CN108929883A - II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme - Google Patents

II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme Download PDF

Info

Publication number
CN108929883A
CN108929883A CN201810886538.5A CN201810886538A CN108929883A CN 108929883 A CN108929883 A CN 108929883A CN 201810886538 A CN201810886538 A CN 201810886538A CN 108929883 A CN108929883 A CN 108929883A
Authority
CN
China
Prior art keywords
spo
follows
gene
pcr amplification
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810886538.5A
Other languages
Chinese (zh)
Other versions
CN108929883B (en
Inventor
肖静
王瑞明
原梨萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qilu University of Technology
Original Assignee
Qilu University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qilu University of Technology filed Critical Qilu University of Technology
Priority to CN201810886538.5A priority Critical patent/CN108929883B/en
Publication of CN108929883A publication Critical patent/CN108929883A/en
Application granted granted Critical
Publication of CN108929883B publication Critical patent/CN108929883B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411—Amylases

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to II E of sporulation related gene spo to influence the application in strain growth and producing enzyme.The present invention is in such a way that plug-in type inactivates, by II E partial gene fragments of spo and CmrGene Fusion, II E-Cm of fusion sporIt is inserted into II E gene order of Bacillus clausii spo, make II E gene of spo can not normal expression and inactivate, II E gene deactivated strain of spo can not only be such that gemma production rate significantly reduces to 0.3%, and makes the quickening more obvious than original strain of the engineered strain speed of growth, realize the fermenting and producing of the amylase of the accumulation and higher vigor of cell quantity in a shorter time.The present invention constructs the Bacillus clausii of low gemma yield, and overcome Bacillus clausii cannot achieve the problem of high density is continuously fermented in commercial process, can effectively improve the production intensity of target enzyme, be with a wide range of applications.

Description

II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme
Technical field
The present invention relates to II E of sporulation related gene spo to influence the application in strain growth and producing enzyme, belongs to point Sub- biology techniques field.
Background technique
Bacillus clausii (Bacillus clausii) is industrial enzyme production bacterial strain, in process of production with gemma Formation fermentation can be had an impact, the yield of limited target enzyme, reduce production efficiency.Constructing gemma missing bacterium is to a gram Lloyd's The important directions that the cell factories such as bacillus are transformed.There are many sporulation related gene, as spo0A, sigmaE, SigmaK etc., single-gene function and Interaction among genes relationship existing research report of these genes during sporulation, In, II E of Spo is the Major modulators in gemma process, is in forespore forming process necessary to SigmaF factor activator Phosphoprotein phosphatase, in genoneme formation, the tubulin homologous protein FtsZ positioned at cell center is passing through a spiral shell It can be re-positioned near bacterium the two poles of the earth after rotation structural transition, this repositioning of expression initiation of II E of spo, one wherein Site inspires bacterium mal-distribution, and then pushes being differentiated to form for gemma.Further study show that gemma gene not only influences The formation of gemma also has adjustment effect, such as the spo0A of certain threshold value for the structure of bacterial strain, growth, metabolite generation etc. It can promote the formation of thallus envelope；III D of spo in bacillus thuringiensis be only formed gemma institute it is necessary, also with crystal Protein expression is related；In clostridium sporogene, sporulation related gene can influence sporulation, also with acetone, butanol etc. The fermenting and producing of organic matter is related.And in Bacillus clausii, II E gene deletion strains of Spo are constructed, it can be in control gram While the formation of Lloyd's's bacillus spore, the accumulation of strain growth speed and biomass is improved, improves the ectoenzymes such as amylase Fermentative activity.
Summary of the invention
In view of the deficiencies of the prior art, the present invention provides II E of sporulation related gene spo influence strain growth and Application in producing enzyme.
Technical scheme is as follows:
II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme, II E's of gene spo Nucleotide sequence is as shown in SEQ ID NO.1.
Preferred according to the present invention, the producing enzyme is to produce amylase, and the enzyme activity of amylase is 5~6 times of starting strain.
Preferred according to the present invention, II E of sporulation related gene spo is in influencing strain growth and producing enzyme Using steps are as follows:
(1) genomic DNA for extracting Bacillus clausii, using genomic DNA as template progress PCR amplification, obtained gram Lloyd's's bacillus spore forms II E of related gene spo, and the nucleotide sequence of II E of gene spo is as shown in SEQ ID NO.1；
(2) PCR amplification is carried out by template of pHT01 plasmid, amplification obtains CmrSegment, CmrThe nucleotide sequence of segment is such as Shown in SEQ ID NO.2；
(3) by Cm made from II E of gene spo made from step (1) and step (2)rSegment is melted using over-lap PCR It closes, obtains II E-Cm of fusion spor；
(4) by II E-Cm of fusion spo of step (3)rAfter digestion, then concentration converts Bacillus clausii Competent cell is screened to obtain positive restructuring bacterium, that is, can be applied to thalli growth and producing enzyme.
Preferred according to the present invention, in the step (1), PCR amplification primer nucleotide sequences are as follows, and underscore is BamHI restriction enzyme site:
II E-F of spo:CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；
II E-R:GCCAGCAAAAAGCGTTCCTACAAGTAAGCC of spo；
PCR amplification system is as follows, 50 μ L of total volume:
2 × HiFi-PCR Master 25 μ L, II E-F of primer spo 2.5 μ L, II E-R of primer spo 2.5 μ L, Ke Lao Family name's subtilis genomic dna 2.5 μ L, ddH2O 17.5μL；
PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extension 1min45s, totally 30 recycle；72 DEG C continue to extend 10min.
Preferred according to the present invention, in the step (2), PCR amplification primer nucleotide sequences are as follows, and underscore is BamHI restriction enzyme site:
Cmr- F:CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC；
Cmr- R:CGCGGATCCTAGTGACTGGCGATGCTG；
PCR amplification system is as follows, 50 μ L of total volume:
2 × HiFi-PCR Master 25 μ L, primer Cmr- F 2.5 μ L, primer Cmr2.5 μ L, pHT01 plasmid of-R, 2.5 μ L, ddH2O 17.5μL；
PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min40s, totally 30 recycle；72 DEG C continue to extend 10min.
According to the present invention it is further preferred that in the step (3), the amplimer nucleotide sequence of over-lap PCR is as follows, Underscore is BamHI restriction enzyme site:
II E-F of spo:CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；
Cmr- R:CGCGGATCCTAGTGACTGGCGATGCTG；
First round over-lap PCR amplification system is as follows, 25 μ L of total volume:
II E segment of 2 × HiFi-PCR Master 12.5 μ L, glue recovery product spo 2 μ L, glue recovery product CmrSegment 2 μ L, ddH2O 8.5μL；
First round over-lap PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min40s, 5 recycle；72 DEG C after It renews and stretches 10min；
Second wheel over-lap PCR amplification system is that following reagent is added on the basis of first round PCR amplification system:
2 × HiFi-PCR Master 12.5 μ L, II E-F of primer spo 1 μ L, primer Cmr- R 1 μ L, ddH2O 10.5μ L；
Second wheel over-lap PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 4min25s, totally 30 recycle；72 DEG C continue to extend 10min.
Preferred according to the present invention, in the step (4), digestion system is as follows, 40 μ L of total volume:
20 μ L, 10 × K Buffer of overlapping PCR products, 4 I restriction endonuclease of μ L, BamH 2 μ L, ddH2O 14μL；
Digestion condition are as follows: 37 DEG C, 1.5h.
It is preferred according to the present invention, in the step (4), II E-Cm of fusion spo after concentrationrConcentration be 300~ 500ng/μL。
According to the present invention it is further preferred that in the step (4), Bacillus clausii competent cell, step are converted It is rapid as follows:
By the digestion products after concentration under conditions of 1500~1800V electrotransformation Bacillus clausii competent cell 4~5ms, then under the conditions of 37 DEG C in liquid resuscitation culture medium cultivate 3~4h to get.
It is further preferred that the liquid resuscitation nutrient media components are as follows, it is weight percentage:
Peptone 1%, yeast extract 0.5%, sodium chloride 1%, sorbierite 9%, mannitol 7%, excess water, pH=7.0 ~7.4.
It is further preferred that the preparation step of the Bacillus clausii competent cell is as follows:
The fresh Bacillus clausii single colonie of picking, culture to cell concentration OD600=0.9~1.0, it is placed on ice It is cooling, it is centrifuged after cooling, is then turned buffer washing thalline 3~5 times with the electricity of pre-cooling, electricity turns to dispense after thallus is resuspended in buffer To the sterile EP tube of pre-cooling, Bacillus clausii competent cell is made.
Wherein, it is as follows to turn buffer composition for the electricity:
The sorbierite that mass percent is 9.1%, the mannitol that mass percent is 9.1%, percent by volume 10% Glycerol, excess water.
Preferred according to the present invention, in the step (4), screening step is as follows:
Bacillus clausii after conversion is coated with the LB plate containing chloramphenicol, 37 DEG C of cultures 12~for 24 hours, it chooses positive Bacterial strain, it is identified to get.
It is further preferred that the LB solid that it is 25 μm of ol/mL containing chloramphenicol concentration that the LB plate containing chloramphenicol, which is, Culture medium.
Beneficial effect
1, the work present invention firstly discloses II E of sporulation related gene spo in terms of controlling strain growth speed With in such a way that plug-in type inactivates, by II E partial gene fragments of spo and CmrGene Fusion, II E-Cm of fusion spor Be inserted into II E gene order of Bacillus clausii spo in, make II E gene of spo can not normal expression and inactivate, II E base of spo Because deactivated strain can not only be such that gemma production rate significantly reduces to 0.3%, and the engineered strain speed of growth is made to compare original bacteria Strain is obvious to be accelerated, and the accumulation of cell quantity in a shorter time is realized；
2, the engineered strain that the present invention constructs improves the fermentation enzyme activity of amylase, and it is raw to be conducive to bacillus category enzyme preparation Produce the genetic breeding and industrialized production of bacterial strain.
Detailed description of the invention
Fig. 1 is the agarose gel electrophoresis figure of II E genetic fragment of Bacillus clausii spo of the present invention；
In figure: swimming lane M is that DNA molecular amount marks (DNA marker), and swimming lane 1~3 is II E gene band of spo, size For 793bp；
Fig. 2 is Cm of the present inventionrThe agarose gel electrophoresis figure of genetic fragment；
In figure: swimming lane M is that DNA molecular amount marks (DNA marker), and swimming lane 1~4 is CmrGene band, size are 1259bp；
Fig. 3 is the agarose gel electrophoresis figure that II E gene of Bacillus clausii spo of the present invention inactivates transformant verifying；
In figure: swimming lane M is that DNA molecular amount marks (DNA marker), and swimming lane 1~4 is transformant band, and size is 2028bp；
Fig. 4 is that II E deactivated strain of spo and starting strain cell concentration change line chart；
In figure: II E of B.clausii QL-1 Δ spo is II E deactivated strain of spo, and B.clausii QL-1 is bacterium germination Strain.
Specific embodiment
Below with reference to embodiment, technical scheme is described further, but institute's protection scope of the present invention is not limited to This.
Term used in this method generally there are those of ordinary skill in the art usually to manage unless otherwise specified The meaning of solution.
Below in an example, be not described in detail and various processes and method are routine sides as known in the art Method.The source of agents useful for same, product name and it is necessary to list its constituent person, are indicated on the first occurrence, thereafter Same reagents used unless otherwise specified, is the same as indicated for the first time.
Biological material source:
Bacillus clausii (Bacillus clausii) in embodiment is received wound connection biotechnology purchased from Beijing North and is ground Study carefully institute, bacterium numbering: BNCC160124, for common commercially available bacterial strain；
Plasmid pHT01 matches biological Co., Ltd purchased from Hangzhou treasured.
LB solid medium component is as follows, is mass percent:
Peptone 1%, yeast extract 0.5%, sodium chloride 1%, agar 2%, excess water, pH=7.0~7.4；
LB nutrient media components are as follows, are mass percent:
Peptone 1%, yeast extract 0.5%, sodium chloride 1%, excess water, pH=7.0~7.4
Embodiment 1: the preparation of target gene fragment
(I) is extracted Bacillus clausii genomic DNA and (is said according to Ezup pillar bacterial genomes DNA extraction agent box Bright book)
According to the nucleotide sequence design primer of II E gene of spo, BamHI restriction enzyme site is introduced in upstream primer, under It swims primer and adds Cmr10, the end the 5' base of segment, primer are synthesized by Sangon Biotech (Shanghai) Co., Ltd..Using 2 × HiFi-PCR Master polymerase of precious bioengineering Co., Ltd, using Bacillus clausii genomic DNA as template Expand II E gene of spo.Primer nucleotide sequences are as follows, and what wherein underscore represented is BamHI restriction enzyme site.
II E-F of spo:CGCGGATCC CCTTAAAAGCGGAGCCAAAAC
II E-R:GCCAGCAAAAAGCGTTCCTACAAGTAAGCC of spo；
PCR amplification system is as follows, 50 μ L of total volume:
2 × HiFi-PCR Master 25 μ L, II E-F of primer spo 2.5 μ L, II E-R of primer spo 2.5 μ L, Ke Lao Family name's subtilis genomic dna 2.5 μ L, ddH2O 17.5μL；
PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extension 1min45s, totally 30 recycle；72 DEG C continue to extend 10min.
Agarose gel electrophoresis examines PCR product, as a result as shown in Figure 1, the length of II E of target gene spo is 793bp (SEQ ID NO.1), II E of PCR product spo that clone is obtained carry out glue using SanPrep pillar DNA plastic recovery kit Recycling, -20 DEG C of gained DNA solution save backup.
(II) target gene CmrThe acquisition of gene
Using pHT01 plasmid as template, the Cm that is obtained through PCR amplificationrGenetic fragment.
Wherein the primer nucleotide sequences of PCR amplification are as follows, and BamHI restriction enzyme site, upstream primer are introduced in downstream primer In addition II 14, the end E 3' base of spo, what wherein underscore represented is BamHI restriction enzyme site:
Cmr- F:CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC
Cmr- R:CGCGGATCCTAGTGACTGGCGATGCTG；
PCR amplification system, 50 μ L of total volume:
2 × HiFi-PCR Master 25 μ L, primer Cmr- F 2.5 μ L, primer Cmr2.5 μ L, pHT01 plasmid of-R, 2.5 μ L, ddH2O 17.5μL；
PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min40s, totally 30 recycle；72 DEG C continue to extend 10min.
Agarose gel electrophoresis examines PCR product, as a result as shown in Fig. 2, target gene CmrLength be 1259bp (SEQ ID NO.2), the PCR product Cm that clone is obtainedrGlue recycling is carried out using SanPrep pillar DNA plastic recovery kit, DNA is molten - 20 DEG C of liquid save backup.
(III) is by Cm made from II E of gene spo made from step (I) and step (II)rSegment is carried out using over-lap PCR II E-Cm of spo is made in fusionrSegment；
Used primer nucleotide sequences are as follows, and what underscore represented is BamHI restriction enzyme site:
II E-F of spo:CGCGGATCC CCTTAAAAGCGGAGCCAAAAC
Cmr- R:CGCGGATCC TAGTGACTGGCGATGCTG
First round over-lap PCR amplification system is as follows, 25 μ L of total volume:
II E segment of 2 × HiFi-PCR Master 12.5 μ L, glue recovery product spo 2 μ L, glue recovery product CmrSegment 2 μ L, ddH2O 8.5μL；
First round over-lap PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min40s, 5 recycle；72 DEG C after It renews and stretches 10min.
Second wheel over-lap PCR amplification system is that following reagent is added on the basis of first round PCR amplification system:
2 × HiFi-PCR Master 12.5 μ L, II E-F of primer spo 1 μ L, primer Cmr- R 1 μ L, ddH2O 10.5μ L；
Second wheel over-lap PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 4min25s, totally 30 recycle；72 DEG C continue to extend 10min.
Equally, agarose gel electrophoresis examines PCR product, detects II E-Cm of target gene sporLength be 2028bp (SEQ ID NO.3), II E-Cm of PCR product spo that clone is obtainedrIt is recycled and is tried using SanPrep pillar DNA glue Agent box carries out glue recycling, and -20 DEG C of gained DNA solution saves backup.
Embodiment 2: Bacillus clausii competence is prepared
The fresh Bacillus clausii single colonie of (I) picking, is inoculated in 10mL LB culture medium, 37 DEG C, 200r/min Cultivate 12h；
(II) takes 2.0mL bacterium solution to be transferred to 50mL GM culture medium, and 37 DEG C, 200r/min cultivate 4h to OD600=1.0；
(III) bacterium solution is transferred to 50mL centrifuge tube, ice bath 10min；
(IV) 4 DEG C after ice bath, 5000r/min is centrifuged 5min, collects thallus；
(V) electricity of the thallus pre-cooling after being centrifuged turns buffer (ETM) and washs 3 times；
(VI) after washing, turn buffer using 1000 μ L electricity and thallus is resuspended；
(VII) competent cell prepared dispenses 100 μ L/ pipe, and -80 DEG C of preservations are spare.
Wherein, GM culture medium: LB culture medium+0.5mol/L sorbierite；
Electricity turns buffer (ETM): the sorbierite that mass percent is 9.1%, the mannitol that mass percent is 9.1%, The glycerol that percent by volume is 10%, excess water.
II E-Cm of embodiment 3:sporSegment electrotransformation Bacillus clausii
(I) is by II E-Cm of sporSegment is digested with restriction enzyme BamH I；
Digestion system (40 μ L) is as follows:
10 × K Buffer, 4 I restriction endonuclease of μ L, BamH 2 μ L, over-lap PCR glue recovery product 20 μ L, ddH2O 14μL；
Digestion condition are as follows: 37 DEG C, 1.5h.
Digestion products are concentrated in (II)
1/10 volume 3mol/L sodium acetate and 2.5 times of volume dehydrated alcohols is added, is placed in -20 DEG C of refrigerator 20min； 12000r/min centrifugation 5min must be precipitated；The ethanol solution of 300 μ L75% (percent by volume) is added in precipitating, it is heavy to be resuspended It forms sediment；12000r/min, is centrifuged 5min, and 37 DEG C of air-dried 30min remove ethyl alcohol；20 μ L ddH are added2DNA is resuspended in O, and -20 DEG C save, It is spare.
(III) electrotransformation
Measure II E-Cm of sporFragment concentrations reach 470ng/ μ L, after competent cell and enriched product ice bath 5min 1500V, 5ms electrotransformation, cell cultivates 4h in 37 DEG C of recoveries through liquid resuscitation culture medium RM, after 4000r/min is centrifuged 5min, 100 μ L supernatants, which suspend, to be precipitated, and 25 μm of ol/mL chloramphenicol plates, 37 DEG C of constant temperature incubation 20h are coated with, and screening has chlorampenicol resistant Transformant；
The liquid resuscitation culture medium RM component is as follows, is weight percentage:
Peptone 1%, yeast extract 0.5%, sodium chloride 1%, sorbierite 9%, mannitol 7%, excess water, pH=7.2.
Embodiment 4: the culture and identification of positive restructuring bacterium
The above-mentioned positive restructuring bacterium colony of picking, is inoculated into the LB liquid medium containing chlorampenicol resistant, 37 DEG C of culture 12h Afterwards, bacterium solution multigelation 3~4 times, using bacterium solution as template, spo II E-F and Cmr- R is that primer carries out PCR amplification, amplified production It is verified using agarose gel electrophoresis, verification result is as shown in Figure 3；
The PCR primer sequence is as follows；
II E-F of spo:CGCGGATCC CCTTAAAAGCGGAGCCAAAAC
Cmr- R:CGCGGATCC TAGTGACTGGCGATGCTG
Wherein, restriction enzyme site is identified with underscore.
The PCR amplification system is 25 μ L:
2 × HiFi-PCR Master, 12.5 μ L, 2 II E-F of μ L, spo of bacterium solution 1 μ L, Cmr- R 1 μ L, ddH2O 8.5μL；
PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 4min25s, 30 recycle；72℃ Continue to extend 10min.
Embodiment 5: the measurement of gemma production rate
(I) Example 4 is accredited as the strain of positive restructuring bacterium, in the LB solid culture containing 25 μm of ol/mL chloramphenicol It is activated repeatedly in base 2 times, 37 DEG C of stationary culture 20h；It chooses single bacterium and falls within 10mL LB liquid medium, 37 DEG C, 200r/min culture 12h is inoculated in the 100mL LB liquid medium containing 25 μm of ol/mL chloramphenicol, 37 DEG C, 200r/ with 2% inoculum concentration Min culture；
The measuring method of (II) gemma production rate are as follows:
The bacterium solution of culture 36h in step (I) is taken, 80 DEG C of water bath processing 10min, ice bath 5min dilute suitable multiple, take 100 μ L are coated with LB plate, and for 24 hours, plate count simultaneously calculates gemma production rate to 37 DEG C of constant temperature incubations, starting strain and nonheat-treated Positive restructuring bacterial strain compares, and count results are as shown in table 1.
Wherein, gemma production rate (%)=(gemma number/total viable count) × 100%.
The measurement of II E deactivated strain gemma production rate of 1 starting strain of table and spo
It can be seen from the above result that recombination Bacillus clausii (II E gene of spo inactivation) gemma production rate is 0.3%, Starting strain is that the gemma production rate of 89.5%, spo, II E gene deactivated strain is greatly lowered.
Embodiment 6: the measurement of growth cycle
(I) Example 4 is accredited as the strain of positive restructuring bacterium, in the LB solid culture containing 25 μm of ol/mL chloramphenicol It is activated repeatedly in base 2 times, 37 DEG C of culture 20h；Choose single bacterium and fall within 10mL LB liquid medium, 37 DEG C, 200r/min cultivate 12h, It is inoculated in the 100mL LB liquid medium containing 25 μm of ol/mL chloramphenicol with 2% inoculum concentration, 37 DEG C, 200r/min training It supports；
(II) is sampled every 2~4h, and dilution suitable multiple measures spectrophotometric value under 600nm.
The variation of spectrophotometric value is as shown in figure 4, as the result is shown: II E gene deactivated strain of spo is logarithm in 2~18h Growth period, 18~28h are stationary phase, are decline phase after 28h, and II E gene deactivated strain OD during measurement of spo600All Greater than starting strain, thallus accumulation in the unit time is effectively increased.
Embodiment 7: the enzyme activity determination of amylase
The II E gene deactivated strain of spo that (I) starting strain and embodiment 4 are identified is in containing 25 μm of ol/mL chloramphenicol It is activated repeatedly in LB solid medium 2 times, 37 DEG C of stationary culture 20h；It chooses single bacterium and falls within 10mL LB liquid medium, 37 DEG C, 200r/min cultivates 12h, is inoculated in the 100mL fermentation medium containing 25 μm of ol/mL chloramphenicol with 3% inoculum concentration, 37 DEG C, 200r/min culture；After 72h, fermentation culture is taken, through clasmatosis, starch enzyme purification, obtains enzyme solution to be measured；
(II) amylase enzyme activity determination method particularly includes: draw 20.0mL soluble starch solution in test tube, be added Phosphate buffer 5.0mL after shaking up, is placed in 60 DEG C of waters bath with thermostatic control and preheats 8min；Step (i) system that 1.0mL has diluted is added Standby enzyme solution to be measured, immediately timing shake up, and react 5min；1.0mL reaction solution is drawn with automatic pipettor immediately, is added in advance It does not fill and terminates reaction in the test tube of 0.5mL 0.1mol/L hydrochloric acid solution, add the dilute iodine solution of 5.0mL, not plus dilute iodine of reaction solution Liquid is blank, measures absorbance under 660nm wavelength, according to tables of data check in absorbance corresponding to enzyme solution concentration.
(III) enzyme activity calculation formula: X=c × n
In formula: the enzyme activity [IU/g (IU/mL)] of X- sample
The concentration (IU/mL) of c- sample enzyme solution
The extension rate of n- sample
Enzyme activity definition: 1mL liquid enzymes, in 60 DEG C, under the conditions of pH=6.0, enzyme amount needed for 1h liquefaction 1g soluble starch, i.e., For 1 enzyme activity unit (U/mL).
By the measurement of dry weight, amylase enzyme-activity unit U/mL is scaled U/g.
The fermentation medium preparation method is as follows:
A. 2g (being accurate to 0.001g) soluble starch is weighed in beaker, is tuned into slurry with a small amount of water, while stirring It is slowly added into 40mL boiling water, the beaker of dress starch is then rinsed with moisture time, washing lotion is poured into wherein, is heated with stirring to completely thoroughly It is bright, it is cooling, 1g peptone and 2g yeast powder is added, stirring is settled to 50mL to after dissolving, and 121 DEG C, 20min sterilizing is spare.
B. 2.66g Na is weighed2HPO4With 0.66g NaH2PO4, 50mL is settled to after being dissolved in water, 121 DEG C, 20min goes out Bacterium, it is spare.
A liquid and B liquid cooling are but mixed afterwards, as fermentation medium.
The soluble starch solution preparation method is as follows:
2.000g (being accurate to 0.001g) soluble starch is weighed in beaker, is tuned into slurry, side stirring with a small amount of water While being slowly added into 70mL boiling water, the beaker of dress starch is then rinsed with moisture time, washing lotion is poured into wherein, is heated with stirring to completely Transparent, cooling is settled to 100mL.
The phosphoric acid buffer liquid is as follows: weighing 45.23g disodium hydrogen phosphate and 8.07g citric acid, use is water-soluble Solution is settled to 1000mL, adjusts pH=6.0.
It is computed, amylase enzyme activity is 4.8 × 10 after II E deactivated strain of spo fermentation 72h5U·g-1, starting strain fermentation Amylase enzyme activity is 0.86 × 10 after 72h5U·g-1, the amylase enzyme activity of II E deactivated strain of spo is the 5.58 of starting strain Times, II E deactivated strain of spo effectively improves compared with starting strain amylase fermentative activity.
SEQUENCE LISTING
<110>Qilu University of Technology
<120>II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 793
<212> DNA
<213> Bacillus clausii
<400> 1
ccttaaaagc ggagccaaaa cggtgcttta tgattggggc atattcattg ccattcttgg 60
ttttctgcta ggaagggcta tgattttatc agagttgacg ccatttatct tgccattctt 120
ggcggccgtg ttcttgttaa gacgctctca atcactcatt gctgcagctt cattattagc 180
aggtgctgtg ttcagtttcc atggtcagtt gatttttgcg attgcaggga tcgggttttt 240
tcttattctg tacaaatgta tgaaaatgtt catgaagtac cctgctaaat cgctccctta 300
tcttgtgttt tcagctagta tcgccacgag gctgtcactc gtatttttga cagaaggtgg 360
attaagccaa tatgcgatga tgatggctac agtcgaagcg gcgcttagct ttatcctgac 420
aatgatcttt atccaaagca taccgcttgt gacaggaaaa agaggcggac aagcactccg 480
gaatgaagaa attatttgtt taattatttt gcttgcctct gtaatgacag gaacagtcgg 540
ttggacgata aatgaagctg tgcttcagca tagctttgca agttatctcg ttttagtgtt 600
tgcttttgtt ggcggggctg caataggctc gactgtcgga gtggtgacag gcttgatttt 660
aagcttggcc agtttagcaa gtctttatca gatgagtctg cttgcctttg caggcttgtt 720
aggagggttg ttaaaggaag ggaaacggat cggcgtgtca cttggcttac ttgtaggaac 780
gctttttgct ggc 793
<210> 2
<211> 1259
<212> DNA
<213>artificial sequence
<400> 2
cttgtaggaa cgctttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg 60
attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa 120
cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcccaata cgcatgctta 180
agttattggt atgactggtt ttaagcgcaa aaaaagttgc tttttcgtac ctattaatgt 240
atcgttttag aaaaccgact gtaaaaagta cagtcggcat tatctcatat tataaaagcc 300
agtcattagg cctatctgac aattcctgaa tagagttcat aaacaatcct gcatgataac 360
catcacaaac agaatgatgt acctgtaaag atagcggtaa atatattgaa ttacctttat 420
taatgaattt tcctgctgta ataatgggta gaaggtaatt actattatta ttgatattta 480
agttaaaccc agtaaatgaa gtccatggaa taatagaaag agaaaaagca ttttcaggta 540
taggtgtttt gggaaacaat ttccccgaac cattatattt ctctacatca gaaaggtata 600
aatcataaaa ctctttgaag tcattcttta caggagtcca aataccagag aatgttttag 660
atacaccatc aaaaattgta taaagtggct ctaacttatc ccaataacct aactctccgt 720
cgctattgta accagttcta aaagctgtat ttgagtttat cacccttgtc actaagaaaa 780
taaatgcagg gtaaaattta tatccttctt gttttatgtt tcggtataaa acactaatat 840
caatttctgt ggttatacta aaagtcgttt gttggttcaa ataatgatta aatatctctt 900
ttctcttcca attgtctaaa tcaattttat taaagttcat ttgatatgcc tcctaaattt 960
ttatctaaag tgaatttagg aggcttactt gtctgctttc ttcattagaa tcaatccttt 1020
tttaaaagtc aatattactg taacataaat atatatttta aaaatatccc actttatcca 1080
attttcgttt gttgaactaa tgggtgcttt agttgaagaa taaaagacca cattaaaaaa 1140
tgtggtcttt tgtgtttttt taaaggattt gagcgtagcg aaaaatcctt ttctttctta 1200
tcttgataat aagggtaact attgccgatc gtccattccg acagcatcgc cagtcacta 1259
<210> 3
<211> 2028
<212> DNA
<213>artificial sequence
<400> 3
ccttaaaagc ggagccaaaa cggtgcttta tgattggggc atattcattg ccattcttgg 60
ttttctgcta ggaagggcta tgattttatc agagttgacg ccatttatct tgccattctt 120
ggcggccgtg ttcttgttaa gacgctctca atcactcatt gctgcagctt cattattagc 180
aggtgctgtg ttcagtttcc atggtcagtt gatttttgcg attgcaggga tcgggttttt 240
tcttattctg tacaaatgta tgaaaatgtt catgaagtac cctgctaaat cgctccctta 300
tcttgtgttt tcagctagta tcgccacgag gctgtcactc gtatttttga cagaaggtgg 360
attaagccaa tatgcgatga tgatggctac agtcgaagcg gcgcttagct ttatcctgac 420
aatgatcttt atccaaagca taccgcttgt gacaggaaaa agaggcggac aagcactccg 480
gaatgaagaa attatttgtt taattatttt gcttgcctct gtaatgacag gaacagtcgg 540
ttggacgata aatgaagctg tgcttcagca tagctttgca agttatctcg ttttagtgtt 600
tgcttttgtt ggcggggctg caataggctc gactgtcgga gtggtgacag gcttgatttt 660
aagcttggcc agtttagcaa gtctttatca gatgagtctg cttgcctttg caggcttgtt 720
aggagggttg ttaaaggaag ggaaacggat cggcgtgtca cttggcttac ttgtaggaac 780
gctttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga ttctgtggat 840
aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac gaccgagcgc 900
agcgagtcag tgagcgagga agcggaagag cgcccaatac gcatgcttaa gttattggta 960
tgactggttt taagcgcaaa aaaagttgct ttttcgtacc tattaatgta tcgttttaga 1020
aaaccgactg taaaaagtac agtcggcatt atctcatatt ataaaagcca gtcattaggc 1080
ctatctgaca attcctgaat agagttcata aacaatcctg catgataacc atcacaaaca 1140
gaatgatgta cctgtaaaga tagcggtaaa tatattgaat tacctttatt aatgaatttt 1200
cctgctgtaa taatgggtag aaggtaatta ctattattat tgatatttaa gttaaaccca 1260
gtaaatgaag tccatggaat aatagaaaga gaaaaagcat tttcaggtat aggtgttttg 1320
ggaaacaatt tccccgaacc attatatttc tctacatcag aaaggtataa atcataaaac 1380
tctttgaagt cattctttac aggagtccaa ataccagaga atgttttaga tacaccatca 1440
aaaattgtat aaagtggctc taacttatcc caataaccta actctccgtc gctattgtaa 1500
ccagttctaa aagctgtatt tgagtttatc acccttgtca ctaagaaaat aaatgcaggg 1560
taaaatttat atccttcttg ttttatgttt cggtataaaa cactaatatc aatttctgtg 1620
gttatactaa aagtcgtttg ttggttcaaa taatgattaa atatctcttt tctcttccaa 1680
ttgtctaaat caattttatt aaagttcatt tgatatgcct cctaaatttt tatctaaagt 1740
gaatttagga ggcttacttg tctgctttct tcattagaat caatcctttt ttaaaagtca 1800
atattactgt aacataaata tatattttaa aaatatccca ctttatccaa ttttcgtttg 1860
ttgaactaat gggtgcttta gttgaagaat aaaagaccac attaaaaaat gtggtctttt 1920
gtgttttttt aaaggatttg agcgtagcga aaaatccttt tctttcttat cttgataata 1980
agggtaacta ttgccgatcg tccattccga cagcatcgcc agtcacta 2028

Claims (10)

1. II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme, which is characterized in that the gene The nucleotide sequence of II E of spo is as shown in SEQ ID NO.1.
2. II E of sporulation related gene spo as described in claim 1 is influencing the application in strain growth and producing enzyme, It is characterized in that, the producing enzyme is to produce amylase, and the enzyme activity of amylase is 5~6 times of starting strain.
3. II E of sporulation related gene spo as described in claim 1 is influencing the application in strain growth and producing enzyme, It is characterized in that, steps are as follows:
(1) genomic DNA for extracting Bacillus clausii carries out PCR amplification by template of genomic DNA, gram Lloyd's is made Bacillus spore forms II E of related gene spo, and the nucleotide sequence of II E of gene spo is as shown in SEQ ID NO.1；
(2) PCR amplification is carried out by template of pHT01 plasmid, amplification obtains CmrSegment, CmrThe nucleotide sequence of segment such as SEQ Shown in ID NO.2；
(3) by Cm made from II E of gene spo made from step (1) and step (2)rSegment is merged using over-lap PCR, is obtained II E-Cm of fusion spor；
(4) by II E-Cm of fusion spo of step (3)rAfter digestion, then concentration converts Bacillus clausii, through sieving Positive strain is selected to obtain, that is, can be applied to thalli growth and producing enzyme；Preferably, II E-Cm of fusion spo after the concentrationr's Concentration is 300~500ng/ μ L.
4. application as claimed in claim 3, which is characterized in that in step (1), the primer nucleotide sequences of the PCR amplification It is as follows:
II E-F of spo:CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；
II E-R:GCCAGCAAAAAGCGTTCCTACAAGTAAGCC of spo；
PCR amplification system is as follows, 50 μ L of total volume:
2 × HiFi-PCR Master 25 μ L, II E-F of primer spo 2.5 μ L of 2.5 μ L, II E-R of primer spo, gram Lloyd's's gemma Vaccae genomic dna 2.5 μ L, ddH2O 17.5μL；
PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extension 1min45s, totally 30 recycle；72 DEG C after It renews and stretches 10min.
5. application as claimed in claim 3, which is characterized in that in step (2), the primer nucleotide sequences of the PCR amplification It is as follows:
Cmr- F:CTTGTAGGAACGCTTTTTGCTGGCCTTTTGCTC；
Cmr- R:CGCGGATCCTAGTGACTGGCGATGCTG；
PCR amplification system is as follows, 50 μ L of total volume:
2 × HiFi-PCR Master 25 μ L, primer Cmr- F 2.5 μ L, primer Cmr2.5 μ L, pHT01 plasmid of-R, 2.5 μ L, ddH2O 17.5μL；
PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min40s, totally 30 recycle；72 DEG C after It renews and stretches 10min.
6. application as claimed in claim 3, which is characterized in that in step (3), the amplimer nucleotide of the over-lap PCR Sequence is as follows:
II E-F of spo:CGCGGATCCCCTTAAAAGCGGAGCCAAAAC；
Cmr- R:CGCGGATCCTAGTGACTGGCGATGCTG；
First round over-lap PCR amplification system is as follows, 25 μ L of total volume:
II E segment of 2 × HiFi-PCR Master 12.5 μ L, glue recovery product spo 2 μ L, glue recovery product Cmr2 μ L of segment, ddH2O 8.5μL；
First round over-lap PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min40s, 5 recycle；72 DEG C after reneing Stretch 10min；
Second wheel over-lap PCR amplification system is that following reagent is added on the basis of first round PCR system:
2 × HiFi-PCR Master 12.5 μ L, II E-F of primer spo 1 μ L, primer Cmr- R 1 μ L, ddH2O 10.5μL；
Second wheel over-lap PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 4min25s, totally 30 recycle；72 DEG C after It renews and stretches 10min.
7. application as claimed in claim 3, which is characterized in that in step (4), the reaction system of the digestion is as follows, overall 40 μ L of product:
20 μ L, 10 × K Buffer of overlapping PCR products, 4 I restriction endonuclease of μ L, BamH 2 μ L, ddH2O 14μL；
Digestion condition are as follows: 37 DEG C, 1.5h.
8. application as claimed in claim 3, which is characterized in that in step (4), the conversion Bacillus clausii, step It is as follows:
By the digestion products after concentration under conditions of 1500~1800V electrotransformation Bacillus clausii competent cell 4~ 5ms, then under the conditions of 37 DEG C in liquid resuscitation culture medium cultivate 3~4h to get；
Wherein liquid resuscitation nutrient media components are as follows, are weight percentage:
Peptone 1%, yeast extract 0.5%, sodium chloride 1%, sorbierite 9%, mannitol 7%, excess water, pH=7.0~ 7.4。
9. application as claimed in claim 8, which is characterized in that the preparation step of the Bacillus clausii competent cell It is as follows:
The fresh Bacillus clausii single colonie of picking, culture to cell concentration OD600=0.9~1.0, it is placed in cooled on ice, It is centrifuged after cooling, is then turned buffer washing thalline 3~5 times with the electricity of pre-cooling, electricity turns to dispense after thallus is resuspended in buffer to pre- Bacillus clausii competent cell is made in cold sterile EP tube；
Wherein it is as follows to turn buffer composition for electricity:
Mass percent be 9.1% sorbierite, mass percent be 9.1% mannitol, percent by volume be 10% it is sweet Oil, excess water.
10. application as claimed in claim 3, which is characterized in that in step (4), the step of screening is as follows:
By after conversion Bacillus clausii be coated with the LB plate containing chloramphenicol, 37 DEG C culture 12~for 24 hours, choose positive bacteria Strain, it is identified to get；
Wherein the LB plate containing chloramphenicol is the LB solid medium for being 25 μm of ol/mL containing chloramphenicol concentration.
CN201810886538.5A 2018-08-06 2018-08-06 Application of spoIII E gene related to sporulation in influencing growth of strain and producing enzyme Active CN108929883B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810886538.5A CN108929883B (en) 2018-08-06 2018-08-06 Application of spoIII E gene related to sporulation in influencing growth of strain and producing enzyme

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810886538.5A CN108929883B (en) 2018-08-06 2018-08-06 Application of spoIII E gene related to sporulation in influencing growth of strain and producing enzyme

Publications (2)

Publication Number Publication Date
CN108929883A true CN108929883A (en) 2018-12-04
CN108929883B CN108929883B (en) 2020-05-01

Family

ID=64444827

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810886538.5A Active CN108929883B (en) 2018-08-06 2018-08-06 Application of spoIII E gene related to sporulation in influencing growth of strain and producing enzyme

Country Status (1)

Country Link
CN (1) CN108929883B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110055204A (en) * 2019-05-10 2019-07-26 齐鲁工业大学 A kind of method and application for knocking out II Q and pcf gene of spo and improving the lichen bacillus ferments producing enzyme
CN113621540A (en) * 2021-08-11 2021-11-09 沈阳农业大学 Bacillus clausii strain and screening method and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1513057A (en) * 2001-05-29 2004-07-14 ������������ʽ���� Host microorganisms
CN1639183A (en) * 2002-02-08 2005-07-13 金克克国际有限公司 Secretion, transcription and sporulation genes in bacillus clausii
CN101903519A (en) * 2007-12-21 2010-12-01 丹尼斯科美国公司 Enhanced protein production in bacillus
CN105802985A (en) * 2016-04-18 2016-07-27 齐鲁工业大学 Method for achieving bacillus licheniformis gene knockout rapidly

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1513057A (en) * 2001-05-29 2004-07-14 ������������ʽ���� Host microorganisms
CN1639183A (en) * 2002-02-08 2005-07-13 金克克国际有限公司 Secretion, transcription and sporulation genes in bacillus clausii
CN101903519A (en) * 2007-12-21 2010-12-01 丹尼斯科美国公司 Enhanced protein production in bacillus
CN105802985A (en) * 2016-04-18 2016-07-27 齐鲁工业大学 Method for achieving bacillus licheniformis gene knockout rapidly

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110055204A (en) * 2019-05-10 2019-07-26 齐鲁工业大学 A kind of method and application for knocking out II Q and pcf gene of spo and improving the lichen bacillus ferments producing enzyme
CN110055204B (en) * 2019-05-10 2020-04-10 齐鲁工业大学 Method for improving fermentation enzyme production of bacillus licheniformis by knocking out spo II Q and pcf genes and application
CN113621540A (en) * 2021-08-11 2021-11-09 沈阳农业大学 Bacillus clausii strain and screening method and application thereof
CN113621540B (en) * 2021-08-11 2023-01-06 沈阳农业大学 Bacillus clausii strain and screening method and application thereof

Also Published As

Publication number Publication date
CN108929883B (en) 2020-05-01

Similar Documents

Publication Publication Date Title
CN105087456B (en) A method of producing the recombined bacillus subtilis building of specified molecular weight hyaluronic acid
CN107603937A (en) A kind of recombination bacillus coli and its construction method for expressing lysine aminopeptidase
Lakshmikandan et al. Enhancement of growth and biohydrogen production potential of Chlorella vulgaris MSU-AGM 14 by utilizing seaweed aqueous extract of Valoniopsis pachynema
CN107177607A (en) Bacillus subtilis BS04 urate oxidase gene and application thereof
CN105238807A (en) Construction of coenzyme efficient regeneration system and application thereof
CN105505846A (en) Recombinant spore with glutamate dehydrogenase displayed on surface and construction method and application thereof
CN107574173A (en) A kind of recombinant plasmid and its method for building High-productive Monascus Pigment Strain
CN105368767A (en) Recombinant bacillus subtilis for expressing cellobiose-2-epimerase based on D-alanine defective screening, and construction method of recombinant bacillus subtilis
CN105802985A (en) Method for achieving bacillus licheniformis gene knockout rapidly
CN104152506A (en) Method catalytically synthesizing (S)-N, N-dimethyl-3-hydroxy-(2-thiofuran)-1-propylamine((S)-DHTP) by aldehyde ketone reductase recombinant strain crude enzyme system
CN106399216A (en) Single-cell plant for efficiently synthesizing alpha-aminobutyric acid, as well as construction and application thereof
CN105734092A (en) Method for preparing D-tagatose by enzyme process
CN108929883A (en) II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme
CN104195190A (en) Method for producing 5-aminolevulinic acid by carrying out anaerobic fermentation by utilizing recombinant escherichia coli
JP2023133181A (en) Production methods of recombinant escherichia coli and high purity ursodeoxycholic acid
El-Rab et al. Costless and huge hydrogen yield by manipulation of iron concentrations in the new bacterial strain Brevibacillus invocatus SAR grown on algal biomass
CN105200076A (en) Bacillus subtilis recombined to express gamma-lactamase and immobilization and application
CN105349583A (en) Method for preparing (R)-o-chloromandelic acid through enzyme and application of enzyme
CN105255934A (en) Strategy for efficiently coproducing alpha-aminobutyric acid and gluconic acid
CN104726388B (en) A kind of Pullulanase bacterium producing multi enzyme preparation and the method for improving its enzymatic productivity
CN108949784A (en) Application of the sporulation related gene sigmaF in producing enzyme
CN101285085B (en) Process for synthesizing adenosine methilanin by intact cell catalysis
CN104830744A (en) Method for preparing (R)-phenylglycol from SD-AS sequence coupled (R)-carbonyl reductase and glucose dehydrogenase
US11098331B2 (en) Method for producing lysine by utilizing adsorption and immobilized fermentation of recombinant corynebacterium glutamicum
CN107267476B (en) It a kind of lactic dehydrogenase and its is applied in preparing lactic acid

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address

Address after: 250353 University Road, Changqing District, Ji'nan, Shandong Province, No. 3501

Patentee after: Qilu University of Technology (Shandong Academy of Sciences)

Country or region after: China

Address before: 250353 University Road, Changqing District, Ji'nan, Shandong Province, No. 3501

Patentee before: Qilu University of Technology

Country or region before: China