CN104195190B - Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli - Google Patents

Abstract

The invention discloses a method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli. The method comprises the following steps: inoculating the recombinant escherichia coli into an AM1-yeast powder inorganic salt culture medium; and firstly culturing under an aerobic condition for 8-15 hours to grow thalli, and then transforming into anaerobic fermentation, wherein the fermentation time is 72+/-10 hours. According to the method, the 5-aminolevulinic acid can be produced through the anaerobic fermentation without adding an expensive succinic acid precursor, and the produced 5-ALA (Aminolevulinic Acid) is difficult to degrade, so that the process is simplified, and the cost is reduced. Experiments prove that the output of the 5-ALA achieves as high as 1.65 g/l under the condition of the anaerobic fermentation, and the glucose transformation rate of the 5-ALA is 0.32 g/g, so that the 5-ALA is prompted to have very good industrial development and application prospect.

Description

A kind of method that utilization recombination bacillus coli anaerobism produces 5-ALA

Technical field

The present invention relates to microbial technique and field of fermentation engineering, it particularly relates to one kind utilizes recombination bacillus coli The method that anaerobic fermentation produces 5-ALA.

Background technology

5-ALA (5-aminolevulinic acid, abbreviation 5-ALA) be one kind be widely present in antibacterial, Non-protein amino acid in funguses, animal and plant body, its molecular formula are C₅O₃NH₉, molecular weight is 131.13, and fusing point is 118 ℃.It is unstable in aqueous, easily there is condensation reaction.5-ALA is the important intermediate in the biosynthesiss of pyridine.Therefore Frequently as Vitamin B12, haemachrome and chlorophyllous precursor.Medically, it can treat various cancers as photodynamic agents Disease.Agriculturally, 5-ALA is due to crop, animal and people's avirulence, can be used as plant growth regulator, herbicide and insecticide. In addition industrially, 5-ALA is a kind of important organic synthesis intermediate.

In nature, many biologies can synthesize 5-ALA, and such as photosynthetic bacteria is that a class can synthesize 5-ALA in a large number and secrete To extracellular microorganism.In nature biotechnology body in the approach of synthesis 5-ALA, C4 approach is using succinyl-CoA and glycine 5-ALA is generated in 5-aminolevulinate synthetase (5-ALAS) catalysis next step；And C5 approach is then glutamic acid through paddy ammonia Acyl-tRNA synzyme (GluRS, by gltX gene codes), glutamyl-tRNA reductase (GluTR, by hemA gene codes) and Glutamic acid -1- semialdehyde -2, the catalysis of 1- aminotransferases (GSA-AM, by hemL gene codes) three steps generate 5-ALA.In cell Interior, 5-ALA further metabolism can form heme Heme.

The biosynthesiss mode of 5-ALA corresponding with biosynthesiss at present to be had produce 5-ALA using C4 approach and pass through C5 approach directly synthesizes two kinds of 5-ALA from glucose.5-ALA is produced using C4 approach, i.e., it is biological by expressing 5-ALA synzyme Conversion succinic acid and glycine production 5-ALA.By optimizing 5-aminolevulinate synthetase hemA genes in this research Expression and fermentation condition, the yield of 5-ALA can be improved.5-ALA is directly synthesized from glucose by C5 approach, i.e., by C5 Approach synthesis 5-ALA then needs the metabolic engineering optimization of complexity, it is necessary to build engineering strain.Once engineering strain structure Build and complete, its biosynthetic process is relatively easy and cheap.Retrieval finds the research for utilizing photosynthetic bacteria to synthesize 5-ALA also very It is many, but need to adopt illumination in Fermentation by Photosynthetic Bacteria, and so as to increased cost, photosynthetic bacterium growth is slow in addition, fermentation time It is long, be not suitable for large-scale industry fermenting and producing.Also, under aerobic condition, the phase is susceptible to degraded to 5-ALA after fermentation, enters The downstream metabolism of one step is converted into haemachrome (ingredient of aerobic respiration electron transmission), and yield is decreased obviously.Meanwhile, blood The partial intermediate of red pigment route of synthesis has toxic action to cell, is easily caused thalli growth slow.

Under anaerobic condition, 5-ALA is difficult to be converted degraded, is conducive to the production of 5-ALA and makes output increased；Meanwhile, anaerobism Fermentation reduces energy expenditure the cost ----air agitation cost of maximum in fermentation industry, and incubation is simple, production scale Easily expand, with obvious advantage.But retrieve find about 5- glycyls being produced using recombination bacillus coli anaerobic fermentation The method of propanoic acid has not been reported.

The content of the invention

For existing method and the deficiency of technology, it is an object of the invention to provide a kind of sent out using recombination bacillus coli anaerobism The method of ferment production 5-ALA (5-ALA).

The C4 biosynthesis pathwaies based on 5-ALA are the technical scheme is that, using recombination bacillus coli in AM1 yeast 5-ALA (5- is produced as substrate through anaerobic fermentation with cheap glucose and glycine under the conditions of powder minimal medium ALA).Wherein, the recombination bacillus coli is any to express 5-aminolevulinate synthetase (ALAS) and S-(3-carboxy-propionyl)-coenzyme-A Synzyme (SucCD) the under anaerobic bacterial strain of generation succinic acid.

The method that utilization recombination bacillus coli anaerobic fermentation of the present invention produces 5-ALA, its feature exist In：Using the fermentation condition of recombination bacillus coli anaerobism production 5-ALA it is：2% is calculated as with percent by volume～ 5% inoculum concentration is inoculated in recombination bacillus coli in AM1- yeast powder minimal mediums, first under aerobic condition culture 8～ 15h growing mycelias, then turn anaerobic fermentation, and fermentation time is 72 ± 10h；Wherein, temperature is controlled to 37 ± 1 DEG C, and pH is controlled 6.5 ± 0.5 are made as, the AM1- yeast powders minimal medium formula is：(NH₄)₂HPO₄, 2.6306g/l；NH₄H₂PO₄, 0.8709g/l；KCl, 0.1491g/l；3- N-morpholinyls (MOPS), 20.9270g/l；Yeast powder, 2g/l；Use Na₂CO₃Adjust pH To 7.0, balance of water；Add 0.15mM MgSO during use₄·7H₂O and volume ratio are 1 ‰ trace element solution；It is wherein micro- Secondary element 1000 × mother solution formula is：FeCl₃·6H₂O, 2.4003g/l；CoCl₂·6H₂O, 0.2998g/l；ZnCl₂, 0.2999g/l；Na₂MoO₄·2H₂O, 0.3000g/l；H₃BO₄, 0.0748g/l, MnCl₂·4H₂O, 0.4948g/l；CuCl₂· 2H₂O, 0.1500g/l；Dissolved with 120mM HCl；Wherein, the recombination bacillus coli is any to express 5- glycyls third Acid enzyme (ALAS) and succinic thiokinase (SucCD) simultaneously produce the bacterial strain of succinic acid under anaerobic.

In the method for above-mentioned utilization recombination bacillus coli anaerobic fermentation production 5-ALA：The restructuring large intestine bar Bacterium preferred culture 12h under aerobic condition, rotating speed is 250 ± 10rpm.

Further, above-mentioned utilization recombination bacillus coli anaerobic fermentation produces the method concrete steps of 5-ALA It is：

(1) dipped from the glycerol tube of the E. coli recombinant stain of preservation after bacterium solution with inoculating loop, containing 100 μ g/ The flat lining outs of LB of ml ampicillin, and the LB flat boards of line are placed in into 37 DEG C of 12 ± 1h of culture.

(2) monoclonal on LB flat boards is inoculated in the 300ml shaking flasks of the culture medium of LB containing 50ml, and is placed on rotating speed For 250rpm, during temperature is 37 DEG C of shaking table, 12 ± 1h is cultivated, seed culture fluid is obtained.

(3) take 2ml seed liquor to be inoculated in the 300ml shaking flasks of the yeast powder inorganic salt fermentation medium of AM1- containing 100ml, And rotating speed is placed on for 250rpm, temperature is to be fermented in 37 DEG C of shaking table, and is induced with IPTG.K₂CO₃Adjust pH to 6.5.Send out Ferment initially adds 2g/l glycine.

(4) fermentation liquid after culture 12h is proceeded to the anaerobism bottle of the yeast powder inorganic salt fermentation medium of AM1- containing 130ml Middle sealing anaerobic fermentation, condition：37 DEG C, 210rpm, pH6.5.Respectively at 12h, 22h, 28h respectively add 2g/l glycine, 72h knots Beam ferments.A sample detection 5-ALA yield is taken per 6h.

Above-mentioned 5-ALA detection methods are：12000rpm is centrifuged fermentation liquid 2min, and supernatant is proceeded in new centrifuge tube.Press Certain proportion is diluted.400 μ l of diluent are taken, the acetylacetone,2,4-pentanedione of the sodium acetate buffer and 100 μ l of 200 μ l is separately added into, Boil reaction 15min.Room temperature is cooled to, Modified Ehrlich ' s reagent reagent reacting 10min is added, is then utilized The cuvette of 1cm is detected using spectrophotometer under wavelength 554nm.

In the method for above-mentioned utilization recombination bacillus coli anaerobic fermentation production 5-ALA：The restructuring large intestine bar Bacterium comprises the following steps：The expression vector pTrc99a-hemA containing hemA genes is built, is built containing sucCD again on this basis The expression vector pTrc99a-hemA-sucCD of gene, by constructed recombinant vector pTrc99a-hemA-sucCD cotransformation weights In group escherichia coli, obtaining can be while the recombination bacillus coli of overexpression hemA and sucCD；Wherein, the hemA is source In the hemA genes of the red bacillus of class ball, the sucCD gene sources are in escherichia coli.

In the method for above-mentioned utilization recombination bacillus coli anaerobic fermentation production 5-ALA：The restructuring large intestine bar Bacterium is preferably escherichia coli YL106-hemA-sucCD, escherichia coli W3110-hemA-sucCD, or escherichia coli W3110GAB- hemA-sucCD。

Wherein：Above-mentioned recombination bacillus coli is further preferred that escherichia coli YL106-hemA-sucCD, and its genotype is MG1655(ptsG poxB pta iclR sdhA arcA adhE ldhA pckA*ldhA::trc-rbs-glf)/ PTrc99a-hemA-sucCD, comprises the following steps：The expression vector pTrc99a-hemA containing hemA genes is built, in this base Build the expression vector pTrc99a-hemA-sucCD containing sucCD genes on plinth again, by constructed recombinant vector pTrc99a- In hemA-sucCD cotransformation recombination bacillus coli YL106, obtaining can be while the restructuring large intestine bar of overexpression hemA and sucCD Bacterium, as escherichia coli YL106-hemA-sucCD；Wherein, the hemA is derived from the hemA genes of the red bacillus of class ball, institute SucCD gene sources are stated in escherichia coli；The recombination bacillus coli YL106 is deposited in " Chinese allusion quotation on April 17th, 2013 Type culture collection ", deposit number are CCTCC NO:M 2013149, its genotype are MG1655 Δ ptsG Δ poxB Δs ptaΔiclRΔsdhAΔarcAΔldhAΔadhE pckA*glf_ZM。

Unstable, the restriction being easily degraded during production aerobic for 5-ALA of the invention, and aerobic fermentation high cost Shortcoming, there is provided a kind of method that anaerobic fermentation produces 5-ALA.The inventive method is by succinyl CoA synthase And the effect of 5-ALA synzyme hemA, while adding glycine to produce 5-ALA.The method is without the need for the expensive succinic acid of addition Precursor, the 5-ALA of production are difficult to be degraded；Meanwhile, using cheap minimal medium, fermentation technology is simplified, reduce life Produce cost.Under anaerobic fermentation conditions, the yield of 5-ALA is up to 1.65g/l, and 5-ALA/ inversion rate of glucose is 0.32g/g.Turn Rate has a clear superiority, and points out with good commercial development and application prospect.

Description of the drawings

Fig. 1. recombination bacillus coli glucose fermentation produces the approach of 5-ALA.

Fig. 2. build plasmid expression vector collection of illustrative plates.

Fig. 3. extracellular 5-ALA concentration, glucose, bacterium under recombination bacillus coli YL106-hemA-sucCD anaerobic fermentation conditions Body density (OD₆₀₀), the relation curve of succinic acid and fermentation time.

Specific embodiment

General explanation：Enzyme involved by embodiment is purchased from TaKaRa companies, and plasmid extraction kit is public purchased from Tiangeng Department, agarose gel reclaim DNA fragmentation test kit and are purchased from Shen Neng betting offices, and operation is carried out fully according to corresponding instructions.Matter During grain builds, gene sequencing is completed by Huada gene company.5-ALA standard sample and other reagents are purchased from Sigma companies.DH5 α competent cells are purchased from Quan Shijin Bioisystech Co., Ltd.

LB liquid culture based formulas：Yeast powder 5g/l, peptone 10g/l, NaCl 10g/l, pH 7.0.

LB- ammonia benzyl culture medium prescriptions：Yeast powder 5g/l, peptone 10g/l, NaCl 10g/l, 100 μ g/ of ampicillin ml

5-ALA detection methods are：12000rpm is centrifuged fermentation liquid 1ml, and supernatant is proceeded in new centrifuge tube.By a definite proportion Example is diluted.400 μ l of diluent are taken, the acetylacetone,2,4-pentanedione of the sodium acetate buffer and 100 μ l of 200 μ l is separately added into, is boiled anti- Answer 15min.Room temperature is cooled to, 700 μ l of Modified Ehrlich ' s reagent, reagent reacting 10min, Ran Houli is added Detected using spectrophotometer under wavelength 554nm with the cuvette of 1cm.

Acetate buffer consists of (1 liter of distilled water):57ml glacial acetic acids, 82g anhydrous sodium acetates.

Improvement Ehrlich ' s reagents：The glacial acetic acid of addition 30ml in the graduated cylinder of 50ml, the p- dimethylaminobenzoic acids of 1g, 8ml70% perchloric acid, is then settled to 50ml.

AM1- yeast powder minimal medium formula：(NH₄)₂HPO₄, 2.6306g/l；NH₄H₂PO₄, 0.8709g/l；KCl, 0.1491g/l；3- N-morpholinyls (MOPS), 20.9270g/l；Yeast powder, 2g/l；Use Na₂CO₃PH is adjusted to 7.0, it is balance of Water；121 DEG C of sterilizing 20min.Add 0.15mM MgSO during use₄·7H₂O and 1 ‰ (v/v) trace element solution.

Trace element solution (1000 × mother solution) formula：FeCl₃·6H₂O, 2.4003g/l；CoCl₂·6H₂O, 0.2998g/l；ZnCl₂, 0.2999g/l；Na₂MoO₄·2H₂O, 0.3000g/l；H₃BO₄, 0.0748g/l, MnCl₂·4H₂O, 0.4948g/l；CuCl₂·2H₂O, 0.1500g/l；Dissolved with 120mM HCl.121 DEG C of sterilizing 20min.

50% glucose solution (w/v), individually sterilizes.

Recombination bacillus coli (Escherichia coli) YL106, belongs to gram negative bacteria.The bacterium is in shaft-like, size For 0.4～0.6 micron × 1～3 micron, have ordinary pilus and sex fimbria, without spore, growth temperature range 15～46 DEG C it Between, optimum growth temperature is 37 DEG C.The bacterium is deposited in " China typical culture collection on April 17th, 2013 by applicant " center ", deposit number are CCTCC NO:M2013149.The related application number of the bacterium is：201310203945.9, application Day it is：2013-05-28.The starting strain of the strain construction is e. coli k-12 series MG1655, and its genome sequence row number is NC_000913.2。

Recombination bacillus coli W3110 (derives from American Type Culture collection, preserving number ATCC27325).

The structure of the expression vector of embodiment 1,5-aminolevulinate synthetase (hemA) gene

According to the red bacillus gene group sequence of class ball that NCBI is announced, using primer hemA-F：5′- GCTCTAGAAGGAGAACAGCTATGGACTACAATCTGGCACTC-3 ' and hemA-R：5′- CCCAAGCTTCGAAAGAAGTAGCACAGGGC-3', enters performing PCR as template with the plasmid PUI1014 containing hemA genes, gram Grand hemA genes.The hemA fragments of clone are utilized respectively into Cobra venom endonuclease Xbal and PstI digestion process, while plasmid is carried Body pTrc99a is also utilized respectively Cobra venom endonuclease XbaI and PstI digestion process.By the hemA fragments and pTrc99a of digestion process Plasmid vector is reclaimed using agarose gel test kit, is then connected using T4 ligases.

Linked system is：

HemA fragments：6μl

PTrc99a carriers：2μl

10×Buffer：1μl

4 ligases of Τ：lμl

After 25 DEG C of connection 1h, by the connection liquid conversion escherichia coli YL106 competent cells of 10 μ l.

Conversion process is：The connection liquid of 10 μ l is added in competent cell, is mixed.Ice bath 30min, 42 DEG C of thermal shock 90s, Ice bath 2min, adds the LB culture medium of 900 μ l, and 37 DEG C, 180rpm hatches lh, is coated with amicillin resistance flat board, culture 16h, picking transformant extract plasmid checking.Enter the correct of ー step sequence verification hemA genes after so.So as to obtain recombiant plasmid pTrc99a-hemA。

The structure of embodiment 2, succinic thiokinase (sucCD) expression vector

According to the genome of E.coli sequence that NCBI is announced, using primer HindIII-sucCD-F：5′- CCCAAGCTTAGAAGGAGAACAGCTATGAACTTACATGAATATCAGGCA-3 ' and HindIII-sucCD-R：5′- CCCAAGCTTTTATTTCAGAACAGTTTTCAGTGC-3 ', with escherichia coli MG1655 genomes as template, PCR amplifications SucCD genes.The sucCD fragments of clone are utilized into Cobra venom endonuclease HindIII digestion process, while by plasmid vector PTrc99A-hemA also Cobra venom endonuclease HindIII digestion process.By the sucCD fragments and pTrc99A-hemA matter of digestion process Grain carrier is reclaimed using agarose gel test kit, is then connected using T4 ligases.

Linked system is 10 μ l：

SucCD fragments：6μl

PTrc99A-hemA carriers：2μl

10×Buffer：1μl

T4 ligases：0.5μl

After 25 DEG C of connection 1h, by the connection liquid conversion escherichia coli YL106 competent cells of 10 μ l.

Conversion process is：The connection liquid of 10 μ l is added in the YL106 competent cells of 100 μ l, is mixed.Ice bath 30min, 42 DEG C of thermal shock 90s, ice bath 2min, add the LB culture medium of 900 μ l, and 37 DEG C, 180rpm hatches lh, is coated with ammonia benzyl resistant panel, Culture 12h, picking transformant extract plasmid checking.Then further sequence verification sucCD gene is correct.So as to obtain The recombiant plasmid pTrc99A-hemA-sucCD of amount expression hemA and sucCD.

Embodiment 3, utilizing works bacterium W3110-hemA-sucCD anaerobic fermentations production ALA

Constructed recombinant vector pTrc99a-hemA-sucCD is converted recombination bacillus coli by step (1) in conventional manner W3110 (derive from American Type Culture collection, preserving number ATCC27325), obtain can simultaneously overexpression hemA and The recombination bacillus coli of sucCD, is named as escherichia coli W3110-hemA-sucCD.

Step (2) is dipped after bacterium solution from the glycerol tube of the W3110-hemA-sucCD of preservation with inoculating loop, is containing 100 The flat lining outs of LB of μ g/ml ampicillin, and the LB flat boards of line are placed in into 37 DEG C of culture 12h.

Step (3) is inoculated in the monoclonal on LB flat boards in the 300ml shaking flasks of the culture medium of LB containing 50ml, and is placed on Rotating speed is 250rpm, during temperature is 37 DEG C of shaking table, cultivates 12h, obtains seed culture fluid.

Step (4) take 2ml seed liquor be inoculated in the yeast powders of AM1- containing 100ml inorganic salt send out fermentation medium 300ml shake In bottle, and rotating speed is placed on for 250rpm, temperature is to be fermented in 37 DEG C of shaking table, and is induced with IPTG.K₂CO₃Adjust pH6.5.The initial addition 2g/l glycine of fermentation.Initial glucose concentration is 20g/l.

Fermentation liquid after fermentation culture 12h is proceeded to the yeast powder inorganic salt fermentation medium of AM1- containing 130ml by step (5) Anaerobism bottle in, 37 DEG C, 210rpm, anaerobic fermentation.Respectively at 12h, 22h, 28h respectively add 2g/l glycine, and 72h terminates to send out Ferment.A sample detection ALA yield is taken per 6h.

Fermentation results show that the recombination bacillus coli reaches 84mg/l through 72h anaerobic fermentations, ALA yield.

Embodiment 4, the structure for producing succinic acid recombinant bacterial strain W3110GAB

(1) knockout of .plfB genes：

Strain：Escherichia coli W3110

The LB culture medium is:Peptone 10g/l, yeast powder 5g/l, NaCl 10g/l, ampicillin, 100mg/l, Chloromycetin 50mg/l.

The ammonia benzyl chloramphenicol resistance flat board is the ampicillin containing 100mg/l, the LB solids training of 1.5% agar powder Foster base.

The chlorampenicol resistant flat board is the chloromycetin containing 50mg/l, the LB solid mediums of 1.5% agar powder.

The SOC culture medium is：Peptone 2g/l, yeast powder 0.5g/l, NaCl 0.0585g/l, KCl 0.0186g/l, MgCl₂0.203g, MgSO₄0.246g/l, glucose 20mmol/l.

The clone of a homologous recombination segments

Genes of interest is knocked out using Red recombination systems.

According to the plfB gene orders design primer that Genbank is announced：

pflB_F：5'-

TCGGCAACATTATCGGTGGTGGTTTGTTGGTTGGGTTGACGTGTAGGCTGGAGCTGCTT-3'

pflB_R：5'-

ATAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGCTATGGGAATTAGCCATGGTC-3'

Restructuring segment with kalamycin resistance is obtained by PCR (polymerase chain reaction) amplification in vitro with pKD4. PCR reaction conditions：97 DEG C of denaturations 5min, 94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 72 after 30 circulations DEG C extend 10min, 4 DEG C preservation.After DpnI endonuclease digestions, recovery purifying concentration homologous recombination segment.

The preparation of b Electroporation-competent cells

(I) picking with pKD46 plasmids escherichia coli W3110, proceed in LB culture medium, at the same add 0.2% Ah Uncle's sugar is drawn, OD is cultivated₆₀₀To 0.5；

(II) ice bath 15min, is centrifuged thalline, is then washed three times using 10% glycerol；

(III) 10% glycerol is added, 50 times is concentrated into, subpackage competence.

C electricity conversions, screen recon

(I) the homologous recombination segment of 1mg is drawn, in adding the competent cell of 100 μ l, is mixed.Adjust electroporation apparatuss, 2.5Kv, electric shock；

(II) the SOC culture medium of 900 μ l is added, 37 DEG C, 150rpm cultivates 1h；

(III) chlorampenicol resistant flat board is coated with, transfers recon and utilize primer

pflB-F:5'-ACTGATAACCTGATTCCGGTTACGA-3'

pflB-R:5'-ATGGGAATTAGCCATGGTCCATATG-3'

Enter performing PCR detection, pflB genes are further characterized by by PCR primer sequencing and are replaced by kalamycin resistance gene Change.

(IV) FRT site-specifics restructuring

PCP20 is proceeded to into Chloramphenicol-resistant clones, 30 DEG C of culture 8h are improved afterwards to 42 DEG C of incubated overnight 12h, thermal induction FLP restructuring expression of enzymes, plasmid are also gradually lost.Bacterium solution is dipped using inoculating loop to rule in non-resistant culture medium, by what is grown Monoclonal is proceeded to simultaneously, grows and resist in chloromycetin on non-resistant flat board What is do not grown on mild-natured plate is deleted by FLP recombinases.Further identified using detection primer pflB-F and pflB-R.

(V) obtain engineered strain W3110 (Δ pflB).

(2) knockout of .ptsG genes：

Strain：Escherichia coli W3110 (Δ pflB)

The LB culture medium is:Peptone 10g/l, yeast powder 5g/l, NaCl 10g/l, ampicillin, 100mg/l, Chloromycetin 50mg/l.

The ammonia benzyl chloramphenicol resistance flat board is the ampicillin containing 100mg/l, the LB solids training of 1.5% agar powder Foster base.

The chlorampenicol resistant flat board is the chloromycetin containing 50mg/l, the LB solid mediums of 1.5% agar powder.

The SOC culture medium is：Peptone 2g/l, yeast powder 0.5g/l, NaCl 0.0585g/l, KCl 0.0186g/l, MgCl₂0.203g, MgSO₄0.246g/l, glucose 20mmol/l.

The clone of a homologous recombination segments

Genes of interest is knocked out using Red recombination systems.

According to the ptsG gene orders design primer that Genbank is announced：

pKD-ptsG F:

5'-ACGTAAAAAAAGCACCCATACTCAGGAGCACTCTCAATTGTGTAGGCTGGAGCTGCTTC-3'

pKD-ptsG R:

5'-AGCCATCTGGCTGCCTTAGTCTCCCCAACGTCTTACGGAATGGGAATTAGCCATGGTCC-3'

Restructuring segment with chlorampenicol resistant is obtained by PCR (polymerase chain reaction) amplification in vitro with pKD3.PCR Reaction condition：97 DEG C of denaturations 5min, 94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 90s, after 30 circulations, 72 DEG C are prolonged Stretch 10min, 4 DEG C of preservations.After DpnI endonuclease digestions, recovery purifying concentration homologous recombination segment.

The preparation of b Electroporation-competent cells

(I) escherichia coli W3110 (Δ pflB) of the picking with pKD46 plasmids, proceeds in LB culture medium, while adding 0.2% arabinose, cultivates OD₆₀₀To 0.5；

(II) ice bath 15min, is centrifuged thalline, is then washed three times using 10% glycerol；

(III) 10% glycerol is added, 50 times is concentrated into, subpackage competence.

C electricity conversions, screen recon

(I) the homologous recombination segment of 1mg is drawn, in adding the competent cell of 100 μ l, is mixed.Adjust electroporation apparatuss, 2.5Kv, electric shock；

(II) the SOC culture medium of 900 μ l is added, 37 DEG C, 150rpm cultivates 1h；

(III) chlorampenicol resistant flat board is coated with, transfers recon utilization

ptsG test F:5'-CCTGTACACGGCGAGGCTCT-3'

ptsG test R:5'-AATAACACCTGTAAAAAAGGCAGCC-3'

Enter performing PCR detection, ptsG genes are further characterized by by PCR primer sequencing and are replaced by chloramphenicol resistance gene.

(IV) FRT site-specifics restructuring

PCP20 is proceeded to into Chloramphenicol-resistant clones, 30 DEG C of culture 8h are improved afterwards to 42 DEG C of overnight 12h, thermal induction FLP weights Group expression of enzymes, plasmid are also gradually lost.Bacterium solution is dipped using inoculating loop to rule in non-resistant culture medium, by the monoclonal for growing Simultaneously proceed to, the growth on non-resistant flat board and in chlorampenicol resistant flat board On do not grow deleted by FLP recombinases.Further identified using detection primer ptsG test F and ptsG test R.

(V) obtain engineered strain W3110 (Δ pflB Δ ptsG).

(3) knockout of ldhA genes

Bacterial strain：W3110(ΔpflBΔptsG)

The LB culture medium for being used is：1% peptone, 1%NaCl, 0.5% yeast powder.

The ammonia benzyl chloramphenicol resistance flat board for being used is the training of the LB solids containing 100mg/l ammonia benzyl mycins and 1.5% agar powder Foster base.

The kalamycin resistance flat board for being used is the LB solid culture containing 50mg/l kanamycin and 1.5% agar powder Base.

A. the clone of homologous recombination fragment

Genes of interest is knocked out using Red homologous recombination systems.Existed according to the ldhA gene orders that Genbank is announced Primer is designed at its upstream and downstream about 250bp：

ldhA-F：5’-CAGCGTCAACGGCACAAGAAT-3’

ldhA-R：5’-GCTGATTTCTGGCGGATTTTT-3’

With MG1655 (Δ ldhA::Kan it is) template, obtains mould with that is blocked by PCR (polymerase chain reaction) amplifications The recombinant fragment of plain resistance.PCR reaction systems are as follows：

10 × buffer, 5 μ l；4 μ l of 10mmol/L dNTP mixed liquors；The 1 μ l of ldhA-F primers of 20 μm of ol/l；20μmol/l 1 μ l of ldhA-R primers；0.5 μ l of Taq archaeal dna polymerases；1 μ l of template DNA, the benefit that adds water to 50 μ l；

PCR reaction conditions：95 DEG C of denaturations 5min, 94 DEG C of degeneration 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 1min, 30 After circulation, 72 DEG C extend 10min, 4 DEG C of preservations eventually.Recovery purifying concentration homologous recombination segment is standby.

B. the preparation of Electroporation-competent cells

1) escherichia coli W3110 (Δ pflB Δ ptsG) of the picking with pKD46 plasmids, is inoculated in LB culture medium, together When add 1ml10% arabinose, cultivate OD₆₀₀To 0.6；

2) ice bath 10min, the glycerol after collects thalline using 10% are washed three～five times；

3) Electroporation-competent cells are obtained with 10% glycerol of 100 μ l is resuspended, is placed in standby on ice.

C. electricity conversion, screens recon

1) the good recombinant fragment of 1mg purification is taken, is added in 100 μ l Electroporation-competent cells, mixed and ice puts 2min Afterwards, 2.5Kv electric shocks.

2) 900 μ l LB culture medium are rapidly added, 37 DEG C, 150rpm replys culture 1h.

3) thalline is coated on kalamycin resistance flat board, after choosing recon line, using detection primer

ldhA test F:5’-TGCAATACGTGTCCCGAG-3’

ldhA test R:5’-CAGTTTGCCTTCACCGCT-3’

Enter performing PCR detection.

D. the removal of resistance screening labelling

Plasmid pCP20 is proceeded to into recon, 30 DEG C of 220rpm cultivate 6h, are then transferred to 42 DEG C of 220rpm overnight incubations 12h.Bacterium solution is dipped in the flat lining out of non-resistant with inoculating loop, the monoclonal for growing is transferred to into non-resistant flat board and Ka Na is mould In plain resistant panel, what is can grown on non-resistant flat board and can not grow on kalamycin resistance flat board has been resistance The recon of removal, then determines whether to remove successfully using the further PCR detections of ldhA test F and ldhA test R.

E. remove the successful recombinant escherichia coli strain of resistance and be named as product succinic acid recombination bacillus coli W3110GAB (bases Because of type W3110 Δ pflB Δ ptsG Δ ldhA).

Embodiment 4, utilizing works bacterium W3110GAB-hemA-sucCD anaerobic fermentations production ALA

Constructed recombinant vector pTrc99a-hemA-sucCD is converted product succinic acid restructuring by step (1) in conventional manner Escherichia coli W3110GAB (genotype be W3110 Δ pflB Δ ptsG Δ ldhA), obtain can simultaneously overexpression hemA and The recombination bacillus coli of sucCD, is named as escherichia coli W3110GAB-hemA-sucCD.

Step (2) is dipped after bacterium solution from the glycerol tube of the W3110GAB-hemA-sucCD of preservation with inoculating loop, is being contained The flat lining outs of LB of 100 μ g/ml ampicillin and kanamycin, and the LB flat boards of line are placed in into 37 DEG C of incubated overnight 12h。

Step (3) is inoculated in the monoclonal on LB flat boards in the 300ml shaking flasks of the culture medium of LB containing 50ml, and is placed on Rotating speed is 250rpm, and during temperature is 37 DEG C of shaking table, incubated overnight 12h obtains seed culture fluid.

Step (4) take 2ml seed liquor be inoculated in the yeast powders of AM1- containing 100ml inorganic salt send out fermentation medium 300ml shake In bottle, and rotating speed is placed on for 250rpm, temperature is to be fermented in 37 DEG C of shaking table, and is induced with IPTG.K₂CO₃Adjust pH6.5.The initial addition 2g/l glycine of fermentation.Initial glucose concentration is 20g/l.

The fermentation liquid cultivated after 12h is proceeded to detesting for the yeast powder inorganic salt fermentation medium of AM1- containing 130ml by step (5) In oxygen bottle, 37 DEG C, 210rpm, anaerobic fermentation.Respectively at 12h, 22h, 28h respectively add 2g/l glycine, and 72h terminates fermentation.Often 6h takes a sample detection ALA yield.

Shown in fermentation results, the recombination bacillus coli reaches 240mg/l through 72h anaerobic fermentations, ALA yield.

Embodiment 5, recombination bacillus coli engineering bacteria YL106-hemA-sucCD anaerobic fermentations production 5-ALA

Constructed recombiant plasmid pTrc99a-hemA-sucCD is converted product succinic acid restructuring by step (1) in conventional manner In escherichia coli YL106, obtain while the recombination bacillus coli YL106-hemA-sucCD of overexpression hemA and sucCD.On State product succinic acid recombination bacillus coli YL106 to be deposited in " China typical culture collection center " on April 17th, 2013, protect It is CCTCC NO to hide numbering:M 2013149, its genotype are MG1655 Δ ptsG Δ poxB Δ pta Δ iclR Δ sdhA Δs arcAΔldhAΔadhE pckA*glfZM。

Step (2) is dipped after bacterium solution from the glycerol tube of the YL106-hemA-sucCD of preservation with inoculating loop, is containing 100 The flat lining outs of LB of μ g/ml ampicillin, and the LB flat boards of line are placed in into 37 DEG C of incubated overnight 12h.

Step (3) is inoculated in the monoclonal on LB flat boards in the 300ml shaking flasks of the culture medium of LB containing 50ml, and is placed on Rotating speed is 250rpm, and during temperature is 37 DEG C of shaking table, incubated overnight 12h obtains seed culture fluid.

Step (4) take 2ml seed liquor be inoculated in the yeast powders of AM1- containing 100ml inorganic salt send out fermentation medium 300ml shake In bottle, and rotating speed is placed on for 250rpm, temperature is to be fermented in 37 DEG C of shaking table, and is induced with IPTG.K₂CO₃Adjust pH6.5.The initial addition 2g/l glycine of fermentation.Initial glucose concentration is 20g/l.

The fermentation liquid cultivated after 12h is proceeded to detesting for the yeast powder inorganic salt fermentation medium of AM1- containing 130ml by step (5) In oxygen bottle, 37 DEG C, 210rpm, anaerobic fermentation.Respectively at 12h, 22h, 28h respectively add 2g/l glycine, and 72h terminates fermentation.Often 6h takes a sample detection 5-ALA yield.

As shown in figure 3, the recombination bacillus coli is through 72h anaerobic fermentations, 5-ALA yield reaches 1.65g/l to fermentation results, 5-ALA/ inversion rate of glucose is 0.32g/g.

Claims (1)

1. a kind of method that utilization recombination bacillus coli anaerobic fermentation produces 5-ALA, is to express 5- using any ALAS and succinic thiokinase simultaneously produce the recombination bacillus coli bacterium of succinic acid under anaerobic Strain anaerobic fermentation production 5-ALA, it is characterised in that：

Using the fermentation condition of recombination bacillus coli anaerobic fermentation production 5-ALA it is：With volume percentage Inoculum concentration for 2%～5% is inoculated in recombination bacillus coli in AM1- yeast powder minimal mediums, first under aerobic condition Culture 12h, rotating speed is 250 ± 10rpm growing mycelias, then turns anaerobic fermentation, and temperature is controlled to 37 ± 1 DEG C, and pH is controlled For 6.5 ± 0.5, fermentation time is 72 ± 10h；

Wherein,

The recombination bacillus coli is escherichia coli YL106-hemA-sucCD, and its genotype is MG1655 Δ ptsG Δ poxB Δpta ΔiclR ΔsdhA ΔarcA ΔldhA ΔadhE pckA*glf_ZM/pTrc99a-hemA-sucCD。