGCCGACCACCGTTGAAGAAGTTCTGGCTCAGACCGTGCGTGAAGTTATGACCGACTTCCTGGACCCGGAAATCGGCCTGATGCGTGAAGCTGTTACCCCGACCGGTGAATTCGTTGACTCTTTCGAAGGTCGTCTGCTGAACCCGGGTCACGGTATCGAAGCTATGTGGTTTATGATGGACATCGCTCAGCGCTCTGGCGACCGTCAGCTGCAGGAACAGGCTATCGCTGTTGTTCTGAACACCCTGGAATACGCTTGGGACGAAGAATTCGGTGGTATCTTCTACTTCCTGGACCGTCAAGGTCACCCGCCGCAGCAGCTGGAATGGGACCAGAAACTGTGGTGGGTTCACCTGGAAACCCTGGTTGCTCTTGCTAAAGGTCACCAGGCTACCGGTCAGGAAAAATGCTGGCAGTGGTTCGAACGTGTTCACGACTACGCTTGGTCTCACTTCGCTGACCCGGAATACGGTGAATGGTTCGGTTACCTGAACCGTCGTGGCGAAGTTCTGCTGAACCTGAAAGGTGGTAAATGGAAAGGTGCTTTCCACGTTCCGCGTGCTCTGTGGCTGTGCGCTGAAACCCTGCAGCTGCCGGTTTCTTAA

In some embodiments, the recombinant E.coli has introduced the glucosamine-6-phosphate acetyltransferase gene GNA1.

In some embodiments, the GNA1 gene is derived from Saccharomyces cerevisiae S288C, pichia pastoris CBS 7435 or a microorganism capable of expressing the same functional enzyme;

in some embodiments, the nucleotide sequence encoding the GNA1 gene is set forth in sequence listing SEQ ID No. 3;

SEQ ID NO.3

ATGTCTCTGCCGGACGGTTTCTACATCCGTCGTATGGAAGAAGGTGACTTAGAACAGGTTACCGAAACCCTGAAAGTTCTGACCACCGTTGGTACCATCACCCCGGAATCTTTCTCTAAATTAATCAAATACTGGAACGAAGCTACCGTTTGGAACGACAACGAAGACAAAAAAATCATGCAGTACAACCCGATGGTTATCGTTGACAAACGTACCGAAACCGTTGCTGCTACCGGTAACATCATCATCGAACGTAAAATCATCCACGAACTGGGTCTGTGCGGTCACATCGAAGACATCGCTGTTAACTCTAAATACCAGGGTCAGGGTCTGGGTAAACTGCTGATCGACCAGTTAGTTACCATCGGTTTCGACTACGGTTGCTACAAAATCATCCTGGACTGCGACGAAAAAAACGTTAAATTCTACGAAAAATGCGGTTTCTCTAACGCTGGTGTTGAAATGCAGATCCGTAAATAA

in some embodiments, the nucleotide sequence encoding the GNA1 gene is set forth in sequence listing SEQ ID No. 4.

SEQ ID NO.4

ATGCAGCCGGTTTCTGTTCCGGCTCTGCCGCAGGGTTACAATCTGCGTCGTGTTGGTAAAGAAGACTTCCAGGACAAAAACCTGTTTAAAACCCTGTCTATCCTGACCACCGTTGGTGACATCCCGGAACCGAAATTCCACGCTCTGATCGAGTACTGGAACGACCGTAAAGAAATCTACAACCCGATGGTTATCACCAACGCTGAGAACGTTATCATCGCTACCGGTATGCTGTTCGTTGAACACAAACTGATCCACGGCGGTGGCAAAGTTGGTCACATCGAAGACATCTCTGTTAACCCGTCTGAACAGGGTAAAAAACTGGGTCTCATCATGATCCGTAACCTGATCCAGATCGCTCAGACCGAAGGTTGTTACAAAGTTATCCTGGACTGCGACGAAAAAAACGTTCGTTTCTACGAAAAATGCGGTATGAAAATCGAAGGTGTTGAAATGGGTTACCGTTTCTAA

In some embodiments, the escherichia coli is selected from escherichia coli BL21 (DE 3), escherichia coli K12 MG1655, and escherichia coli JM109.

In some embodiments, the escherichia coli is selected from escherichia coli BL21 (DE 3).

In some embodiments, the methods utilize glucose or glycerol as a carbon source for fermentation.

in some embodiments, the use of the recombinant E.coli described above for the production of a product comprising N-acetylneuraminic acid.

The following definitions and descriptions are illustrative of terms used in the present invention; when describing the present invention, unless otherwise indicated, technical and scientific terms used herein should have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosures and documents referred to herein are incorporated by reference.

nanA: neuAc aldolase

nanT: neuAc transporter

nanE: n-acetylmannosamine-6-phosphate 2-epimerase

nanK: n-acetylmannosamine kinase

nagE: n-acetylglucosamine-specific EIICBA component

nagB: glucosamine-6-phosphate deaminase

nagA: n-acetylglucosamine-6-phosphate acetylenzyme

AGE: n-acetylglucosamine-2-isomerase

GNA1: glucosamine-6-phosphate acetyltransferase

glmM: phosphoglucosamine mutase

glmS: glucosamine synthase

neuB: acetylneuraminic acid synthetase

neuC: n-acetylglucosamine isomerase

As used herein, the term "silent" or "knock-out" of a gene refers to the inactivation of the gene by deleting the coding box of the gene in whole or in part using techniques such as CRISPR gene editing.

As used herein, the terms "comprises" or "comprising" mean that any illustrated steps/operations, components, elements, etc. of the recited method, structure, or composition include any recited volume, but do not exclude any other steps/operations, components, elements, etc.

In the context of the present invention, where a range of values is recited, it is understood that each intervening value, to the upper and lower limit of that range and between each and every other stated or intervening value in that range is encompassed within the invention. The upper and lower limits of these smaller ranges independently combinable with the range are also encompassed within the invention, subject to any specifically excluded limit in the stated range. When a specified range includes one or both of the limits, ranges excluding either of those included limits are also within the invention.

The present invention will be described in more detail with reference to examples.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The gel recovery kit, high fidelity enzyme used was purchased from novalun.

The seamless connection kit and LB are purchased from the organism.

The pEcCas, pTargetS and pTargetD plasmids used were maintained in the laboratory and the remaining vectors used were purchased from the eubao organism.

The host bacteria used to transform the plasmids were DH 5. Alpha. Competent cells purchased from the indigenous organisms.

The BL21 (DE 3) host bacteria used were BL21 (DE 3) competent cells purchased from a indigenous organism.

The plasmid extraction kit was purchased from the root of the plant.

The gene synthesis, primer synthesis and sequencing were all completed by Jin Weizhi.

Comparative example 1

Control strain construction

1 construction of the knockout Strain

The chassis fungus used is BL21 (DE 3), and the knocked-out nanATER gene is a combination of four genes, namely nanA gene, nanT gene, nanE gene and nanK gene. The knocked nagEBA gene is the name of the nagE gene, nagB gene and nagA gene.

1.1 knockout of the nanATEK Gene

The pTargetD plasmid was amplified using primers nan-N20-1 and nan-N20-2 to obtain a 193bp fragment containing two N20 s required for the na TEK knockout, the pTargetS plasmid was amplified using primer DPZL-1-F/R to obtain a 2128bp vector fragment, the 2128bp vector fragment and the 193bp double N20 fragment were ligated to construct a pTargetD plasmid containing the target N20, and the plasmid was designated nan-N20-pTargetD, and a nan-N20-pTargetD monoclonal strain was selected and sequenced to detect whether the target N20 was constructed into the pTargetD plasmid. After the result to be sequenced is out, selecting the N20 plasmid which meets the purpose, and shaking the bacteria to extract the plasmid.

Performing inverse PCR on the successfully constructed nan-N20-pTargetD plasmid by using a primer pTargetD-HP-F/R to obtain a vector fragment, then using a primer nan-HL-F/R to obtain an upstream homology arm of the knocked-out plasmid, wherein the fragment size is 846bp, the sequence is named nan-HL, the sequence is used for obtaining a downstream homology arm of the knocked-out plasmid by using a primer nanR-R/nan-HR-R, the fragment size is 934bp, the sequence is named as nan-HR, connecting the amplified upstream and downstream homology arms with the vector fragment, constructing the knocked-out plasmid of nanATK, and identifying a monoclonal after plating and culturing overnight, wherein the used identification primers are as follows: pTargetT-F/R, selecting a successfully connected monoclonal and sequencing, and selecting a plasmid with correct sequencing as a knockout plasmid.

The pEcCas plasmid was transformed into BL21 (DE 3) competent cells, cultured overnight on kanamycin solid medium containing 50ug/ml, and one of the monoclonal strains was selected for shaking the next day as the chassis strain for subsequent knockout.

BL21 (DE 3) strain containing pEcCas plasmid cultured overnight is inoculated onto 20ml kanamycin liquid culture medium containing 50ug/ml at a ratio of 1:100, cultured for 1.5h, L-arabinose with a final concentration of 100mM is added, and after continuous culture for 1h, OD is detected ₆₀₀ The value is 0.6-0.8.

Ice-bath the cultured bacterial liquid for 30min, centrifuging at 2000xg for 5min in a centrifuge at 4 ℃, discarding the supernatant, washing with pre-cooled pure water, lightly blowing and mixing, and centrifuging at 2000xg for 5min in the centrifuge at 4 ℃; the supernatant is poured out again, pre-cooled 10% glycerol is used for washing, centrifugation is carried out according to the same condition after uniform mixing, 10% glycerol washing is repeated, the last centrifuged supernatant is poured out and added with 1ml of pre-cooled 10% glycerol, 100ul of supernatant is taken out after gentle blowing and uniform mixing and placed into a pre-cooled hollow EP tube, 200ng of nanATK knockout plasmid (with the added volume of not more than 10 ul) is added, after gentle blowing and uniform mixing, all of the supernatant is added into a pre-cooled 2mm electric shock cup, electric shock is carried out by using 3.0kv, then 1ml of pre-cooled antibiotic-free LB is added, all of the supernatant is sucked out after uniform mixing, the supernatant is placed into a 1.5ml hollow centrifuge tube, 200ul of supernatant is taken out after culturing for 1h in a 220rpm shaking table and coated on a solid LB plate containing 50ug/ml kanamycin and 50ug/ml spectinomycin, and the supernatant is cultured overnight.

The next day was identified as to whether the nan gene was successfully knocked out using the identifying primer nanQ-R & nan-IS-R.

Selecting the strain which is knocked out successfully, and culturing the strain in 2ml of liquid LB medium containing 10mM rhamnose and 50ug/ml kanamycin for 6 hours at 37 ℃ and 220 rpm; centrifuging at 2000Xg for 5min after culturing, discarding supernatant, adding 2ml of antibiotic-free LB, and culturing at 37deg.C and 220rpm for 2 hr; 10ul of thalli are taken, diluted by 10 times and then all coated in a solid LB culture medium containing 10g/L of sucrose for culture overnight; the next day, randomly selecting a monoclonal spot plate to continuously culture on LB non-resistant culture medium, solid culture medium containing 50ug/ml kanamycin and solid culture medium containing 50ug/ml spectinomycin, wherein only strains growing on the LB non-resistant culture medium and the solid culture medium containing spectinomycin are target strains; the strain with the lost plasmid is shaken, and glycerol with the final concentration of 15% is used for preserving bacteria, and the strain is named BNC for standby.

1.2 knockout of nagEBA Gene

The pTargetD plasmid is amplified by using primers nagE-N20-F and nagE-N20-2 to obtain 193bp fragment, two N20 needed by knockout of nagEBA are contained on the fragment, then the pTargetS plasmid is amplified by using a primer DPZL-1-F/R to obtain 2128bp carrier fragment, 2128bp carrier fragment and 193bp double N20 fragment are connected to construct pTargetD plasmid containing target N20, and the plasmid is named nag-N20-pTargetD, and monoclonal strains of nag-N20-argetD are selected for sequencing to detect whether the target N20 is constructed into the pTargetD plasmid. After the result to be sequenced is out, selecting the N20 plasmid which meets the purpose, and shaking the bacteria to extract the plasmid. Performing inverse PCR on the successfully constructed nag-N20-pTargetD plasmid by using a primer pTargetD-HP-F/R to obtain a vector fragment, then using a primer nag-HL-F/R to obtain an upstream homology arm of the knocked-out plasmid, wherein the fragment size is 677bp, the sequence is named nan-HL, using a primer nag-HR-F/nagE-HR-R to obtain a downstream homology arm of the knocked-out plasmid, the fragment size is named nan-HR, connecting the amplified upstream and downstream homology arms with the vector fragment to construct a knocked-out plasmid of nagEBA, and identifying a monoclonal after plating and culturing overnight by using identification primers: pTargetT-F/R, a successfully ligated monoclonal was selected for sequencing, and the correctly sequenced plasmid was selected as the knockout plasmid used, designated nag-pTargetD.

The method of knocking out and losing plasmids is the same as above. The identified primer IS nag-IS-F & nag-IS-R2. The bacteria grown only on the antibiotic-free LB medium and the spectinomycin-containing LB medium were named BNNC for use. The bacteria grown only on the antibiotic-free LB medium were named BNN for later use.

Table 1 Gene knockout and identification primers

Table 2 knock-out characteristics

2 construction of the overexpression vector

The nanA gene used was the ShNAL gene from Staphylococcus hominis subsp.hominis C80. The AGE gene used was the slr1975 gene from synechinocystis sp.pcc 6803. The GNA1 genes used were ScGNA1 gene derived from Saccharomyces cerevisiae S288C and ppdna 1 derived from Pichia pastoris CBS 7435, respectively. The sequence of the used genes is shown as SEQ ID NO. 1-4 after codon optimization. The optimized genes are all synthesized by Jin Weizhi, and the synthesized genes contain T7 promoter, RBS and T7 terminator sequences.

1. Construction of pET28a (+) -slr1975-ShNAL-ScGNA1 vector

The synthetic gene is used as a template, and 5-F and 3-R primers are used for amplification to obtain pT7-slr1975-tT7, pT7-ShNAL-tT7, pT7-ScGNA1-tT7 and pT7-PpGNA1-tT7 fragments respectively. Inverse PCR is carried out by taking pET28a (+) plasmid as a template and pET-F/R as a primer to obtain a linearized vector fragment.

TABLE 3 construction of primers for pET28a (+) -slr1975-ShNAL-ScGNA1 vector

The target gene fragment and the linearization vector fragment are subjected to homologous recombination through a seamless cloning kit, and vectors with correct gene sequences are obtained through sequencing, and are respectively named as pET28a (+) -slr1975-ShNAL-ScGNA1 vectors and pET28a (+) -slr1975-ShNAL-PpGNA1 vectors.

3 construction of control bacteria

The knock-out BNN electrotransformation competence preparation and electrotransformation method are the same as the above, pET28a (+) -slr1975-ShNAL-ScGNA1 and pET28a (+) -slr1975-ShNAL-PpGNA1 vectors are respectively and electrically transformed into the knock-out bacteria, and strains growing on kanamycin resistance plates are respectively named BNNS and BNNP.

TABLE 4 characterization of control bacteria

Example 1

Construction of genetically engineered bacteria

The constructed genetically engineered bacterium continuously knocks out the glmM gene on the basis of the control bacterium BNNC, and the method is specifically as follows:

the pTargetD plasmid was amplified using primers glmM-N20-F and glmM-N20-2 to obtain 193bp fragment containing two N20 required for knockout of glmM, then the pTargetS plasmid was amplified using primer DPZL-1-F/R to obtain 2128bp vector fragment, 2128bp vector fragment and 193bp double N20 fragment were ligated to construct pTargetD plasmid containing the target N20, and the plasmid was named glmM-N20-pTargetD, and the single clone strain of glmM-N20-pTargetD was selected and sequenced to determine whether the target N20 was constructed into the pTargetD plasmid. After the result to be sequenced is out, selecting the N20 plasmid which meets the purpose, and shaking the bacteria to extract the plasmid. Performing inverse PCR on the successfully constructed glmM-N20-pTargetD plasmid by using a primer pTargetD-HP-F/R to obtain a vector fragment, then using a primer glmM-HL-F/R to obtain an upstream homology arm of the knocked-out plasmid, wherein the fragment size is 634bp, the name is glmM-HL, using a primer glmM-HR-F/glmM-HR-R to obtain a downstream homology arm of the knocked-out plasmid, the fragment size is 547bp, the name is glmM-HR, connecting the amplified upstream and downstream homology arms with the vector fragment, constructing the glmM knockout plasmid, and identifying a monoclonal after plating for overnight, wherein the identification primers are used as follows: pTargetT-F/R, a successfully ligated monoclonal was selected for sequencing, and the correctly sequenced plasmid was selected as the knockout plasmid used, designated glmM-pTargetD.

The method of knocking out and losing plasmids is the same as above. The identified primers were glmM-IS-F & glmM-IS-R2. The engineering bacteria are knocked out only on the antibiotic-free LB culture medium, and are named BNNG for standby.

BNNG electrotransformation competent preparation and electrotransformation method are the same, pET28a (+) -slr1975-ShNAL-PpGNA1 vector is electrotransformed into bacteria, and the grown kanamycin resistance plate is the genetically engineered bacteria, named BNNGP.

TABLE 5glmM knockout and identification primers

TABLE 6 genetically engineered fungus characterization

Example 2

Induction synthesis and product detection

1. Induction

BNNS, BNNP, BNNGP 3 strains were cultured overnight in LB liquid medium, 1mL of overnight bacteria was added to 2mL of fermentation medium (90% M9 glucose medium+10% LB medium), and after 2 hours of culture 100uL was added to 10mL of fermentation medium for continuous culture overnight.

Inoculating the cultured strain into baffle shake flask containing 200mL fermentation medium at ratio of 1:50, culturing at 37deg.C and 220rpm until OD600 value is about 0.8, adding IPTG with final concentration of 0.2mM, culturing for 48 hr, and sampling.

The formula of the M9 glucose medium is as follows:

2. product detection

Taking 1mL of the culture sample, centrifuging 12000g for 5min, collecting supernatant, and performing HPLC detection using Pezex as separation column ^TM ROA-Organic Acid H+ (8%), 5mM sulfuric Acid solution in mobile phase, flow rate of 0.6ml/min, column temperature set to 50 ℃, detection sample volume of 10ul per sample, detection time of 25min. Neu5Ac standard was purchased from the institute of biotechnology limited in the Xinyang city. The final HPLC assay yields were: BNNS shake flask yield: 0.144g/L; BNNP shake flask yield: 1.171g/L; BNNGP shake flask yield: 2.360g/L.

It should be understood that the above examples are illustrative and are not intended to encompass all possible implementations encompassed by the claims. Various modifications and changes may be made in the above embodiments without departing from the scope of the disclosure. Likewise, the individual features of the above embodiments can also be combined arbitrarily to form further embodiments of the invention which may not be explicitly described. Therefore, the above examples merely represent several embodiments of the present invention and do not limit the scope of protection of the patent of the present invention.

Claims

1. A recombinant escherichia coli, wherein the recombinant escherichia coli is silenced or knocked out of a glmM gene encoding a phosphoglucosamine mutase on a genome.

2. The recombinant escherichia coli according to claim 1, wherein the recombinant escherichia coli is further silenced or knocked out of the gene nanE encoding NeuAc aldolase gene nanT and/or NeuAc transporter gene nanE and/or N-acetylmannosamine-6-phosphate 2-epimerase gene nanE and/or N-acetylmannosamine kinase gene nanK;

3. The recombinant escherichia coli according to any one of claims 1-2, wherein the recombinant escherichia coli is further silenced or knocked out of the gene nagE encoding the N-acetylglucosamine-specific EIICBA component and/or the glucosamine-6-phosphate deaminase gene nagB and/or the N-acetylglucosamine-6-phosphate acetylase gene nagA;

4. A recombinant escherichia coli according to any one of claims 1-3, wherein said recombinant escherichia coli is introduced with the NeuAc aldolase gene nanA, preferably said nanA gene is derived from MG1655, klebsiella quasipneumoniae, staphylococcus hominis subsp.hominis C80 or a microorganism expressing the same functional enzyme;

5. The recombinant E.coli according to any one of claims 1 to 4, wherein the recombinant E.coli has introduced an N-acetylglucosamine-2-isomerase gene AGE derived from Anabaena sp.CH1, synechocystis sp.PCC 6803 or a microorganism expressing the same functional enzyme;

6. The recombinant escherichia coli according to any one of claims 1-5, wherein the recombinant escherichia coli is introduced with a glucosamine-6-phosphate acetyltransferase gene GNA1, said GNA1 gene being derived from Saccharomyces cerevisiae S288C, pichia pastoris CBS 7435 or a microorganism capable of expressing the same functional enzyme;

7. The recombinant E.coli according to any one of claims 1 to 6, wherein the E.coli is selected from E.coli BL21 (DE 3), E.coli K12 MG1655 and E.coli JM109; coli BL21 (DE 3) is preferred.

8. A process for producing N-acetylneuraminic acid, characterized in that the recombinant E.coli of any one of claims 1 to 7 is used as a fermentation strain and is cultivated at 30 to 37℃for at least 24 hours.

9. The method for producing N-acetylneuraminic acid according to claim 8, wherein fermentation is carried out using glucose or glycerol as a carbon source.

10. Use of the recombinant escherichia coli of any one of claims 1-7 in the fields of medicine, food and chemical industry;

preferably, the recombinant E.coli according to any one of claims 1 to 7 is used for the production of a product containing N-acetylneuraminic acid.